Next Article in Journal
Effects of Plot Size on Airborne LiDAR-Derived Metrics and Predicted Model Performances of Subtropical Planted Forest Attributes
Previous Article in Journal
Rapid Estimation of Decameter FPAR from Sentinel-2 Imagery on the Google Earth Engine
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 13
Issue 12
10.3390/f13122123
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression Pattern Analysis of Larch WRKY in Response to Abiotic Stress

by
Chen Wang
,
Qingrong Zhao
,
Lei Zhang
and
Hanguo Zhang
*
State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, Harbin 150040, China
*
Author to whom correspondence should be addressed.
Forests 2022, 13(12), 2123; https://doi.org/10.3390/f13122123
Submission received: 14 November 2022 / Revised: 8 December 2022 / Accepted: 9 December 2022 / Published: 11 December 2022
(This article belongs to the Section Genetics and Molecular Biology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Larix olgensis is one of the most common tree species in Northeast China; it has the advantages of fast growth and good wood properties. In order to accelerate larch molecular breeding and to provide good candidate genes for larch improvement, based on the existing transcriptome data of Larix olgensis, four WRKY family genes with complete CD regions were obtained by BLAST comparison on the NCBI website. The results of bioinformatics analysis and gene expression after abiotic stress showed that there were some differences in the expression of WRKY1, WRKY2, WRKY3 and WRKY4 in roots, stems and leaves under each treatment. Under the treatment of a 40% PEG6000 solution (polyethylene glycol), the expression of WRKY2 was significantly up-regulated in each time period and WRKY1, WRKY3 and WRKY4 were down-regulated in varying degrees compared with the control group, indicating that they were involved in the response to drought stress. Under the treatment of the 0.2mol/L NaCl solution, the expression of WRKY2 was up-regulated in roots, stems and leaves. The expression amount and the expression trend of the other three genes were different in roots, stems and leaves under different treatment durations, indicating that they were also involved in a salt-stress response. Under the treatment of the 0.1 mol/L NaHCO3 solution, the expression of WRKY4 was significantly down-regulated in all time periods, while WRKY2 was significantly up-regulated. The other two genes were regulated to a certain extent, indicating that they also had a physiological response under alkaline conditions. These results lay a foundation for the study of gene function of these four WRKY transcription factors.

1. Introduction

When facing adversity stress, forest trees regulate gene expression through signal transduction to produce new proteins, resulting in changes in morphological or physiological and biochemical indexes [1,2]. The study of gene expression patterning can reveal the growth law of plants under stress and can provide candidate genes for genetic engineering breeding. At present, the research on genes mainly focuses on transcription factors and functional genes. Transcription factors are a special protein that can bind to the specific nucleotide sequence of related genes and have the function of activating or inhibiting the transcription of target genes [2]. Studies have made it clear that lots of transcription factors participate in the regulation of plant growth and development and abiotic stress at the transcriptional level, such as AP2/ERF, HD-Zip, NAC, MYB and WRKY [3,4,5,6]. WRKY was initially considered to be unique to higher plants [7]. Later, the WRKY gene was identified in ferns, indicating that it originated before the differentiation of prokaryotes and eukaryotes [7]. The WRKY protein belongs to the WRKY family. As one of the larger transcription factor families in plants, the WRKY protein plays an important role in the regulatory network of plant response to drought stress [8,9]. In 1994, the first WRKY gene SPF1 was isolated from sweet potato [10], then ABF1 and ABF2 were obtained from wild oats [11] and WRKY1, WRKY2 and WRKY3 were cloned from wrinkled leaf parsley and named WRKY [12]. The WRKY transcription factor family is a zinc finger transcription factor with a highly conserved domain of 60 amino acids that can bind to DNA. It contains a group of conserved WRKYGQK domains in its N segment and a zinc finger structure of CX4-5CX22-23HXH(C2H2) or CX7CX23HXC(C2HC) in its C end [2,8,13]. In addition, the WRKY family has other potential conserved domains, such as a nuclear localization signal, a proline enrichment region, a glutamate enrichment region and so on, which are also the basis of its functional diversity [14,15]. According to the number of WRKY domains and the type of zinc finger motif, it is usually divided into three subfamilies: I, II and III. The WRKY Ⅰ subfamily contains two WRKY domains and a C2H2 zinc finger structure. The WRKY II subfamily contains a WRKY domain and a C2H2 zinc finger structure. According to the amino acid sequence and phylogenetic relationship, it is divided into five subgroups: IIa, IIb, IIc, IId and IIe, which are divided into three categories: IIa + IIb, IIc and IId + IIe. The WRKY Ⅲ subfamily contains a WRKY domain and a C2HC zinc finger structure [8,16,17]. The WRKY transcription factor is not only widely involved in the response of plants to biological, abiotic and hormone stress [8,18], but also can directly activate or inhibit the expression of functional genes to participate in plant hormone signaling pathways by binding with W-box or cis elements of itself or other transcription factors. The interaction with other proteins plays an important role in plant response to different biological and abiotic stresses [14,19,20,21].
Larix olgensis is a deciduous tree belonging to the larch genus of the pine family. It is mainly distributed in Changbai Mountain, Laoyeling and Wanda Mountains in China. It has strong cold resistance and is a promising tree species for timber and afforestation [1,22,23]. Abiotic factors influencing the growth of larch in Northeast China mainly include drought, low temperature and high salinity [22]. Therefore, this study selected saline alkali stress and PEG-simulated drought stress to treat larch seedlings in order to understand the gene expression pattern of larch under abiotic stress and to reveal the stress resistance mechanism of larch.
At present, there are few studies on the function of the WRKY gene in larch. In order to explore the function of WRKY in larch, the sequences obtained from the existing transcriptome data of Larix olgensis were displayed on the NCBI website (https://blast.ncbi.nlm.nih.gov, accessed on 17 October 2021). Four WRKY family genes (named LoWRKY1, LoWRKY2, LoWRKY3 and LoWRKY4) with complete CD regions were obtained by blast comparison. In order to make up for the vacancy of WRKY gene-related research in larch, four WRKY genes were analyzed by bioinformatics and the expression patterns of these four genes under stress were analyzed, providing some reference for further research on the function of the larch WRKY gene family and its stress resistance mechanism.

2. Materials and Methods

2.1. Test Material

The materials used in the experiment were taken from the seeds of Larix olgensis from Jixi provenance in Heilongjiang Province. The plump and glossy seeds of Larix olgensis were soaked in deionized water for 4–5 days, during which time the water was changed 3–4 times, and then sown in the substrate for the cultivation of V (soil):V (vermiculite):V (perlite) = 5:3:2 (V refers to the volume, the matrix used in this experiment is the substrate for cultivation configured according to this proportion) and covered with film for moisturizing. The conditions for the plant growth and culture were 16 h of light, 8 h of darkness, 75% humidity and 22 °C constant temperature. The larch grew for about 30 days, that is, until the needles were fully extended. The seedlings with good growth were selected and transplanted into the seedling basin for further growth. There were ten larch seedlings in each pot, with a total of 36 pots of seedlings, which was convenient for repeated experiments in the later stage. According to the preliminary experimental results of our laboratory [6], the following concentrations were selected to treat larch seedlings. Two-month-old larch seedlings were treated with the 0.2 mol/L NaCl solution, 0.1 mol/L NaHCO3 solution and 40% PEG6000 solution, respectively (each treatment was repeated three times). After treatment for 12, 24, 48 and 96 h, the gene expression was analyzed in the roots, stems and leaves (untreated plants of the same age served as the control group).
The gene sequence of WRKY was obtained by designing primers based on the transcriptome sequencing results obtained earlier and by sequencing the cloned gene again.

2.2. Test Method

2.2.1. Bioinformatics Analysis

Four full-length genes of the WRKY transcription factor family were classified according to their conserved domain (CD) characteristics by using Bioedit bioanalysis software. BIOXM software was used to translate the four genes into corresponding amino acid sequences and then ExPASY online software was used to analyze their protein physical and chemical properties in order to obtain the protein molecular weight, isoelectric point, fat coefficient, stability coefficient and other physical and chemical properties of the four WRKY genes. SOPMA and SWISS MODEL online software were used to analyze the secondary and tertiary structures of proteins and the WOLF PSORT website was used to predict subcellular localization. The bioinformatics analysis website refers to the article [24] of Peiqi An et al., (Table 1).

2.2.2. Real-Time Fluorescence Quantitative PCR

The temporal and spatial expression pattern of the WRKY gene in larch and its participation in abiotic stress response were analyzed by real-time fluorescence quantitative PCR. In this study, the RNA of Larix olgensis root, leaf and stem samples was extracted by PureLinkTMPlant RNA Reagent (Bioteke); the extraction steps were carried out according to the instructions of the RNA extraction kit. The RNA of Larix olgensis samples was reverse transcribed to obtain cDNA by a reverse transcription PrimeScript RT reagent Kit Perfect Real Time (TaKaRa) kit. The gene quantitative primer (Table 2) was designed by Primer5 software. The fluorescent quantitative reagent was an SSYBR Premix Ex TaqII (Tli RNaseH Plus) kit from the Takara company. The test steps were carried out according to the instructions in the kit (Table 3). An ABI7500 fluorescence quantitative PCR instrument was used to analyze the dissolution curve after the reaction. The dissolution curve was analyzed according to the standard procedure of the ABI7500 instrument. By exporting the Ct values, the difference between the three Ct values should be less than 1. The calculation method used was the −ΔΔCt calculation, using Microsoft Excel 2016 for data analysis and mapping. A-Tubulin was used as the internal reference gene (NCBI accession number is MF278617.1) and the stress 0 h sample was used as the control.
The reaction conditions of real-time fluorescence quantitative PCR are as follows: 94 °C 30 s, 94 °C 5 s, 60 °C 15 s and 72 °C 10 s. A total of 40 to 45 cycles are required from the second step to the fifth step. The qRT-PCR reaction system refers to the article of Jiali Zhao et al., [25].

3. Results

3.1. WRKY Sequence Analysis of Larix olgensis

According to the sequence alignment results (Figure 1), the N-terminal of the four genes has a conserved WRKYGQK domain and the C-terminal contains a C2H2 type zinc finger structure. According to the number of WRKY domains and the relationship type of the zinc finger motif, the four genes are classified. It can be determined that the four genes belong to a WRKYⅡ subfamily. The difference between amino acid sequences in the zinc finger structures of LoWRKY2, LoWRKY3 and LoWRKY4 shows that they belong to different subgroups than LoWRKY1. Four WRKY genes of Larix olgensis and some genes of the Arabidopsis WRKYⅡ subfamily were used to construct a phylogenetic tree (Figure 2). According to the clustering, LoWRKY1 and the WRKYⅡd subfamily in Arabidopsis belong to the same branch and the genetic relationship is more than 87%, so it can be inferred that LoWRKY1 belongs to the WRKYⅡd + IIe subfamily. Similarly, LoWRKY2, LoWRKY3 and LoWRKY4 belong to the WRKYⅡc subfamily, according to their genetic relationship.
Following the name of the Arabidopsis gene the subgroup to which the gene belongs is indicated. For example, AtWRKY56 IIc indicates that AtWRKY56 belongs to the WRKY IIc subgroup.
The analysis of the physical and chemical properties of the WRKY transcription factor family genes of Larix olgensis indicated that the length of the four WRKY genes ranged from 800 to 1300 bp and the molecular weight of the full-length genes ranged from 32,314.77 Da to 44,904.72 Da. The isoelectric point of protein is about 6–9, in which the PI of LoWRKY2 and LoWRKY3 is less than 7 and is negatively charged, while the other two are positively charged. The fat coefficient is between 52.93–62.01, which indicates that the protein thermal stability of the WRKY gene family is high. However, the instability coefficient of LoWRKY2 is lower than 40, which indicates unstable protein; the other three indicate stable protein. The average coefficient of hydrophobicity is negative, which indicates that WRKY proteins are hydrophilic. On the basis of the analysis of signal peptides, WRKY proteins do not have signal peptides, indicating that they are non-secretory proteins. The subcellular localization of four WRKY family genes was predicted by the WOLF PSIRT website; they were all located in the nucleus (Table 4).
After predicting the secondary structural characteristics of four WRKY transcription factor family genes (Figure 3), it is found that the LoWRKY protein has alpha helix (Hh), extended strand (Ee), beta turn (Tt) and random coil (Cc) structures. Random coil (CC) and alpha helix (Hh) are the main components of the protein structure of the family, accounting for more than 70% of the total of the four genes (Table 5). Among the four genes, LoWRKY3 accounted for the largest proportion of alpha helix (Hh), beta turn (TT) and extended strand (EE), and LoWRKY1 accounted for the largest proportion of random coil (CC). The biological activity of protein is closely related to its specific spatial structure. Protein secondary structure is the basis of analyzing protein structure and is of great significance to understand the function of protein.
In this study, the amino acid sequences of four WRKY transcription factors of Larix olgensis were modeled by three-dimensional homology. According to the prediction results (Figure 4), it can be seen that the tertiary structure similarity of the amino acid sequence of the same subgroup is high, but the spatial angle is not completely the same due to the different length and distribution of alpha helix (Hh), beta turn (TT) and extended strand (EE). The secondary structure of the protein further curls and folds to form the tertiary structure of the protein. A polypeptide chain has a tertiary structure before it has biological activity. Therefore, understanding its tertiary structure characteristics is of great significance to understand the function of protein.

3.2. Analysis of WRKY Gene Expression Pattern of Larix Olgensis under Abiotic Stress

3.2.1. Expression Pattern Analysis of WRKY in Response to PEG6000 Stress

When two-month-old larch seedlings were treated with 40% PEG6000 solution, the expression of four WRKY genes showed that all four genes responded to stress treatment. There were also some differences in the expression of the four genes in the roots, stems and leaves (Figure 5).
The expression of WRKY2 was significantly up-regulated in each time period of 40% PEG6000 solution treatment. The expression in the roots was the highest at 48 h, about 7 times higher than in the control group; the expression in the stem was the highest at 12 h, about 8 times higher than in the control group; the expression in the leaves was the highest at 48 h, about 16 times higher than in the control group; the expression of WRKY2 at 12 h, 48 h and 96 h showed leaf > stem > root. The expression of WRKY4 was significantly down-regulated in the 40% PEG6000 solution at all times; the expression in the roots was the lowest at 96 h, about four times lower than in the control group; the expression in the stem was the lowest at 48 h, about four-and-a-half times lower than in the control group; the expression in the leaves was the lowest at 24 h, which was about seven times lower than in the control group.
WRKY1 and WRKY3 were down-regulated in most cases compared with the control group. The expression of WRKY1 in the roots was the lowest at 96 h, down-regulated by about one-and-a-half times; the expression in the stems and leaves reached the lowest at 48 h. The expression of WRKY3 in the roots and stems reached the lowest at 48 h, down-regulated by about three-and-a-half times. The gene expression was up-regulated in the leaves that were treated for 12 h, 24 h and 96 h.

3.2.2. Expression Pattern Analysis of WRKY in Response to Salt Stress

After treatment with 0.2 mol/L NaCl solution, the quantitative results showed that the expression amount and expression trend of four WRKY genes were different in roots, stems and leaves under different treatment durations (Figure 6).
WRKY1 was up-regulated in roots and leaves after NaCl stress. The expression in the roots was the highest at 48 h, about 1.3 times higher than the control group; the expression in the leaves was the highest at 12 h, up-regulated about 2.5 times compared with the control group; the expression in the stems was down-regulated by about 1.8 times when treated for 12 h. WRKY3 was down-regulated in the roots and stems after NaCl stress and reached the lowest at 12 h; the expression was mostly up-regulated in the leaves and the expression was the highest at 24 h, up-regulated by about 1.1 times compared with the control group. WRKY4 basically showed a downward trend after NaCl stress; the expression in the roots was the lowest at 24 h, about three times down-regulated; the expression of the stems and leaves was the lowest at 12 h, down-regulated by five and four times, respectively.
WRKY2 was up-regulated in the roots, stems and leaves after NaCl stress. The expression in the roots and leaves reached the highest at 48 h, up-regulated by about six and four times, respectively, compared with the control group; the expression in the stem reached the highest at 24 h, up-regulated by about 8.5 times compared with the control group.

3.2.3. Expression Pattern Analysis of WRKY in Response to NaHCO3 Stress

Under the treatment of the NaHCO3 solution with the concentration of 0.1 mol/L, the four WRKY genes were differentially regulated in varying degrees (Figure 7).
The expression of WRKY2 was significantly up-regulated in each time period treated with the 0.1 mol/L NaHCO3 solution. The expression in the roots and leaves was the highest at 48 h, about five and four times higher than the control group, respectively; the expression in the stems was the highest at 12 h, about 6.5 times higher than the control group. The expression of WRKY4 in the 0.1mol/L NaHCO3 solution decreased significantly in all time periods; the expression in the roots was the lowest at 24 h and the expression in stems was the lowest at 12 h, which were more than five times lower than the control group; the expression level in the leaves was the lowest at 96 h, which was about 4.5 times lower than the control group.
The expression of WRKY1 in the roots was the highest at 48 h, up-regulated about one-fold; the expression was mostly down-regulated in the stems and reached the lowest at 96 h; the expression was mostly up-regulated in the leaves and was the highest at 12 h. The expression of WRKY3 in the 0.1mol/L NaHCO3 solution was mostly down-regulated; the expression in the roots and stems reached the lowest at 96 h, down-regulated by about four and three times, respectively; the gene expression was up-regulated in the leaves treated for 12 h.

4. Discussion

4.1. Identification and Physicochemical Properties Analysis of WRKY Gene of Larix Olgensis

The bioinformatics analysis of genes is the most basic part for understanding the basic information of genes. If this analysis is not carried out, it is difficult to carry out follow-up in-depth research on genes. Therefore, the analysis of gene bioinformatics is very necessary to understand the classification and function of genes.
In recent years, there have been many identifications made and much research conducted on plant WRKY genes. For example, 122 WRKY gene family members have been identified in the poplar family and the WRKY gene has been found to play an important role in the response to drought stress [26]. There are 74 WRKY genes identified in the model plant Arabidopsis. A large number of studies have found that WRKY genes are involved in not only biological stress but also abiotic stress in Arabidopsis [27,28]. A total of 197 WRKY family gene sequences have been published in soybean and the class I, II and III genes of the soybean WRKY family are involved in stress regulation [29]. A total of 59 WRKY genes were identified in the melon genome. Studies have proved that the melon WRKY gene plays an important role in response to low-temperature stress [30]. A large number of related studies provide a reference basis for the function of the WRKY gene family in regulating plant response to stress, but the function of the larch WRKY gene family has not been reported.
Based on the transcriptome data of the Larix olgensis cambium, using the sequence of the Arabidopsis WRKY gene family as the comparison basis on the NCBI website, this study identified and obtained four WRKY family genes with complete CD regions, which are less than other known species. The four WRKY family genes of Larix olgensis have strong hydrophilicity and high stability. The secondary structure prediction shows that random coil (CC) and alpha helix (Hh) account for the largest proportion (similar to the research results of grape [31], eucalyptus [32] and chestnut [33]), which provides a basis for further identification of the WRKY family gene function of Larix olgensis. The secondary structure of each gene has high similarity, but there are differences in the tertiary structure. The similarity and difference of the protein structure will lead to some similarity and difference in its function, and the properties of these proteins may be related to the function of the gene family. The results of this study provide a reference for further study of the function of the gene family in larch.

4.2. Differential Expression Analysis of WRKY Gene in Larix olgensis under Abiotic Stress

The WRKY transcription factor family widely exists in a variety of plants. A large number of studies have shown that WRKY transcription factor family genes are not only involved in regulating a variety of physiological processes of plants [34] but also involved in responding to environmental signal stimuli, such as abiotic stresses such as drought, high salt and low temperature [35]. Therefore, in-depth studies of the regulatory mechanism of the WRKY transcription factor will help to understand the molecular mechanism of larch in response to various stress processes.
At present, the research on WRKY family genes is very extensive and a large number of studies show that WRKY genes are involved in the response to drought stress. A Northern-blot analysis of 13 OsWRKY transcription factor genes in rice showed that 10 OsWRKY genes could respond to drought stress in varying degrees [36]. The overexpression of the TaWRKY19 gene in Arabidopsis enhanced the drought tolerance of transgenic plants [37]. The Fraxinus mandshurica FmWRKY40 gene was significantly up-regulated under drought stress, indicating that this gene may play an important regulatory role in the response to drought stress [38]. In this study, larch seedlings were subjected to simulated drought stress with 40% PEG6000 solution, and the four WRKY family genes were differentially regulated in varying degrees. The LoWRKY2 gene was significantly up-regulated in the roots, stems and leaves, which was similar to the research conclusions of Li Sen [39] and Zhang Xu [40]. This indicates that the expression of this gene is up-regulated by drought stress and it is speculated that the ability to resist stress may be improved by regulating other drought-resistant genes downstream. The expression of the LoWRKY2 gene in larch under PEG stress shows that leaf > stem > root, indicating that the gene responds more easily to drought and express in leaves. LoWRKY4 showed an obvious down-regulated expression trend in roots, stems and leaves, which was similar to the expression pattern of the HrWRKY1 gene in Seabuckthorn [41], and the expression amount of the LoWRKY4 gene reached the extreme value in the leaves, stems and roots 24 h, 48 h and 96 h after PEG stress, indicating that the gene may first respond to drought stress in the leaves and then transmit to the roots through the stems. After PEG treatment, LoWRKY1 and LoWRKY3 were down-regulated in the roots and stems, the SlWRKY24 and SlWRKY50 genes in tomato were down-regulated after 20% PEG treatment [42], while LoWRKY1 and LoWRKY3 in leaves were up-regulated first and then down-regulated, while MaWRKY47 gene in banana showed similar expression after drought treatment [43]. This may be due to the different expression patterns of the gene in leaves and rhizomes, with mainly negative responses in rhizomes. The above conclusions indicate that these four genes may participate in the drought response of larch, which proves that the WRKY gene family is closely related to the drought-stress resistance of larch.
According to this study, LoWRKY1 and LoWRKY2 were up-regulated in roots under salt stress, which was consistent with the research conclusion in upland cotton. Zhou et al. identified 26 WRKY genes in upland cotton, and 5 of them were up-regulated in roots under NaCl induction [44]. LoWRKY3 and LoWRKY4 were down-regulated in the roots. After salt treatment of upland cotton by Cai Jihong and others, WRKY22, WRKY52 and WRKY90 were down-regulated in the roots [45]. Under salt stress, LoWRKY1 and LoWRKY3 were first down-regulated and then up-regulated in the stems of larch, which was similar to the expression trend of the LpWRKY20 gene in the fine leaf lily under salt stress [46]. LoWRKY2 was significantly up-regulated after treatment, which was consistent with the expression of WRKY family genes in Xiaojin begonia [47] and rice [48]. LoWRKY4 was significantly down-regulated, which was consistent with the expression trend of the SlWRKY24 gene in tomato [39]. However, LoWRKY1, LoWRKY2 and LoWRKY3 were up-regulated in larch leaves after salt stress, which was similar to that in tomato [49] and Hevea brasiliensis [50]. LoWRKY4 was down-regulated, which was similar to the expression of the ClWRKY75 gene [51] in lemon. In this study, when larch was treated with the 0.2mol/L NaCl solution, LoWRKY2, LoWRKY3 and LoWRKY4 first reached the extreme value in the stem, indicating that these three genes responded to salt stress signals first in the stem. LoWRKY1 reached the extreme value at 12 h in the leaves, significantly earlier than that in the roots (48 h), indicating that the gene responds to salt stress signal first in leaves and is then transmitted to roots. LoWRKY2 was up-regulated after salt stress, while LoWRKY4 was down-regulated after salt stress, indicating that they responded to salt stress through opposite expression patterns, suggesting that they may have antagonistic relationship under salt stress.
The saline–alkali land in inland China is mainly saline and alkaline mixed soil [52], so it is also of great significance to explore the gene expression pattern under alkaline conditions. The expression trend of LoWRKY2 and LoWRKY4 under the 0.1mol/L NaHCO3 treatment was similar to that under salt stress, that is, LoWRKY2 and LoWRKY4 genes were significantly up-regulated and down-regulated in the roots, stems and leaves, respectively. The expression of LoWRKY1 reached the extreme value in leaves after 12 h of NaHCO3 treatment and reached the extreme value in stems and roots at 48 h and 96 h, respectively. This conclusion is also very similar to the gene expression pattern under salt stress. The reason for this phenomenon may be the ion imbalance caused by the accumulation of a large amount of Na+ and the ion toxicity will lead to a series of changes in plants [53,54]. Both the NaHCO3 solution and the NaCl solution are rich in Na+, so the gene expression pattern is similar. In maize, the ZmWRKY45 gene was up-regulated under the NaHCO3 treatment [55], and the GsWRKY15 gene in soybean was also up-regulated under alkali stress [56], which was consistent with the expression trend of LoWRKY1 in roots and leaves and LoWRKY2 in this study. This expression of LoWRKY1 may be due to the gene being more sensitive to alkaline stress in leaves and roots, so it can reach the extreme value of expression earlier; this signal may be transmitted to the stem through the leaves and roots, so it finally reaches the extreme value of expression in the stem. LoWRKY3 was mainly down-regulated under alkaline stress, indicating that the gene was negatively responsive to alkaline stress.
LoWRKY2 was always up-regulated under the three treatments, while LoWRKY4 was always down-regulated under the three treatments, which showed that the expression trend of these two genes had not changed under the three treatments, only the expression amount had changed. This phenomenon indicates that the gene regulation mechanism is basically the same under drought and saline–alkali stress, which may be caused by the change of osmotic pressure in plants under stress.

5. Conclusions

In this study, the bioinformatics and gene expression patterns of four WRKY genes in Larix olgensis were examined. The results discussed above indicate that the four genes belong to the WRKY II subfamily and have the same conserved domains and similar protein secondary and tertiary structures, so they may have similar functions. The gene expression of WRKY under various abiotic stresses also indicates that it may participate in the response to abiotic stress. Among them, LoWRKY2 was always up-regulated under the three treatments, while LoWRKY4 was always down-regulated under the three treatments and the expression level was higher than the other two genes. It shows that their expression patterns are completely opposite under stress and that there may be an antagonistic relationship between them. In the future, four genes will be cloned and transformed to further study the function of this gene in plants.

Author Contributions

Conceptualization, L.Z. and H.Z.; methodology, C.W., L.Z. and H.Z.; software, C.W. and Q.Z.; validation, Q.Z.; writing—review and editing, C.W.; supervision, Q.Z., L.Z. and H.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant No. 31700595), National Science and Technology Major Project (2018ZX08020003-001-001) and the Fundamental Research Funds for the Central Universities (2572019BA13), Heilongjiang Touyan Innovation Team Program.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, W.; Li, C.; Yang, J.; Zhang, H.; Zhang, S. Somatic embryogenesis and plantlet regeneration from immature zygotic embryos of Hybrid larch. Sci. Silvae Sin. 2009, 45, 34–38. [Google Scholar]
  2. Chen, H.; Lai, L.; Li, L.; Liu, L.; Jakada, B.H.; Huang, Y.; He, Q.; Chai, M.; Niu, X.; Qin, Y. AcoMYB4, an Ananas comosus L. MYB Transcription Factor, Functions in Osmotic Stress through Negative Regulation of ABA Signaling. Int. J. Mol. Sci. 2020, 21, 5727. [Google Scholar] [CrossRef] [PubMed]
  3. Cao, Q.; An, P.; Zhang, S.; Wang, J.; Zhang, H.; Zhang, L. Preliminary analysis of two NAC transcription factor expression patterns in Larix olgensis. J. For. Res. 2021. prepublish. [Google Scholar] [CrossRef]
  4. Bian, X.; Soo, K.H.; Soo, K.S.; Qian, Z.; Shuai, L.; Peiyong, M.; Zhaodong, J.; Yizhi, X.; Peng, Z.; Yang, Y. Different Functions of IbRAP2.4, a Drought-Responsive AP2/ERF Transcription Factor, in Regulating Root Development between Arabidopsis and Sweetpotato. Front. Plant Sci. 2022, 13, 820450. [Google Scholar] [CrossRef]
  5. Guo, Q.; Jiang, J.; Yao, W.; Li, L.; Zhao, K.; Cheng, Z.; Han, L.; Wei, R.; Zhou, B.; Jiang, T. Genome-wide analysis of poplar HD-Zip family and over-expression of PsnHDZ63 confers salt tolerance in transgenic Populus simonii × P.nigra. Plant Sci. 2021, 311, 111021. [Google Scholar] [CrossRef]
  6. Yin, M.; Pan, G.; Tao, J.; Doblin, M.S.; Zeng, W.; Pan, L.; Zhao, L.; Li, Z.; Jiang, H.; Chang, L.; et al. Identification of MYB genes reveals their potential functions in cadmium stress response and the regulation of cannabinoid biosynthesis in hemp. Ind. Crops Prod. 2022, 180, 114607. [Google Scholar] [CrossRef]
  7. Zhang, Y.; Wang, L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1. [Google Scholar] [CrossRef] [Green Version]
  8. Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
  9. Zhang, T.; Tan, D.; Zhang, L.; Zhang, X.; Han, Z. Phylogenetic analysis and drought-responsive expression profiles of the WRKY transcription factor family in maize. Agri Gene 2017, 3, 99–108. [Google Scholar] [CrossRef]
  10. Sumie Ishiguro, K.N. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1,that recognizes SP8 sequences in the 5′upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol. Gen. Genet. 1994, 244, 563–571. [Google Scholar] [CrossRef]
  11. Rushton, P.J.; Macdonald, H.; Huttly, A.K.; Lazarus, C.M.; Hooley, R. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes. Plant Mol. Biol. 1995, 29, 691–702. [Google Scholar] [CrossRef] [PubMed]
  12. Rushton, P.J.; Torres, J.T.; Parniske, M.; Wernert, P.; Hahlbrock, K.; Somssich, I.E. Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J. 1996, 15, 5690–5700. [Google Scholar] [CrossRef] [PubMed]
  13. Jiang, J.; Ma, S.; Ye, N.; Jiang, M.; Cao, J.; Zhang, J. WRKY transcription factors in plant responses to stresses. J. Integr. Plant Biol. 2017, 59, 86–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Ren, Y.; Wang, D.; Su, Y.; Wang, L.; Zhang, X.; Su, W.; Que, Y. Structure, Classification, Evolution and Function of Plant WRKY Transcription Factors. J. Agric. Biotechnol. 2021, 29, 105–124. [Google Scholar]
  15. Sun, X.; Li, J.; Yuan, J.; Wang, H.; Du, T. Research Progress in the Role of WRKY Transcription Factor in Plant Drought Response Mechanism. Chin. J. Inf. TCM 2021, 28, 138–144. [Google Scholar]
  16. Chen, C.; Chen, Z. Isolation and characterization of two pathogen and salicylic acid-induced genes encoding WRKY DNA-binding proteins from tobacco. Plant Mol. Biol. 2000, 42, 387–396. [Google Scholar] [CrossRef]
  17. Li, W.; Pang, S.; Lu, Z.; Jin, B. Function and Mechanism of WRKY Transcription Factors in Abiotic Stress Responses of Plants. Plants 2020, 9, 1515. [Google Scholar] [CrossRef]
  18. Finatto, T.; Viana, V.E.; Woyann, L.G.; Busanello, C.; Maia, L.C.; Oliveira, A.C. Can WRKY transcription factors help plants to overcome environmental challenges? Genet. Mol. Biol. 2018, 41, 533–544. [Google Scholar] [CrossRef] [Green Version]
  19. Agarwal, P.; Reddy, M.; Chikara, J. WRKY: Its structure, evolutionary relationship, DNA-binding selectivity, role in stress tolerance and development of plants. Mol. Biol. Rep. 2011, 38, 3883–3896. [Google Scholar] [CrossRef]
  20. Birkenbihl, R.P.; Kracher, B.; Roccaro, M.; Somssich, I.E. Induced genome-wide binding of three Arabidopsis WRKY transcription factors during early MAMP-triggered immunity. Plant Cell 2017, 29, 20–38. [Google Scholar] [CrossRef] [Green Version]
  21. Zou, L.; Yang, F.; Ma, Y.; Wu, Q.; Yi, K.; Zhang, D. Transcription factor WRKY30 mediates resistance to Cucumber mosaic virus in Arabidopsis. Biochem. Biophys. Res. Commun. 2019, 517, 118–124. [Google Scholar] [CrossRef] [PubMed]
  22. Li, J. Current status and development strategies of wood fiber raw materials for pulp and papermaking in China. World For. Res. Inst. 2003, 16, 32–35. [Google Scholar]
  23. Han, F. Study on the Sharpness Equation of Larch Plantation; Northeast Forestry University: Harbin, China, 2010. [Google Scholar]
  24. An, P.; Cao, Q.; Wang, C.; Wang, J.; Zhang, H.; Zhang, L. Spatiotemporal expression and bioinformatic analyses of the HD-zip transcription factor family in Larix olgensis. Plant Mol. Biol. Report. 2021, 39, 212–225. [Google Scholar] [CrossRef]
  25. Zhao, J.; Xiong, H.; Wang, J.; Zhang, H.; Zhang, L. Mining Myb transcription factors related to wood development in Larix olgensis. J. For. Res. 2020, 31, 2453–2461. [Google Scholar] [CrossRef]
  26. Zhou, J.; Zeng, M.; An, X. Identification of Populus trichocarpa WRKY Gene Family and Its’ Response to Drought Stress. Chin. J. Cell Biol. 2019, 41, 2160–2173. [Google Scholar]
  27. Qian, J.; Qi, X.; Xie, L.; Zhang, Y. Research Advances about Function of WRKY Family Gene in Arabidopsis thaliana. J. Anhui Agri. Sci. 2014, 42, 1295–1297, 1301. [Google Scholar]
  28. Li, Q.; Li, Y.; Niu, F.; Guo, X.; Zhao, X.; Wu, X.; Yang, B.; Jiang, Y. Characterization and Stress-resistance Functional Identification of Transcription Factor Gene WRKY72 in Arabidopsis thaliana. J. Agric. Biotechnol. 2019, 27, 191–203. [Google Scholar]
  29. Li, H.; Lei, J.; Wu, X.; Wang, X.; Ma, Y. Studies on WRKY Transcription Factors and Their Biological Functions in Soybean. Soybean Sci. 2019, 38, 813–820. [Google Scholar]
  30. Zhang, G.; Wei, B. Identification of WRKY Gene Family and Their Expression Analysis Under Low-temperature Stress in Melon (Cucumis melo). J. Agric. Biotechnol. 2020, 28, 1761–1775. [Google Scholar]
  31. Hou, L.; Wang, W.; Liu, X. Bioinformatics Analysis of VvWRKY71 Transcription Factor in Vitis vinifera L. Chin. Agric. Sci. Bull. 2013, 29, 123–128. [Google Scholar]
  32. Wang, P.; Wei, C.; Qin, L.; Yang, L.; Zhang, Z.; Wu, Y.; Qin, Z.; Cai, L.; Huang, J.; Gao, L.; et al. In Silico Cloning and Bioinformatics Analysis of EcWRKY50 Transcription Factors in Eucalyptus camaldulensis. Agric. Res. Appl. 2014, 04, 9–16. [Google Scholar]
  33. Liu, Y.; Zhu, T.; Liu, Y.; Qiao, T.; Li, S.; Long, X.; Han, S. Cloning, Sequence Analysis and Prokaryotic Expression of CmWRKY from Castanea mollissima BL. Acta Agric. Boreali-Sin. 2019, 34, 37–45. [Google Scholar]
  34. Dong, Y.; Wang, Y.; Wang, Z.; Wei, D.; Tang, Q. Molecular mechanism of WRKY12 in regulating plant development. Chin. J. Biotechnol. 2021, 37, 142–148. [Google Scholar]
  35. Ulker, B.; Somssich, I.E. WRKY transcription factors:from DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Qiu, Y.; Jing, S.; Fu, J.; Li, L.; Yu, D. Cloning and analysis of expression profile of 13 WRKY genes in rice. Chin. Sci. Bull. 2004, 49, 2159–2168. [Google Scholar] [CrossRef]
  37. Niu, C.F.; Wei, W.E.I.; Zhou, Q.Y.; Tian, A.G.; Hao, Y.J.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, Z.B.; Zhang, J.S. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012, 35, 1156–1170. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, Y.; He, L.; Zhao, X.; Liang, N.; Li, X.; Liang, X.; Zhan, Y. Cloning and Expression Analysis of FmWRKY40 Gene in Fraxinus mandshurica. Mol. Plant Breed. 2017, 15, 833–838. [Google Scholar]
  39. Li, S.; Wang, Q.; Chen, X.; Zhang, R.; Li, L.; Du, G.; Fu, X. Cloning and Expression Analysis of Transcription Factor PpWRKY18 in Peach. J. Nucl. Agric. Sci. 2021, 35, 1987–1993. [Google Scholar]
  40. Zhang, X.; Ling, H.; Liu, F.; Huang, N.; Wang, L.; Mao, H.; Li, C.; Tang, H.; Su, W.; Su, Y.; et al. Cloning and Expression Analysis of aⅡd Sub-Group WRKY Transcription Factor Gene from Sugarcane. Sci. Agric. Sin. 2018, 51, 4409–4423. [Google Scholar]
  41. Wang, Z.; Feng, R.; Zhang, X.; Su, Z.; Wei, J.; Liu, J. Cloning and Expression Analysis of Transcription Factor Gene HrWRKY1 in Seabuckthorn (Hippophae rhamnoides). Mol. Plant Breed. 2019, 17, 5638–5643. [Google Scholar]
  42. Chen, Q.; Zhang, H.; Jiang, J.; Li, J. Partial WRKY genes expression under non-biological stress and analysis of SlWRKY50 gene silencing in tomato. J. Northeast Agric. Univ. 2018, 49, 8–18. [Google Scholar]
  43. Jia, C.; Wang, Z.; Zhang, J.; Wang, J.; Miao, H.; Liu, J.; Jin, Z.; Xu, B. Cloning and Expression Analysis of Eight WRKY Transcription Factors in Banana (Musa acuminata L.). Chin. J. Trop. Crops 2018, 39, 2193–2199. [Google Scholar]
  44. Zhou, L.; Wang, N.N.; Kong, L.; Gong, S.Y.; Li, Y.; Li, X.B. Molecular characterization of 26 cotton WRKY genes that are expressed differently in tissues and are induced in seedlings under high salinity and osmotic stress. Plant Cell Tissue Organ Cult. 2014, 119, 141–156. [Google Scholar] [CrossRef]
  45. Cai, J.; Xu, P.; Zhang, X.; Guo, Q.; Xu, Z.; Shen, X. Expression analysis of WRKY gene related to salt tolerance in Cotton under Salt Stress. Jiangsu Agric. Sci. 2018, 46, 28–32. [Google Scholar]
  46. Yang, L.H.; Yin, H.; Huang, Q.M.; Zhang, Y.N.; He, M.; Zhou, Y.W. An analysis of the response of the LpWRKY20 gene to abiotic stress and its role in drought resistance. Acta Prataculturae Sin. 2020, 29, 193–202. [Google Scholar]
  47. Han, D.; Zhou, Z.; Du, M.; Li, T.; Wang, S.; Yang, G. Clone and preliminary functional analysis of Malus xiaojinensis transcription factors gene WRKY48. J. Northeast Agric. Univ. 2020, 51, 36–44. [Google Scholar]
  48. Guo, Y.; Li, P.; Zou, Y.; Xie, D.; Lu, J.; Liu, Q.; Li, Q. Expression and functional analysis of rice OsWRKY78 transcription factor in response to salt stress. J. Yangzhou Univ. (Agric. Life Sci. Ed.) 2019, 40, 18–24. [Google Scholar]
  49. Fan, L.; Gao, Z. Cloning and Expression Analysis of SlWRKY44 Gene in Tomato. North. Hortic. 2018, 22, 6–10. [Google Scholar]
  50. Ma, L. Cloning and Functional Analysis of HbWRKY8Transcription Factor in Hevea Brasiliensis; Hainan University: Haikou, China, 2018. [Google Scholar]
  51. Lu, T.; Yang, L.; Hu, W.; Kuang, L.; Guo, W.; Shen, D.; Liu, D.; Liu, Y. Cloning and expression analysis of Citrus WRKY75 genes in response to abiotic stresses. Acta Agric. Univ. Jiangxiensis 2021, 43, 82–93. [Google Scholar]
  52. Zhang, X.; Shi, Z.; Tian, Y.; Zhou, Q.; Cai, J.; Dai, T.; Cao, W.; Pu, H.; Jiang, D. Salt stress increases content and size of glutenin macropolymers in wheat grain. Food Chem. 2016, 197, 516–521. [Google Scholar] [CrossRef]
  53. Saqib, M.; Akhar, J.; Qureshi, R.H. Na+ exclusion and salt resistance of wheat (Triticum aestivum) in saline-waterlogged conditions are improved by the development of adventitious nodal roots and cortical root aerenchyma. Plant Sci. 2005, 169, 125–130. [Google Scholar] [CrossRef]
  54. Zong, J.; Zhang, Z.; Xue, K.; Wang, S.; Yang, Y. Study on Growth and Physiological Response Mechanism of Xanthoceras sorbifolia Bunge under Salt-alkali Stress. For. Res. 2021, 34, 158–165. [Google Scholar]
  55. Lv, Q.; Gao, S.; He, H.; Sun, L.; Li, Y.; Cai, Z.; Xu, G.; Zhang, J.; Lin, Z.; Song, G.; et al. Expression Analysis of the Maize ZmWRKY45 Gene under the Saline-alkali Adversity Stress. J. Maize Sci. 2017, 25, 28–32. [Google Scholar]
  56. Zhu, P.; Chen, R.; Yu, Y.; Song, X.; Li, H.; Du, J.; Li, Q.; Ding, X.; Zhu, Y. Cloning of Gene GsWRKY15 Related to Alkaline Stress and Alkaline Tolerance of Transgenic Plants. Acta Agron. Sin. 2017, 43, 1319–1327. [Google Scholar] [CrossRef]
Forests 13 02123 g001 550
Figure 1. WRKY transcription factor family gene sequence alignment map (partial sequence). Note: WRKYGQK conserved domain is in the green box and zinc finger structure is in the blue box.
Figure 1. WRKY transcription factor family gene sequence alignment map (partial sequence). Note: WRKYGQK conserved domain is in the green box and zinc finger structure is in the blue box.
Forests 13 02123 g001
Forests 13 02123 g002 550
Figure 2. Phylogenetic trees of LoWRKY protein and Arabidopsis WRKY protein. Note: in the same evolutionary branch, the larger the value, the closer the genetic relationship. The genes added with red dots are those in larch.
Figure 2. Phylogenetic trees of LoWRKY protein and Arabidopsis WRKY protein. Note: in the same evolutionary branch, the larger the value, the closer the genetic relationship. The genes added with red dots are those in larch.
Forests 13 02123 g002
Forests 13 02123 g003 550
Figure 3. Predicted secondary structure of LoWRKY transcription factor family gene proteins. Note: blue: alpha helix, red: extended strand, green: beta turn, purple: random coil.
Figure 3. Predicted secondary structure of LoWRKY transcription factor family gene proteins. Note: blue: alpha helix, red: extended strand, green: beta turn, purple: random coil.
Forests 13 02123 g003
Forests 13 02123 g004 550
Figure 4. Predicted LoWRKY transcription factor family gene protein tertiary structure. Red: alpha helix, blue: random coil, white: beta turn.
Figure 4. Predicted LoWRKY transcription factor family gene protein tertiary structure. Red: alpha helix, blue: random coil, white: beta turn.
Forests 13 02123 g004
Forests 13 02123 g005 550
Figure 5. Gene expression levels at 40% PEG6000 treatment at different times. Note: * indicates a significant difference.
Figure 5. Gene expression levels at 40% PEG6000 treatment at different times. Note: * indicates a significant difference.
Forests 13 02123 g005
Forests 13 02123 g006 550
Figure 6. Gene expression levels at 0.2 mol/L NaCl solution treatment at different times. Note: * indicates a significant difference.
Figure 6. Gene expression levels at 0.2 mol/L NaCl solution treatment at different times. Note: * indicates a significant difference.
Forests 13 02123 g006
Forests 13 02123 g007 550
Figure 7. Gene expression levels at 0.1 mol/L NaHCO3 solution treatment at different times. Note: * indicates a significant difference.
Figure 7. Gene expression levels at 0.1 mol/L NaHCO3 solution treatment at different times. Note: * indicates a significant difference.
Forests 13 02123 g007
Table
Table 1. Bioinformatics analysis software and website used in this paper.
Table 1. Bioinformatics analysis software and website used in this paper.
PurposeSoftware
Physical and chemical properties of proteinExPAsy (http://web.expasy.org/protparam/) accessed on 27 August 2021.
Phylogenetic treeMega 5.0
Signal peptideSignIP (http://www.cbs.dtu.dk/services/SignalP/) accessed on 27 August 2021.
Secondry structureSOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) accessed on 27 August 2021.
Tertiary structureSWISS MODEL (https://www.swissmodel.expasy.org/) accessed on 27 August 2021.
Subcellular localizationWOLF PSORT (http://wolfpsort.hgc.jp/) accessed on 27 August 2021.
Table
Table 2. The primers used in real-time RT-PCR.
Table 2. The primers used in real-time RT-PCR.
Gene NameForward Primers (5′-3′)Reverse Primers (5′-3′)
LoWRKY1TTTCAATGCTCGGAACCACGAGGGGCAAAGCTTAGGAG
LoWRKY2TCTAGTCGCCTAGATTCACTAGGCTTCCTGCGTTTTGAATCAG
LoWRKY3TTCCCAGAGTGATAATTCCGCCACGTTGAGAGTCGTTATATTC
LoWRKY4GGATTAAGCAGCTCAAAACCTCCAGGACATTTCAGTCATCTGATC
Table
Table 3. Real-time fluorescence quantitative PCR reaction system.
Table 3. Real-time fluorescence quantitative PCR reaction system.
ComponentVolume
Template1 μL
Forward Primer1 μL
Reverse Primer1 μL
2 × TransStart Top Green qPCR SuperMix10 μL
Passive Reference Dye (50×) (optional)1 μL
ddH2O6 μL
Total volume20 μL
Table
Table 4. Physical and chemical properties of WRKY transcription factor family genes in Larix olgensis.
Table 4. Physical and chemical properties of WRKY transcription factor family genes in Larix olgensis.
GeneSize
(bp)		Molecular Weight (Da)Theoretical PIAliphatic IndexGrand Average of HydropathicityInstability IndexSignal Peptide
LoWRKY1103537,385.399.3661.54−0.54447.68Non-signal peptide
LoWRKY2123944,904.726.2862.01−0.80738.84
LoWRKY384932,314.776.5557.34−0.87355.74
LoWRKY497536,799.799.0752.93−0.95358.85
Table
Table 5. Secondary structure characteristics of LoWRKY transcription factor family gene proteins.
Table 5. Secondary structure characteristics of LoWRKY transcription factor family gene proteins.
GeneAlpha Helix (Hh)Extended Strand (Ee)Beta Turn
(Tt)		Random Coil (Cc)
LoWRKY117.15%10.17%2.91%69.77%
LoWRKY217.48%13.35%3.16%66.02%
LoWRKY329.43%18.44%8.51%43.62%
LoWRKY428.09%12.96%8.33%50.62%
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, C.; Zhao, Q.; Zhang, L.; Zhang, H. Expression Pattern Analysis of Larch WRKY in Response to Abiotic Stress. Forests 2022, 13, 2123. https://doi.org/10.3390/f13122123

AMA Style

Wang C, Zhao Q, Zhang L, Zhang H. Expression Pattern Analysis of Larch WRKY in Response to Abiotic Stress. Forests. 2022; 13(12):2123. https://doi.org/10.3390/f13122123

Chicago/Turabian Style

Wang, Chen, Qingrong Zhao, Lei Zhang, and Hanguo Zhang. 2022. "Expression Pattern Analysis of Larch WRKY in Response to Abiotic Stress" Forests 13, no. 12: 2123. https://doi.org/10.3390/f13122123

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop