Next Article in Journal
Identification and Functional Analysis of LncRNAs in Response to Seed Aging in Metasequoia glyptostroboides by Third Generation Sequencing Technology
Next Article in Special Issue
Targeted Metabolomics Reveals Impact of N Application on Accumulation of Amino Acids, Flavonoids and Phytohormones in Tea Shoots under Soil Nutrition Deficiency Stress
Previous Article in Journal
Ownership, Governance, Uses, and Ecosystem Services of Community Forests in the Eastern United States
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Characterization of Calmodulin and Calmodulin-like Genes Family in Tea Plant and Their Roles under Abiotic Stress

1
College of Horticulture, Henan Agricultural University, Zhengzhou 450002, China
2
College of Resources and Environment, Henan Agricultural University, Zhengzhou 450002, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Forests 2022, 13(10), 1578; https://doi.org/10.3390/f13101578
Submission received: 16 August 2022 / Revised: 12 September 2022 / Accepted: 16 September 2022 / Published: 26 September 2022
(This article belongs to the Special Issue Dynamics of Upland Soil for Agroforestry Crops)

Abstract

As an important Ca2+ sensor, calmodulin (CaM) and calmodulin-like protein (CML) play core roles in plant growth, development, and response to environmental stimuli. The CaM/CML gene family has been well characterized in various plant species, such as Arabidopsis thaliana, rice, and tomato; however, in the tea plant, the CaM/CML gene family has not been systematically and comprehensively characterized. In the present study, a total of 5 CsCaM and 60 CsCML proteins were identified from the tea plant genome, which were unevenly distributed on the 14 chromosomes of the tea plant. All the proteins contained two to four EF-hand domains. Meanwhile, an integrated analysis of physicochemical properties, sequence structure, motif identification, phylogeny, gene duplication, promoter cis-elements, and RNA-seq expression profiles in the CsCaM/CML gene family was performed. Transcriptome analysis revealed that CsCaM/CMLs were differentially expressed in different tissues of the tea plant, suggesting their potential roles in plant growth and development. The expression profiles associated with various stress treatments revealed that CsCaM/CML genes were involved in a wide range of abiotic factors, including cold and drought stress. Quantitative real-time PCR (qRT-PCR) was also used to validate the differences in expression under abiotic stress. Overall, these findings enhanced our understanding of CsCaM/CML genes and provided useful information for further research into their molecular functions in abiotic stress response, and in multiple physiological processes in the tea plant.

1. Introduction

Calcium (Ca2+) in plants acts as an important intracellular second messenger and is extensively involved in regulating plant growth and development as well as mediating responses to various biotic and abiotic stresses. The Ca2+ signal is not only the core regulator of plant cell physiology but also the plant cellular response to the environment [1,2,3]. When plants are stimulated, for instance by phytohormones, salt, heat, cold, drought, and pathogen attack, they can rapidly cause calcium transients and calcium oscillations via increasing the Ca2+ concentration in the cytoplasm that generate calcium signal transduction and help coordinate adaptive responses [4]. In the process, the perception is that the decoding of transient changes in calcium signal by Ca2+-binding protein sensors is a key regulatory step in the calcium signaling pathway, and four major classes of Ca2+ sensors are presented in plants, namely calmodulins (CaMs), CaM-like proteins (CMLs) [5], calcineurin B-like proteins (CBLs) [6], and Ca2+-dependent protein kinases (CDPKs/CPKs) [7]. The EF-hand domain, which is responsible for Ca2+ binding, is found in all four types of Ca2+ sensors. After binding of Ca2+ ions, the Ca2+ sensors experience a change in protein conformation, which triggers plant responses and amplifies the signal by modulating their activity or capacity to interact with downstream proteins [8,9].
CaMs are highly conserved and the most well-studied Ca2+-binding proteins, present in all eukaryotes and comprising 4 EF-hand motifs, while CMLs are only observed in plants. CMLs share at least 16% of their amino acid identity with typical CaMs, which usually contain 1–6 EF-hand domains and no other identifiable functional domains [10,11]. As a result of genome sequencing in several plant species, the CaM/CML gene family has been characterized at the genome-wide level. A total of 7 AtCaM and 50 AtCML have been identified in Arabidopsis [10], 5 OsCaM and 32 OsCML in rice (Oryza sativa) [12], 6 SpCaM and 45 SpCML in wild tomato (Solanum pennellii) [13], 4 MdCaM and 58 MdCML in apple (Malus x domestica) [14], 3 VviCaM and 62 VviCML in grapevine (Vitis vinifera) [15], 25 BnaCaM and 168 BnaCML in Brassica napus [16], 8 MeCaM and 48 MeCML in cassava (Manihot esculenta) [17], and 34 CaM/CML genes in lotus (Nelumbo nucifera) [18]. However, the bioinformatics of the CaM and CML families in Camellia sinensis have not yet been thoroughly investigated. Despite 5 CsCML genes being discovered and described in the tea plant, they were not named following a standard procedure and were not fully investigated [19].
CaM and CMLs play significant roles in regulating a variety of physiological processes. They participate in pollen tube growth [20,21], seed and fruit development [22,23], flowering [24], cell metabolism [25], root growth [26], and other processes [27]. As previously reported, AtCML39 was involved in regulating seed development, germination, and seedling establishment in Arabidopsis [23]; AtCML42 interacted with kinesin-interacting Ca2+-binding protein (KIC) to regulate trichome branching [28]. AtCaM7 was implicated in light-mediated gene expression, and overexpression AtCaM7 was observed to promote photomorphogenic growth in transgenic plants [29]. Loss and gain of function mutants of cml24 in Arabidopsis thaliana exhibited late and early flowering, respectively [30]. In rice, the OsCaM1-associated OsMKK1-OsMKK6 cascade was found to induce root auxin levels and promote lateral root growth under salt stress [26]. GhCaM7 promoted cotton fiber elongation by modulating the generation of reactive oxygen species (ROS) [31].
Likewise, a great number of studies have shown that the CaM and CML genes are crucial for abiotic and biotic stress responses. AtCML8, CML37, CML38, and CML39 were responsive to pathogenic bacteria, salinity, and hormonal treatment in Arabidopsis [32,33]; AtCML9 was regulated by abscisic acid (ABA) and Pseudomonas syringae infection [34]; AtCML19/42 were involved in the UV stress response of Arabidopsis thaliana and were able to prevent UV damage to the plant [35]. In rice, overexpression of OsCaM1-1 may confer salt stress tolerance through the up-regulation of salt stress response genes [36]; OsMSR2 (OsCML24) significantly enhanced drought and salt tolerance through an ABA-mediated pathway [37]; OsCam1-1, OsCML4, 5, 8, and 11 were induced by osmotic and salt stresses [38]. Apart from Arabidopsis and rice, studies on CaM and CML genes in other plants under abiotic stress have also been reported. ShCML44 from tomato [39], MdCML3 from apple [14], TaCML36 in wheat [40], VaCML21 of grapevine [41], ZmCaM and ZmCML genes of maize [42] were all induced under different abiotic and biotic stresses.
The tea plant (Camellia sinensis) is an evergreen economic plant that grows well in normal temperature, high humidity, and acid soil (pH 4.5–5.5) environments [43]. However, due to the recent occurrence of extreme weather events, the tea plant typically cannot overwinter safely or grow healthily when damaged by drought, heat, salinity, low temperature, or cold spells. Thus, an increasing number of studies have been concentrated on the molecular mechanisms of tea plant stress responses. CaM and CML proteins are types of Ca2+ sensors found in plants that play significant roles in mediating plant tolerance to abiotic stress. Nonetheless, detailed characterization and expression patterns of the CsCaM and CsCML genes family in the tea plant are largely unknown. Herein, we carried out a genome-wide identification and characterization analysis of CsCaM/CMLs, analyzing expression patterns of the tissue-specific profiles and different abiotic stresses. The results will be useful for further exploring the function of CaMs/CMLs in the growth, development, and calcium signaling response of the tea plant in the future.

2. Materials and Methods

2.1. Plant Materials and Treatments

One-year-old tea seedlings (C. sinensis cv. Longjing 43) were pre-cultured in a growth chamber at the Tea Research Laboratory of Henan Agricultural University (Zhengzhou, China). The growth conditions were optimized to a photoperiod of 16 h light (25 ± 1 °C, 240 μmol m−2 s−1) and 75% relative humidity. After two weeks of adaptive growth, the tea seedlings were exposed to adversity stress treatments, including low temperature (10 °C), drought (20% PEG 6000), high salt (200 mmol/L NaCl), and exogenous ABA (100 μmol/L) to investigate the response of CsCaMs and CsCMLs. The third leaf below the top bud of the tea plant was randomly taken after 0, 4, 12, and 24 h treatments. All the samples were frozen in liquid nitrogen immediately and stored at −80 °C for further use. Each treatment was tested in three biological replicates.

2.2. Genome-Wide Identification of CsCaM and CsCML Gene Family in the Tea Plant

The amino acid sequences of the Arabidopsis thaliana CaM and CML family from the TAIR website (https://www.arabidopsis.org/ (accessed on 2 May 2021)) were used as queries to BLAST against the tea plant genome database (TPIA, http://tpdb.shengxin.ren/ (accessed on 15 June 2021)) to identify novel CsCaM and CsCML genes with E-value < 1 ×10−5. Subsequently, we used ‘calmodulin’, ‘EF hand’, ‘calmodulin-like protein’, and ‘PF13499’ as keywords to search for homology in the tea genome database. The obtained candidate protein sequences were verified using the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 4 July 2021)), SMART (http://smart.embl-heidelberg.de/ (accessed on 8 July 2021)), PfamScan (https://www.ebi.ac.uk/Tools/pfa/pfamscan/ (accessed on 12 July 2021)), and InterPro (http://www.ebi.ac.uk/interpro/ (accessed on 19 July 2021)) to eliminate the genes with incomplete domains, and the remaining sequences were used in further analyses.

2.3. Physicochemical Properties, Conserved Domain, Gene Structure, and Phylogenetic Relationships of CsCaM and CsCML Genes

The amino acid sequence length (aa), predicted molecular weight (D), and isoelectric point (pI) of CsCaM/CML family members were investigated using the ExPASy ProtParam tool (http://web.expasy.org/protparam (accessed on 17 August 2021)). The conserved motifs of CsCaM/CML family members were analyzed using the MEME tool (http://meme-suite.org/tools/meme (accessed on 21 August 2021)). The exon and intron structure of each CsCaM and CsCML gene was illustrated using Gene Structure Display Server (GSDS2.0, http://gsds.gao-lab.org/ (accessed on 1 September 2021)). The sequences of CaM/CML family members from the tea plant (CsCaM/CML), Arabidopsis (AtCsCaM/CML), rice (OsCsCaM/CML), and cabbage (BrCaM/CML) were performed to establish a phylogenetic tree by MEGA 7.0 with the neighbor-joining (NJ) method and 1000 bootstrap replicates.

2.4. Promoter Analysis

In order to identify the cis-acting elements in the promoter sequences of the CsCaM and CsCML genes, we isolated the upstream 2000-bp region of the translation start site from the TPIA database and subjected it to the PlantCARE tool (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 15 September 2021)).

2.5. Chromosomal Location and Collinearity Analysis

The identified tea plant CsCaM/CML family genes were examined for chromosomal location and gene collinearity based on the GFF file from the TPIA (tpdb.shengxin.ren/index.html (accessed on 29 September 2021)) and mapped using TBtools software [44]. The Multiple Collinearity Scan (MCScanX) toolkit was used to compare tea plant genome sequences and analyze tandem repeats and fragment repeats [45].

2.6. Expression Analysis of CsCaM and CsCML Gene Family

To analyze the tissue-specific expression patterns of CsCaM/CMLs in the tea plant, which includes root, flower, stem, apical bud, young leaf, fruit, mature leaf, and old leaf, the published transcriptome data were obtained and analyzed from the TPIA database. Moreover, gene expression data under cold and drought stresses were analyzed to better understand the probable function of CsCaM/CMLs in response to abiotic stress. The transcriptomic data were calculated and analyzed using TBtools software [44].

2.7. RNA Extraction and qRT-PCR Assays

Total RNA of the tea plant was extracted using RNAprep Pure Plant Kit (Tian Gen Biochemical Technology Co., Ltd., Beijing, China). The cDNA was generated using the PrimeScript™ RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s protocol. Quantitative reverse-transcription PCR (qRT-PCR) analysis was conducted using the Cham Q Universal SYBR qPCR Master Mix (Vazyme, China) on the Applied Biosystems 7500 FAST platform (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences used for qRT-PCR are listed in Table 1. For data normalization, the CsPTB (GenBank accession number: GAAC01052498.1) gene served as the internal control, and the relative expression was calculated according to the 2−ΔΔCt method [46]. The qRT-PCR program was as follows: 95 °C for 30 s; 40 cycles of 95 °C for 5 s, and 60 °C for 34 s.

3. Results

3.1. Genome-Wide Identification of CaM and CML Genes in the Tea Plant

In total, 5 CsCaMs and 60 CsCMLs were identified from the tea plant genome, and named according to homology with AtCaM/CML genes (Table 2). The CsCaM/CML proteins ranged in length from 86 (CsCML48) to 340 (CsCML19) amino acids, and their molecular weight (MW) ranged between 9.94 and 35.29 kDa. The theoretical isoelectric points (pI) values of the CsCaM and CsCMLs ranged from 3.95 to 6.32, with CsCML60 having the lowest (pI 3.95) and CsCML7/55 having the highest (pI 7.74), indicating that these two proteins were more basic than the others. In addition to CsCML19/52/53/54, which were hydrophobic proteins with a mean hydrophilic value greater than 0, the other proteins were hydrophilic proteins ranging from −0.023 (CsCML8) to 0.829 (CsCML3). The results indicated that the CsCaM/CML protein family of tea are mostly acidic and hydrophilic.

3.2. Conserved Motif and Gene Structure Analysis

Ca2+ is bound by the EF-hand motif, which is the main domain of calcium-binding proteins. As shown in Figure 1A,B, the CsCaM/CML protein family all possessed the conserved EF-hand domains, which had been identified and analyzed in several model plants such as Arabidopsis and rice. CaM proteins were relatively conserved, and all five CsCaM proteins in the tea plant contained four typical EF-hand domains, while there was some variation among CsCMLs, containing two to four typical EF-hand domains. According to these results, all identified CsCaM and CsCML proteins contain typical EF-hand domains, suggesting that they may have a function in binding Ca2+.
Different combinations of introns and exons are the imprints of gene evolution. The distribution of exon–intron arrangement was examined to reveal the structural diversity of CsCaM/CMLs. As illustrated in Figure 1C, CsCaML1 contained two introns, while CsCaM2/3/4/5 contained only one intron. Among the studied 60 CsCMLs, 27 CsCMLs coding genes did not contain any introns, whereas the rest of the CsCMLs contained one to four introns, with CsCML40 having the longest intron fragment and CsCML19/23/31 containing four introns. These introns play an important role in the regulation of gene expression and transcription in plants.

3.3. Cis-Acting Element Analysis of CsCaM/CML Promoter

To understand the potential transcriptional regulatory mechanisms of the CsCaM/CMLs, the 2000 bp sequences of the CsCaM/CML promoter regions were analyzed by PlantCARE, and data visualization of the screened cis-elements was performed using TBtools. A variety of cis-elements were identified in the CsCaM/CML family, including environmental stress elements, hormone signals, plant growth, and development-related factors (Figure 2). Among them, environmental stress elements contained defense and stress response (TC-rich repeats), low-temperature responsive (LTR), drought-inducibility (MBS), anaerobic induction (ARE), and light responsive elements (GT1-motif/ACE/G-box). Hormone-responsive cis-acting elements were also present, such as MeJA (CGTCA-motif/TGACG-motif), IAA (TGA-element/AuxRR-core), SA (TCA-element), ABA (ABRE), and GA (GARE-motif/P-box). Two cis-acting elements involved in plant growth and development were associated with palisade mesophyll cell differentiation (HD-Zip 1) and meristem expression (CAT-box). These findings suggested that CsCaM/CML family genes may be more widely involved in the plant response to environmental stresses as well as their growth and development.

3.4. Phylogenetic Analysis of CsCaM and CsCML Families

To clarify the potential functions of CaM and CML family proteins in the tea plant and Arabidopsis, we established an unrooted tree using MEGA 6.0. CsCaM/CML proteins were classified into 7 subgroups based on their similarities and relationships with Arabidopsis members, which contained 8, 13, 5, 13, 11, 10, and 5 members, respectively (Figure 3). Furthermore, the evolutionary relationships of CaM/CMLs in different plant species were investigated by constructing another phylogenetic tree using the CaM/CMLs sequences from C. sinensis, A. thaliana, O. sativa, and B. oleracea (Figure 4). CsCaMs clustered with AtCaMs, OsCaMs, and BrCaMs, but CsCML47/48 and AtCML12 clustered with AtCaM1 and OsCaM1 respectively; similarly, CsCML was related to other species of CML. These results demonstrate that the CaM/CML proteins of the tea plant, Arabidopsis, rice, and cabbage are highly homologous.

3.5. Chromosomal Localization and Collinearity Analysis

Chromosomal (Chr) localization of 65 CsCaM/CML genes based on tea plant genome information was analyzed using TBtools software (Figure 5). MCscanX software was used to evaluate collinearity diagrams among CsCaM/CML gene members. The results revealed that 58 genes were distributed unevenly on the 14 chromosomes with no genes distributed on Chr 8, while the other 7 genes, including CsCML43/55/56/57/58/59/60, could not be matched on a particular chromosome, but were present on the contig. Chr 4 harbored the most CsCMLs, while Chr 15 contained the fewest, with only one member. CsCaMs were mainly located in the middle of Chr 13, while CsCaM1 was located in the 3′ region of Chr 11. Genes were distributed unevenly on chromosomes, suggesting that there has been genetic variation in tea plants during evolution.
Gene duplications affect plant evolution, inheritance, and variation, and have a close relationship with gene expression and transcriptional regulation. Collinearity analysis was performed for exploring duplications within the CsCaMs and CsCMLs family (Figure 6). There were 14 gene duplication pairs among the 65 CsCaM/CML genes, with duplication of sequences occurring between each chromosome, but no duplication on Chr12. Interestingly, among these duplicated fragments, CsCML4 and CsCML25 both had a duplication relationship with CsCML8, and both CsCML5 and CsCML10 were duplicated with CsCML21, while CsCML4/5/8 were all located on Chr 2, CsCML10 on Chr3, and CsCML21 on Chr4. It is speculated that the duplication of gene sequences may be transmitted between chromosomes through individual genes, and the gene duplication phenomenon has important implications for the evolution of CsCaM/CML proteins.

3.6. Expression Profiles of CsCaM and CsCML Genes in Different Tissues of Tea Plant

To determine the spatiotemporal expression patterns of the CsCaM/CMLs genes, the expression patterns of 65 CsCaM/CML transcripts in different tissues were obtained from TPIA datasets and further analyzed (Figure 7). As visualized by heatmap plotting, in addition to CsCML16, 17, 18, 49, 57, 58, and 59 showing minimal expression/no expression in different tissues, most CsCaM and CML genes were found to be constitutively expressed in tea plant tissues, albeit at different levels. CsCML1, 14, 33, and 52 showed maximum relative expression in buds, while CsCaM5 presented the highest expression level in young leaves, CsCaM1 and CsCML35 displayed a high level of expression in old leaves, and CsCaM2 and CsCML36 expressed more in stems. Moreover, other CsCML genes were relatively expressed (values > 2) mainly in flowers, mature leaves, and roots of tea plants, containing 9, 6, and 11 gene members, respectively. The findings demonstrated that CsCaM/CMLs may play pivotal roles in the morphological establishment of tea plant flowers and the growth and development of leaves and roots. Generally, the expression profiles of most genes in the same cluster were similar but not identical, suggesting that their functions were redundant and partially differentiated.

3.7. Expression Patterns of CsCaM and CsCML Genes under Abiotic Stress in the Tea Plant

To obtain further insights into the potential functions of CsCaM and CsCML genes in the tea plant, we analyzed the expression levels of the CsCaM/CMLs in response to abiotic stress. As shown in Figure 8A, after cold acclimation (CA) treatment, results revealed that the expression patterns of CsCML2, 6, 11, 12, 22, 27, 32, 34, and CsCaM2 were up-regulation (value > 1.5) at 6 h, while CsCML8, 9, 19, 23, 29, 45, 48, 52, and CsCaM5 genes were down-regulated after treatment. Both CsCaM1 and CsCML7, 15, 21, 35, and 55 were highly expressed after 7 d of low-temperature stress. CsCML1, 4, 25, 33, 36, 37, 40, 41, 43, 44, 50, 56, and 57 showed the highest expression level after the de-acclimation (DA) treatment. However, the rest of the genes showed no expression in response to cold treatment.
Under drought stress, their expression patterns were classified into four types: (1) genes such as CsCML28, 35, 41, 45, 47, and CsCaM2 or CsCML1, 7, 15, 27, and 55 were notably activated after 24 h or 48 h of the drought stress, and displayed a significant increase in expression levels. Subsequently, these genes were down-regulated after 48 h or 72 h of the PEG treatment, respectively; (2) type two, including CsCML14, 22, 40, 52, and CsCaM1 were continuously up-regulated under drought stress; (3) type three was a set of genes such as CsCML3, 5, 6, 10, 11, 12, and 25, showing a significant decreased in expression levels; (4) type four consisted of the remaining 10 CsCaM/CMLs, whose expression levels were not detected under drought stress (Figure 8B). The results confirmed that the CsCaM and CsCML genes expressed differently under various stress conditions and participated in the regulation of abiotic stress responses. It is noteworthy that several CsCMLs respond to multiple stresses, and CsCML7/11/15/21/55 were upregulated by cold and drought.

3.8. Expression Analysis of the Selected Genes in Response to Abiotic Stress by qRT-PCR

In order to confirm the results from TPIA, seven CsCML genes were chosen and submitted to qRT-PCR expression analysis in response to multiple abiotic stress treatments, including low temperature, high salt, drought, and ABA (Figure 9). Under low-temperature stress, the expression levels of six CsCML (CsCML1/3/33/39/42/51) genes were significantly upregulated on the whole, while CsCML12 was repressed at first, and then increased at 24 h. Among the six genes, CsCML39 was the most sensitive to low temperature with the highest expression and may have an important role in the low-temperature response. In addition, the expression levels of CsCML12 and CsCML42 significantly increased under salt and drought stress, while the other genes did not change significantly. Meanwhile, CsCML42 showed a maximum change in expression under ABA treatment, which indicated that CsCML42 was sensitive to ABA stimulation. Overall, CsCML39 was the most sensitive to low temperature with the highest expression and may have an important role in the low-temperature response, while CsCML12 showed a trend of decreasing followed by increasing under low temperature, high salt, and drought stresses. These results demonstrated that CsCaM/CML family members may have distinct biological functions in tea plants. In general, CsCML expression profiles revealed that all the collected genes respond to one or more stresses with varying expression patterns.

4. Discussion

CaM and CMLs are types of calcium-sensor proteins that modulate a variety of developmental processes and stress responses by mediating Ca2+ signatures. Among the various calcium sensor proteins reported, CaM and CMLs are the most conserved and the major calcium receptor proteins in plants. Although the analyses of CaM/CML gene family in several plant species have been conducted by genome-wide survey, including Arabidopsis [10], rice [12], tomato [13,47], lotus [18], cabbage [48], apple [14], and wheat [40], there has been no systematic study of CaM/CML genes in C. sinensis. In Ma’s report, only 5 CsCMLs were identified in the tea plant, although the details of these genes are unclear [19]. In the current study, a genome-wide search method was used that detected a total of 5 CsCaM and 60 CsCML genes in the tea plant, and various bioinformatics analyses were accomplished.
Conserved motif analysis revealed that all the CsCaMs contained four EF-hand domains, similar to those characterized in Arabidopsis. CsCML proteins contained two to four EF-hand structural domains, consistent with previous studies, such as the apple MdCMLs [14] and the cabbage BrCMLs [48]. There may be functional differences among CsCaMs/CMLs owing to the different numbers of the EF-hand motif. Gene structure analysis showed that only 27 CsCMLs carried 1–4 introns, most CsCMLs were intronless, while CsCaM contain 1 or 2 introns, indicating critical evolutionary changes in the C. sinensis genome. The presence of few or no introns suggests that they may be quickly transcribed to support an early defense response in the plant under stress [49].
Cis-acting elements are functional elements in the gene promoter region and play important roles in regulating gene expression. According to the prediction of cis-acting elements, most CsCaM and CsCMLs contain various types of cis-elements related to plant growth and development, hormone response, light response, and stresses response. CsCaM and CsCMLs showed different expression patterns under different abiotic stress treatments, which indicated that they may affect tea plant growth in response to abiotic stress. AtCaM5 from Arabidopsis binds to IQM4 to participate in dormancy and germination of Arabidopsis seeds [50]. Both AtCML15 and AtCML18 are able to interact with the Na+/H+ reverse transporter protein AtNHX1, thereby reducing Na+/H+ interchange activity and playing a role in adversity stress [51]. The tomato SlCML37 was found to interact with the proteasome maturation factor SlUMP1 to increase the low-temperature stress tolerance [52].
CsCaM and CsCMLs were divided into 7 subgroups based on the phylogenic tree between Arabidopsis and the tea plant, each subgroup with a different number of proteins and structure, indicating that the CsCaM/CML family proteins of the tea plant are numerous and have different origins and diverse functions. It is worth noting that five CsCaMs and five AtCaMs were clustered together into one group (VII), indicating their close phylogenetic relationship and high sequence identity (Figure 3). Further, we constructed another evolutionary tree of tea plant CsCaM/CML with Arabidopsis thaliana, rice, and cabbage, which indicated that CaM and CML proteins are ubiquitous and conserved among plant species.
Chromosomal localization showed that 65 CsCaM/CML genes were unevenly distributed on the 14 chromosomes of Camellia sinensis (Figure 5). CsCaMs and CsCMLs were not distributed on every chromosome, which was also observed in rice [12], apple [14], and maize [42]. Gene duplication is a major cause of gene family expansion [53]. In this study, we performed a synteny analysis based on the CSS genome and mapped CsCaM/CMLs onto the identified collinear regions. Different types of duplications were identified in several gene pairs, indicating that gene duplication is a key factor in the expansion of the CsCaM/CML gene family. There were 14 pairs of gene duplications in the CsCaM/CML genes. Among these duplicated segments, CsCML4/5/10/25 was duplicated with CsCML8/21, CsCML4/5/8 was located on Chr 2, CsCML10 on Chr 3, and CsCML21 on Chr 4. It is hypothesized that duplication of gene sequences may be transmitted between chromosomes through individual genes and is important for the genetic stability of organisms. Collinearity analysis provided additional information on the evolution of CsCaM/CML, and tandem duplication between adjacent chromosomes may have been generated by the evolution of genes to adapt to their environment.
CaM and CML genes were reported to be diversely expressed in various plant tissues. In this study, most of the CsCaM/CML genes were found to be present in at least one tissue (Figure 7), implying the wide involvement of CsCaM/CML genes in tea plant growth and development. Five of the CsCMLs were highly expressed in apical buds, suggesting their potential function in growth differentiation and phototropism. Eight of the CsCMLs and two CsCaMs were highly expressed in leaves, elucidating their role in leaf development. Ten of the CsCMLs were abundantly expressed in flowers, revealing their role in reproduction. One of the CsCML and one CsCaM were highly expressed in stems, suggesting a potential role in stem development. Five of the CsCMLs were expressed in fruit, suggesting a prospective role for them in fruit formation. Twelve CsCMLs were expressed at high levels in roots, suggesting their possible function during root development. However, CsCML16, 17, 18, 49, 57, 58, and 59 were not expressed in any tissue, suggesting these genes may be related to other biological process, or due to homoeologous gene silencing. The expression patterns of the CsCaM/CML gene family in different tissues revealed function divergence.
The important functions of CaMs/CMLs in plant stress tolerance have been widely reported, such as drought [54], salt [37], cold stress [52], insect [55], and pathogens attack [56]. In Arabidopsis, it has been shown that AtCaM1, 3 and 4, as well as AtCML8/9/20/24/37/38/39, were involved in resistance to abiotic stresses [24,32,33,34,57,58,59,60,61] Additionally, OsCML4 confers drought tolerance in rice by scavenging ROS in a way that is independent of the ABA manner [62]. GmCaM4 in soybean [63], MtCML40 in alfalfa [64], and ShCML44 in tomato [39] were found to be associated with plant tolerance to abiotic stresses.
As a leaf-harvested crop, the tea plant is inevitably confronted with low temperature stresses throughout the whole life cycle. The low temperatures in late autumn and early spring often cause injury to tea plants and then affect its yield and quality, which seriously restricts the development of the tea industry. In this study, most of the CsCaM/CML genes were differentially expressed under low temperature stress, demonstrating that these genes are involved in the response of the tea plant to low temperature stress. For example, the expression levels of CsCML33 and CsCaM5 were expressed highly in young leaves of tea plant under the low temperature condition, suggesting that these genes were involved in cold tolerance. Previous investigations have confirmed that CMLs are involved in plant responses to cold stress. The expression levels of AtCML24 and OsMSR2 could be induced under cold treatment, which might participate in cold-induced Ca2+ signal transduction [24,37]. There are also studies showing that CaCl2 treatment alleviates the chilling injury of plant [65,66], which indicated that calcium signaling proteins play an important role in low temperature stress in plants.
Some of the CsCaM/CML genes were repressed under drought stress, while the other genes were increased. The expression pattern of these genes after drought stress in tea plants was significantly specific, suggesting that the CsCaM/CML gene family has an important role in the response of tea plants to drought stress. Our qRT-PCR analysis of seven CsCML genes showed that CsCML39 had a strong up-regulated expression under low temperature stress, while CsCML12 showed an increasing trend under low temperature, high salt, and drought stresses. CsCML42 showed a significant increase in expression in response to all these abiotic stresses and was assumed to play an important role in the pathway. The results indicated that CsCaMs and CsCMLs in Camellia sinensis had functional diversity.

5. Conclusions

This is the first comprehensive and systematic genome-wide analysis of the CsCaM/CML gene family in C. sinensis. A total of 5 CsCaM and 60 CsCML genes were identified in the present study. Analysis of the conserved motifs, gene structure, cis-acting elements, chromosome location, and phylogenetic relationships indicated that the CsCaM/CML gene family was highly conserved during plant evolution. A large number of cis-acting elements involved in low temperature response, drought induction, anaerobic response, hormone response, and light response can be observed in the promoters of CsCaM/CMLs, implying the potential roles in plant growth and tolerance to abiotic stresses. Differential expression of CsCaM/CMLs in different tissues indicated their involvement in growth and development. Meanwhile, CsCaM/CMLs were differentially expressed under abiotic stresses. qRT-PCR analysis further indicated that CsCaM/CMLs genes were involved in the response of the tea plant to abiotic stresses and plant hormones. Notably, this study provides a comprehensive understanding of the CsCaM/CMLs and a solid foundation for further elucidating the molecular mechanisms of CsCaM/CMLs in calcium signaling and stress responses in the tea plant.

Author Contributions

Conceptualization, Q.Z. and R.Z.; methodology, R.K.; software, L.W.; validation, C.L. and F.Z.; formal analysis, R.K.; investigation, L.W.; resources, Q.Z. and F.Z.; data curation, R.K. and C.L.; writing—original draft preparation, R.K.; writing—review and editing, Q.Z. and R.Z.; visualization, R.K.; supervision, Q.Z. and R.Z.; project administration, Q.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32102437, 31470690), the Henan Provincial Science and Technology Research Project (222102110365), the Expert Workstation of Yunnan Province (202105AF150045), and the China Agriculture Research System of MOF and MARA (CAR-19).

Acknowledgments

The authors thank Zhixin Guo (Henan Agriculture University) for critical reading of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dodd, A.N.; Kudla, J.; Sanders, D. The language of calcium signaling. Annu. Rev. Plant Biol. 2010, 61, 593–620. [Google Scholar] [CrossRef] [Scilit]
  2. Kudla, J.; Batistic, O.; Hashimoto, K. Calcium signals: The lead currency of plant information processing. Plant Cell 2010, 22, 541–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Sarwat, M.; Ahmad, P.; Nabi, G.; Hu, X. Ca2+ signals: The versatile decoders of environmental cues. Crit. Rev. Biotechnol. 2013, 33, 97–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Reddy, A.S.; Ali, G.S.; Celesnik, H.; Day, I.S. Coping with stresses: Roles of calcium-and calcium/calmodulin-regulated gene expression. Plant Cell 2011, 23, 2010–2032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Zielinski, R.E. Calmodulin and calmodulin-binding proteins in plants. Annu. Rev. Plant Biol. 1998, 49, 697–725. [Google Scholar] [CrossRef] [Scilit]
  6. Luan, S.; Kudla, J.; Rodriguez-Concepcion, M.; Yalovsky, S.; Gruissem, W. Calmodulins and calcineurin B–like proteins: Calcium sensors for specific signal response coupling in plants. Plant Cell 2002, 14, S389–S400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Harmon, A.C.; Gribskov, M.; Harper, J.F. CDPKs—A kinase for every Ca2+ signal? Trends Plant Sci. 2000, 5, 154–159. [Google Scholar] [CrossRef] [Scilit]
  8. Grabarek, Z. Structural basis for diversity of the EF-hand calcium-binding proteins. J. Mol. Biol. 2006, 359, 509–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Lewit-Bentley, A.; Réty, S. EF-hand calcium-binding proteins. Curr. Opin. Struc. Biol. 2000, 10, 637–643. [Google Scholar] [CrossRef] [Scilit]
  10. McCormack, E.; Tsai, Y.C.; Braam, J. Handling calcium signaling: Arabidopsis CaMs and CMLs. Trends Plant Sci. 2005, 10, 383–389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Perochon, A.; Aldon, D.; Galaud, J.P.; Ranty, B. Calmodulin and calmodulin-like proteins in plant calcium signaling. Biochimie 2011, 93, 2048–2053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Boonburapong, B.; Buaboocha, T. Genome-wide identification and analyses of the rice calmodulin and related potential calcium sensor proteins. BMC Plant Biol. 2007, 7, 4. [Google Scholar] [CrossRef] [Scilit]
  13. Shi, J.; Du, X. Identification, characterization and expression analysis of calmodulin and calmodulin-like proteins in Solanum pennellii. Sci. Rep. 2020, 10, 7474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Li, C.; Meng, D.; Zhang, J.; Cheng, L. Genome-wide identification and expression analysis of calmodulin and calmodulin-like genes in apple (Malus × domestica). Plant Physiol. Biochem. 2019, 139, 600–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Vandelle, E.; Vannozzi, A.; Wong, D.; Danzi, D.; Digby, A.M.; Dal Santo, S.; Astegno, A. Identification, characterization, and expression analysis of calmodulin and calmodulin-like genes in grapevine (Vitis vinifera) reveal likely roles in stress responses. Plant Physiol. Biochem. 2018, 129, 221–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. He, X.; Liu, W.; Li, W.; Liu, Y.; Wang, W.; Xie, P.; Kang, Y.; Liao, L.; Qian, L.; Liu, Z.; et al. Genome-wide identification and expression analysis of CaM/CML genes in Brassica napus under abiotic stress. J. Plant Physiol. 2020, 255, 153251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Hu, W.; Yan, Y.; Tie, W.; Ding, Z.; Wu, C.; Ding, X.; Wang, W.; Xia, Z.; Guo, J.; Peng, M. Genome-Wide Analyses of Calcium Sensors Reveal Their Involvement in Drought Stress Response and Storage Roots Deterioration after Harvest in Cassava. Genes 2018, 9, 221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Gao, L.; Damaris, R.N.; Yu, F.; Yang, P. Genome-wide Identification and Expression Analysis of CaM/CML Gene Family in Sacred Lotus (Nelumbo nucifera). Plant Mol. Biol. Rep. 2022, 40, 418–432. [Google Scholar] [CrossRef] [Scilit]
  19. Ma, Q.; Zhou, Q.; Chen, C.; Cui, Q.; Zhao, Y.; Wang, K.; Arkorful, E.; Chen, X.; Sun, K.; Li, X. Isolation and expression analysis of CsCML genes in response to abiotic stresses in the tea plant (Camellia sinensis). Sci. Rep. 2019, 9, 8211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Landoni, M.; De Francesco, A.; Galbiati, M.; Tonelli, C. A loss-of-function mutation in Calmodulin2 gene affects pollen germination in Arabidopsis thaliana. Plant Mol. Biol. 2010, 74, 235–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Yang, X.; Wang, S.S.; Wang, M.; Qiao, Z.; Bao, C.C.; Zhang, W. Arabidopsis thaliana calmodulin-like protein CML24 regulates pollen tube growth by modulating the actin cytoskeleton and controlling the cytosolic Ca(2+) concentration. Plant Mol. Biol. 2014, 86, 225–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Bender, K.W.; Rosenbaum, D.M.; Vanderbeld, B.; Ubaid, M.; Snedden, W.A. The Arabidopsis calmodulin-like protein, CML39, functions during early seedling establishment. Plant J. 2013, 76, 634–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Midhat, U.; Ting, M.K.; Teresinski, H.J.; Snedden, W.A. The calmodulin-like protein, CML39, is involved in regulating seed development, germination, and fruit development in Arabidopsis. Plant Mol. Biol. 2018, 96, 375–392. [Google Scholar] [CrossRef] [Scilit]
  24. Delk, N.A.; Johnson, K.A.; Chowdhury, N.I.; Braam, J. CML24, regulated in expression by diverse stimuli, encodes a potential Ca2+ sensor that functions in responses to abscisic acid, daylength, and ion stress. Plant Physiol. 2005, 139, 240–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Cho, K.M.; Nguyen, H.T.K.; Kim, S.Y.; Shin, J.S.; Cho, D.H.; Hong, S.B.; Shin, J.S.; Ok, S.H. CML 10, a variant of calmodulin, modulates ascorbic acid synthesis. New Phytol. 2016, 209, 664–678. [Google Scholar] [CrossRef] [Scilit]
  26. Yang, J.; Ji, L.; Liu, S.; Jing, P.; Hu, J.; Jin, D.; Wang, L.; Xie, G. The CaM1-associated CCaMK-MKK1/6 cascade positively affects lateral root growth via auxin signaling under salt stress in rice. J. Exp. Bot. 2021, 72, 6611–6627. [Google Scholar] [CrossRef] [Scilit]
  27. Astegno, A.; Bonza, M.C.; Vallone, R.; La Verde, V.; D’Onofrio, M.; Luoni, L.; Molesini, B.; Dominici, P. Arabidopsis calmodulin-like protein CML36 is a calcium (Ca2+) sensor that interacts with the plasma membrane Ca2+-ATPase isoform ACA8 and stimulates its activity. J. Biol. Chem. 2017, 292, 15049–15061. [Google Scholar] [CrossRef] [Scilit]
  28. Dobney, S.; Chiasson, D.; Lam, P.; Smith, S.P.; Snedden, W.A. The calmodulin-related calcium sensor CML42 plays a role in trichome branching. J. Biol. Chem. 2009, 284, 31647–31657. [Google Scholar] [CrossRef] [Scilit]
  29. Kushwaha, R.; Singh, A.; Chattopadhyay, S. Calmodulin7 plays an important role as transcriptional regulator in Arabidopsis seedling development. Plant Cell 2008, 20, 1747–1759. [Google Scholar] [CrossRef] [Scilit]
  30. Tsai, Y.C.; Delk, N.A.; Chowdhury, N.I.; Braam, J. Arabidopsis potential calcium sensors regulate nitric oxide levels and the transition to flowering. Plant Signal. Behav. 2007, 2, 446–454. [Google Scholar] [CrossRef] [Scilit]
  31. Tang, W.; Tu, L.; Yang, X.; Tan, J.; Deng, F.; Hao, J.; Guo, K.; Lindsey, K.; Zhang, X. The calcium sensor GhCaM7 promotes cotton fiber elongation by modulating reactive oxygen species (ROS) production. New Phytol. 2014, 202, 509–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zhu, X.; Robe, E.; Jomat, L.; Aldon, D.; Mazars, C.; Galaud, J.P. CML8, an Arabidopsis calmodulin-like protein, plays a role in Pseudomonas syringae plant immunity. Plant Cell Physiol. 2017, 58, 307–319. [Google Scholar] [PubMed]
  33. Vanderbeld, B.; Snedden, W.A. Developmental and stimulus-induced expression patterns of Arabidopsis calmodulin-like genes CML37, CML38 and CML39. Plant Mol. Biol. 2007, 64, 683–697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Leba, L.J.; Perochon, A.; Cheval, C.; Ranty, B.; Galaud, J.P.; Aldon, D. CML9, a multifunctional Arabidopsis thaliana calmodulin-like protein involved in stress responses and plant growth? Plant Signal. Behav. 2012, 7, 1121–1124. [Google Scholar] [CrossRef] [Scilit]
  35. Vadassery, J.; Reichelt, M.; Hause, B.; Gershenzon, J.; Boland, W.; Mithöfer, A. CML42-mediated calcium signaling coordinates responses to Spodoptera herbivory and abiotic stresses in Arabidopsis. Plant Physiol. 2012, 159, 1159–1175. [Google Scholar] [CrossRef] [Scilit]
  36. Yuenyong, W.; Chinpongpanich, A.; Comai, L.; Chadchawan, S.; Buaboocha, T. Downstream components of the calmodulin signaling pathway in the rice salt stress response revealed by transcriptome profiling and target identification. BMC Plant Biol. 2018, 18, 335. [Google Scholar] [CrossRef] [Scilit]
  37. Xu, G.Y.; Rocha, P.S.; Wang, M.L.; Xu, M.L.; Cui, Y.C.; Li, L.Y.; Zhu, Y.X.; Xia, X. A novel rice calmodulin-like gene, OsMSR2, enhances drought and salt tolerance and increases ABA sensitivity in Arabidopsis. Planta 2011, 234, 47–59. [Google Scholar] [CrossRef] [Scilit]
  38. Chinpongpanich, A.; Limruengroj, K.; Phean, O.P.S.; Limpaseni, T.; Buaboocha, T. Expression analysis of calmodulin and calmodulin-like genes from rice, Oryza sativa L. BMC Res. Notes 2012, 5, 625. [Google Scholar] [CrossRef] [Scilit]
  39. Munir, S.; Liu, H.; Xing, Y.; Hussain, S.; Ouyang, B.; Zhang, Y.; Li, H.; Ye, Z. Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses. Sci. Rep. 2016, 6, 31772. [Google Scholar] [CrossRef] [Scilit]
  40. Lu, L.; Rong, W.; Zhou, R.; Huo, N.; Zhang, Z. TaCML36, a wheat calmodulin-like protein, positively participates in an immune response to Rhizoctonia cerealis. Crop. J. 2019, 7, 38–48. [Google Scholar] [CrossRef] [Scilit]
  41. Aleynova, O.A.; Kiselev, K.V.; Ogneva, Z.V.; Dubrovina, A.S. The grapevine calmodulin-like protein gene CML21 is regulated by alternative splicing and involved in abiotic stress response. Int. J. Mol. Sci. 2020, 21, 7939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Wang, Z.; Wang, L.; Li, J.; Yang, W.; Ci, J.; Ren, X.; Wang, W.; Wang, Y.; Jiang, L.; Yang, W. Identification and expression analysis revealed drought stress-responsive Calmodulin and Calmodulin-like genes in maize. J. Plant Interact. 2022, 17, 450–461. [Google Scholar] [CrossRef] [Scilit]
  43. Li, B.; Wang, H.; He, S.; Ding, Z.; Wang, Y.; Li, N.; Hao, X.; Wang, L.; Yang, Y.; Qian, W. Genome-wide identification of the PMEI gene family in tea plant and functional analysis of CsPMEI2 and CsPMEI4 through ectopic overexpression. Front. Plant Sci. 2021, 12, 807514. [Google Scholar] [CrossRef] [Scilit]
  44. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Scilit]
  46. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Munir, S.; Khan, M.R.; Song, J.; Munir, S.; Zhang, Y.; Ye, Z.; Wang, T. Genome-wide identification, characterization and expression analysis of calmodulin-like (CML) proteins in tomato (c). Plant Physiol. Biochem. 2016, 102, 167–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Nie, S.; Zhang, M.; Zhang, L. Genome-wide identification and expression analysis of calmodulin-like (CML) genes in Chinese cabbage (Brassica rapa L. ssp. pekinensis). BMC Genom. 2017, 18, 842. [Google Scholar] [CrossRef] [Scilit]
  49. Keshan, R.; Singh, I.K.; Singh, A. Genome wide investigation of MAPKKKs from Cicer arietinum and their involvement in plant defense against Helicoverpa armigera. Physiol. Mol. Plant Pathol. 2021, 115, 101685. [Google Scholar] [CrossRef] [Scilit]
  50. Zhou, Y.P.; Wu, J.H.; Xiao, W.H.; Chen, W.; Chen, Q.H.; Fan, T.; Xie, C.P.; Tian, C.E. Arabidopsis IQM4, a novel calmodulin-binding protein, is involved with seed dormancy and germination in Arabidopsis. Front. Plant Sci. 2018, 9, 721. [Google Scholar] [CrossRef] [Scilit]
  51. Yamaguchi, T.; Aharon, G.S.; Sottosanto, J.B.; Blumwald, E. Vacuolar Na+/H+ antiporter cation selectivity is regulated by calmodulin from within the vacuole in a Ca2+-and pH-dependent manner. Proc. Natl. Acad. Sci. USA 2005, 102, 16107–16112. [Google Scholar] [CrossRef] [Scilit]
  52. Tang, M.; Xu, C.; Cao, H.; Shi, Y.; Chen, J.; Chai, Y.; Li, Z. Tomato calmodulin-like protein SlCML37 is a calcium (Ca2+) sensor that interacts with proteasome maturation factor SlUMP1 and plays a role in tomato fruit chilling stress tolerance. J. Plant Physiol. 2021, 258, 153373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Taylor, J.S.; Raes, J. Duplication and divergence: The evolution of new genes and old ideas. Annu. Rev. Genet. 2004, 38, 615–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Yin, X.M.; Huang, L.F.; Zhang, X.; Wang, M.L.; Xu, G.Y.; Xia, X.J. OsCML4 improves drought tolerance through scavenging of reactive oxygen species in rice. J. Plant Biol. 2015, 58, 68–73. [Google Scholar] [CrossRef] [Scilit]
  55. Yadav, M.; Pandey, J.; Chakraborty, A.; Hassan, M.I.; Kundu, J.K.; Roy, A.; Singh, I.K.; Singh, A. A comprehensive analysis of calmodulin-like proteins of Glycine max indicates their role in calcium signaling and plant defense against insect attack. Front. Plant Sci. 2022, 13, 817950. [Google Scholar] [CrossRef] [Scilit]
  56. Chiasson, D.; Ekengren, S.K.; Martin, G.B.; Dobney, S.L.; Snedden, W.A. Calmodulin-like proteins from Arabidopsis and tomato are involved in host defense against Pseudomonas syringae pv. tomato. Plant Mol. Biol. 2005, 58, 887–897. [Google Scholar] [CrossRef] [Scilit]
  57. Scholz, S.S.; Reichelt, M.; Vadassery, J.; Mithöfer, A. Calmodulin-like protein CML37 is a positive regulator of ABA during drought stress in Arabidopsis. Plant Signal. Behav. 2015, 10, e1011951. [Google Scholar] [CrossRef] [Scilit]
  58. Wu, X.; Qiao, Z.; Liu, H.; Acharya, B.R.; Li, C.; Zhang, W. CML20, an Arabidopsis calmodulin-like protein, negatively regulates guard cell ABA signaling and drought stress tolerance. Front. Plant Sci. 2017, 8, 824. [Google Scholar] [CrossRef] [Scilit]
  59. Zhang, W.; Zhou, R.G.; Gao, Y.J.; Zheng, S.Z.; Xu, P.; Zhang, S.Q.; Sun, D.Y. Molecular and genetic evidence for the key role of AtCaM3 in heat-shock signal transduction in Arabidopsis. Plant Physiol. 2009, 149, 1773–1784. [Google Scholar] [CrossRef] [Scilit]
  60. Magnan, F.; Ranty, B.; Charpenteau, M.; Sotta, B.; Galaud, J.P.; Aldon, D. Mutations in AtCML9, a calmodulin-like protein from Arabidopsis thaliana, alter plant responses to abiotic stress and abscisic acid. Plant J. 2008, 56, 575–589. [Google Scholar] [CrossRef] [Scilit]
  61. Zhou, S.; Jia, L.; Chu, H.; Wu, D.; Peng, X.; Liu, X.; Zhang, J.; Zhao, J.; Chen, K.; Zhao, L. Arabidopsis CaM1 and CaM4 promote nitric oxide production and salt resistance by inhibiting S-nitrosoglutathione reductase via direct binding. PLoS Genet. 2016, 12, e1006255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Duan, J.; Zhang, M.; Zhang, H.; Xiong, H.; Liu, P.; Ali, J.; Li, J.; Li, Z. OsMIOX, a myo-inositol oxygenase gene, improves drought tolerance through scavenging of reactive oxygen species in rice (Oryza sativa L.). Plant Sci. 2012, 196, 143–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Rao, S.S.; El-Habbak, M.H.; Havens, W.M.; Singh, A.; Zheng, D.; Vaughn, L.; Haudenshield, J.S.; Hartman, G.L.; Korban, S.S.; Ghabrial, S.A. Overexpression of GmCaM4 in soybean enhances resistance to pathogens and tolerance to salt stress. Mol. Plant Pathol. 2014, 15, 145–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Zhang, X.; Wang, T.; Liu, M.; Sun, W.; Zhang, W.H. Calmodulin-like gene MtCML40 is involved in salt tolerance by regulating MtHKTs transporters in Medicago truncatula. Environ. Exp. Bot. 2018, 157, 79–90. [Google Scholar] [CrossRef] [Scilit]
  65. Zhang, M.Z.; Zhang, Q.; Tian, C.; Liu, G.S.; Pan, Y.G.; Xu, X.B.; Shi, X.Q.; Zhang, Z.K.; Meng, L.H. Physiological and transcriptome analyses of CaCl2 treatment to alleviate chilling injury in Pineapple. Plants 2022, 11, 2215. [Google Scholar] [CrossRef] [Scilit]
  66. Hou, Y.; Li, Z.; Zheng, Y.; Jin, P. Effects of CaCl2 treatment alleviates chilling injury of Loquat Fruit (Eribotrya japonica) by modulating ROS homeostasis. Foods 2021, 10, 1662. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Phylogenetic relationships, motif compositions, and gene structure of Camellia sinensis CaMs and CMLs. (A) Phylogenetic tree and classification of CsCaM and CsCML proteins. The CsCaM and CsCML can be divided into seven clades which are denoted as subgroups 1–7 from top to bottom. (B) Schematic representation of the conserved EF-hand motifs among the CsCaM and CsCML proteins as obtained by MEME analysis. Each color represents a specific motif. (C) Exon/intron organization of tea CsCaM and CsCML genes. The exons, introns, and UTRs are represented by yellow boxes, fold lines, and green boxes, respectively.
Figure 1. Phylogenetic relationships, motif compositions, and gene structure of Camellia sinensis CaMs and CMLs. (A) Phylogenetic tree and classification of CsCaM and CsCML proteins. The CsCaM and CsCML can be divided into seven clades which are denoted as subgroups 1–7 from top to bottom. (B) Schematic representation of the conserved EF-hand motifs among the CsCaM and CsCML proteins as obtained by MEME analysis. Each color represents a specific motif. (C) Exon/intron organization of tea CsCaM and CsCML genes. The exons, introns, and UTRs are represented by yellow boxes, fold lines, and green boxes, respectively.
Forests 13 01578 g001
Figure 2. Cis-element analysis of tea CsCaM and CsCML gene promoters. The 2000 bp sequence upstream of the CsCaM/CML start codon was analyzed using online software Plant CARE. Binding sites in the promoter region are represented by boxes of different colors, and the graph shows the number of binding sites.
Figure 2. Cis-element analysis of tea CsCaM and CsCML gene promoters. The 2000 bp sequence upstream of the CsCaM/CML start codon was analyzed using online software Plant CARE. Binding sites in the promoter region are represented by boxes of different colors, and the graph shows the number of binding sites.
Forests 13 01578 g002
Figure 3. Phylogenetic analysis of Camellia sinensis and Arabidopsis CaM and CML proteins. A total of 65 CaM and CML proteins from tea (5 CaMs and 60 CMLs) and 57 from Arabidopsis (7 CaMs and 50 CMLs) were aligned using DNAMAN. The phylogenetic tree was constructed using the MEGA 7.0 program by the neighbor-joining method with bootstrap values 1000 using protein sequences. The red triangles represent Camellia sinensis. The blue circles represent Arabidopsis.
Figure 3. Phylogenetic analysis of Camellia sinensis and Arabidopsis CaM and CML proteins. A total of 65 CaM and CML proteins from tea (5 CaMs and 60 CMLs) and 57 from Arabidopsis (7 CaMs and 50 CMLs) were aligned using DNAMAN. The phylogenetic tree was constructed using the MEGA 7.0 program by the neighbor-joining method with bootstrap values 1000 using protein sequences. The red triangles represent Camellia sinensis. The blue circles represent Arabidopsis.
Forests 13 01578 g003
Figure 4. Phylogenetic relationships of CaM/CML genes from Camellia sinensis and other species. The phylogenetic tree was constructed based on sequence alignment of CaM/CML homologs from Camellia sinensis, Arabidopsis, rice, and cabbage using the neighbor-joining method with bootstrapping analysis in MEGA 7.0 (bootstrap:1000). The red triangles represent Camellia sinensis; the blue circles represent Arabidopsis; the green squares represent rice; the yellow stars represent cabbage.
Figure 4. Phylogenetic relationships of CaM/CML genes from Camellia sinensis and other species. The phylogenetic tree was constructed based on sequence alignment of CaM/CML homologs from Camellia sinensis, Arabidopsis, rice, and cabbage using the neighbor-joining method with bootstrapping analysis in MEGA 7.0 (bootstrap:1000). The red triangles represent Camellia sinensis; the blue circles represent Arabidopsis; the green squares represent rice; the yellow stars represent cabbage.
Forests 13 01578 g004
Figure 5. The distribution of CsCaM and CsCML genes in tea chromosomes. A total of 65 CsCaM and CsCML genes were mapped onto the grapevine genome. Names were assigned based on their location in tea chromosomes. The ones in red are CsCaM genes.
Figure 5. The distribution of CsCaM and CsCML genes in tea chromosomes. A total of 65 CsCaM and CsCML genes were mapped onto the grapevine genome. Names were assigned based on their location in tea chromosomes. The ones in red are CsCaM genes.
Forests 13 01578 g005
Figure 6. Collinearity analysis of tea CsCaM and CsCML genes. Among the 65 CsCaMs/CsCMLs genes, 14 segmentally duplicated tea plant CsCaM/CML genes were mapped onto 14 chromosomes.
Figure 6. Collinearity analysis of tea CsCaM and CsCML genes. Among the 65 CsCaMs/CsCMLs genes, 14 segmentally duplicated tea plant CsCaM/CML genes were mapped onto 14 chromosomes.
Forests 13 01578 g006
Figure 7. Expression profiles of CsCaM and CsCML genes in different tissues of the tea plant. Differential expression patterns of CsCaM and CsCML genes in root, flower, stem, terminal bud, young leaf, fruit, mature leaf, and old leaf of the tea plant.
Figure 7. Expression profiles of CsCaM and CsCML genes in different tissues of the tea plant. Differential expression patterns of CsCaM and CsCML genes in root, flower, stem, terminal bud, young leaf, fruit, mature leaf, and old leaf of the tea plant.
Forests 13 01578 g007
Figure 8. Expression profiles of CsCaM and CsCML genes under cold and drought stress. (A) The cold stress expression pattern of the tea plant was not adapted to 25~20 °C (CK), fully adapted to 10 °C for 6 h (CA−6 h) and 10~4 °C for 7 days (CA−7d), and recovered for 7 days (DA−7d) at 25~20 °C. (B) Expression patterns of tea plants treated with 25% polyethylene glycol (PEG) for 0 h, 24 h, 48 h, and 72 h under drought stress.
Figure 8. Expression profiles of CsCaM and CsCML genes under cold and drought stress. (A) The cold stress expression pattern of the tea plant was not adapted to 25~20 °C (CK), fully adapted to 10 °C for 6 h (CA−6 h) and 10~4 °C for 7 days (CA−7d), and recovered for 7 days (DA−7d) at 25~20 °C. (B) Expression patterns of tea plants treated with 25% polyethylene glycol (PEG) for 0 h, 24 h, 48 h, and 72 h under drought stress.
Forests 13 01578 g008
Figure 9. Response of seven CsCML genes to abiotic stress in tea leaves. The untreated plants were treated with low temperature (10 °C), drought (20% PEG 6000), high salt (200 mmol/L NaCl) and ABA (100 μmol/L). Samples were taken at 0, 4, 12, and 24 h after stress treatment. Three biological replicates were set at each time. Gene expression was detected using qRT-PCR. Different lowercase letters indicate significant differences between different time periods under the same treatment (p ˂ 0.05).
Figure 9. Response of seven CsCML genes to abiotic stress in tea leaves. The untreated plants were treated with low temperature (10 °C), drought (20% PEG 6000), high salt (200 mmol/L NaCl) and ABA (100 μmol/L). Samples were taken at 0, 4, 12, and 24 h after stress treatment. Three biological replicates were set at each time. Gene expression was detected using qRT-PCR. Different lowercase letters indicate significant differences between different time periods under the same treatment (p ˂ 0.05).
Forests 13 01578 g009
Table 1. Primers for qRT-PCR.
Table 1. Primers for qRT-PCR.
Gene NamePrimer Sequences (5′–3′)
CsCML1F: TCTCAGGCACATCCTCACCA; R: ATACTGGTGAGAATGTGCCTGAG
CsCML3F: AAGATTGGAGAAAGGGACAGTAAG; R: AGTCATCCACAGTTACTTCTCCATC
CsCML12F: GTGTTAGTTGGTCTTGGGTATGAAA; R: ACACAACCTCTCATCATTGACCTAA
CsCML33F: TCCAAGCACCTCAAGCCC; R: TACTGGTGAGAATGTGCCTGAGA
CsCML39F: TGGACTCCGATGGAAGCCTAAC; R: GCCTCGCTCATATCGGGTAAAA
CsCML42F: AGTTGATACTGATGGAAATGGGAC; R: CTTCATCTGTTATTCTCTCTCCCAA
CsCML51F: AAGAACAACGACGGCTTCATAA; R: CCATCACCATTAGAATCCACCTT
CsPTBF: ACCAAGCACACTCCACACTATCG; R: TGCCCCCTTATCATCATCCACAA
Table 2. Characteristics and names of the CsCaM and CsCML proteins identified in the Camellia sinensis genome.
Table 2. Characteristics and names of the CsCaM and CsCML proteins identified in the Camellia sinensis genome.
Gene nameGene ID 1CDS 2AA 3DMW 4pI 5GRAVY 6EF-Hands 7
CSS0003231.2CsCaM155218320,913.414.68−0.8014
CSS0032965.1CsCaM245014916,833.644.10−0.6194
CSS0045497.1CsCaM345014916,847.674.11−0.6194
CSS0013557.1CsCaM445014916,847.674.11−0.6194
CSS0005129.1CsCaM545014916,833.644.10−0.6194
CSS0026594.1CsCML144414716,478.714.72−0.3593
CSS0018159.1CsCML250116618,237.104.87−0.7284
CSS0046781.1CsCML351016819,174.364.82−0.8294
CSS0033756.1CsCML443514416,061.254.54−0.3964
CSS0029813.1CsCML557619121,799.474.21−0.2112
CSS0006572.1CsCML644715817,470.394.72−0.6374
CSS0041481.1CsCML751617118,995.887.74−0.4473
CSS0005295.1CsCML858219321,586.524.33−0.0232
CSS0005567.1CsCML955818521,313.485.23−0.4364
CSS0044479.1CsCML1054017920,170.175.15−0.3814
CSS0011314.1CsCML1145615116,771.974.40−0.3174
CSS0038900.1CsCML1245615116,771.974.40−0.3174
CSS0016893.1CsCML1350416718,742.055.33−0.4273
CSS0032997.1CsCML1446215317,515.674.07−0.3303
CSS0000487.1CsCML1546215317,558.764.13−0.3043
CSS0022279.1CsCML1640213315,226.134.44−0.3772
CSS0000476.1CsCML1747115617,786.144.31−0.2903
CSS0006005.1CsCML1847115617,788.174.25−0.2703
CSS0046243.1CsCML19102033935,286.534.140.1613
CSS0017640.1CsCML2055818521,234.385.36−0.5064
CSS0001406.1CsCML2155818521,211.345.23−0.5054
CSS0033780.1CsCML2245315017,023.324.38−0.5094
CSS0024416.1CsCML2369022926,354.004.63−0.4454
CSS0047932.1CsCML2450116618,021.714.34−0.4543
CSS0012943.1CsCML2550116618,109.774.32−0.5013
CSS0046747.1CsCML2658219321,163.774.50−0.3824
CSS0019921.1CsCML2770523425,234.744.58−0.0294
CSS0041234.1CsCML2845915217,256.354.08−0.4224
CSS0037530.1CsCML2945915217,212.284.09−0.4384
CSS0036108.1CsCML3045915217,328.424.08−0.4574
CSS0038701.1CsCML3169323026,266.874.59−0.4083
CSS0037305.1CsCML3269323026,261.854.60−0.4033
CSS0025958.1CsCML3344414716,538.724.69−0.3973
CSS0018156.1CsCML3447715817,028.534.35−0.5434
CSS0043064.1CsCML3548316017,093.614.24−0.5013
CSS0046384.1CsCML3668422726,169.925.47−0.4414
CSS0038594.1CsCML3763921224,257.844.85−0.3734
CSS0023779.1CsCML3848316018,310.364.25−0.4573
CSS0017237.1CsCML3948316017,550.884.38−0.1394
CSS0002201.1CsCML4068723826,577.876.30−0.4402
CSS0018824.1CsCML4145915217,183.344.32−0.4934
CSS0033073.1CsCML4244714816,881.834.06−0.3994
CSS0029226.1CsCML4358519421,265.684.46−0.4384
CSS0033360.1CsCML4449218320,290.864.86−0.3634
CSS0020659.1CsCML4549516418,192.374.55−0.3904
CSS0024302.1CsCML4669022925,736.156.32−0.4172
CSS0036849.1CsCML4744714817,026.254.88−0.8253
CSS0042140.1CsCML48258859941.184.46−0.5692
CSS0021840.1CsCML4944714816,864.844.06−0.3044
CSS0004986.1CsCML5048916217,926.044.48−0.3594
CSS0002820.1CsCML5164821623,653.664.47−0.2543
CSS0038574.1CsCML5263321023,387.234.070.0602
CSS0013916.1CsCML5342314015,001.984.160.0573
CSS0039564.1CsCML5442314015,016.014.160.0593
CSS0025741.1CsCML5551617118,995.887.74−0.4473
CSS0046428.1CsCML5663921224,245.834.85−0.3574
CSS0034436.1CsCML5748316017,262.944.40−0.4573
CSS0034378.1CsCML5847115617,787.214.27−0.2593
CSS0004793.1CsCML5947115617,817.214.29−0.2863
CSS0031482.1CsCML6045014916,933.793.95−0.4734
1 GeneID number in the Genome Database for Camellia sinensis (TPIA, tpdb.shengxin.ren/index.html (accessed on 2 May 2021)); 2 Length of the coding region in base pairs; 3 Number of amino acids; 4 DMW, molecular weight, Da; 5 pI, theoretical isoelectric point; 6 Average hydrophilicity of the protein; 7 Number of EF-hands based on the prediction by InterProScan.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kang, R.; Zhao, R.; Wang, L.; Liu, C.; Zhang, F.; Zhou, Q. Genome-Wide Identification and Characterization of Calmodulin and Calmodulin-like Genes Family in Tea Plant and Their Roles under Abiotic Stress. Forests 2022, 13, 1578. https://doi.org/10.3390/f13101578

AMA Style

Kang R, Zhao R, Wang L, Liu C, Zhang F, Zhou Q. Genome-Wide Identification and Characterization of Calmodulin and Calmodulin-like Genes Family in Tea Plant and Their Roles under Abiotic Stress. Forests. 2022; 13(10):1578. https://doi.org/10.3390/f13101578

Chicago/Turabian Style

Kang, Rui, Renliang Zhao, Long Wang, Chunhui Liu, Fen Zhang, and Qiongqiong Zhou. 2022. "Genome-Wide Identification and Characterization of Calmodulin and Calmodulin-like Genes Family in Tea Plant and Their Roles under Abiotic Stress" Forests 13, no. 10: 1578. https://doi.org/10.3390/f13101578

APA Style

Kang, R., Zhao, R., Wang, L., Liu, C., Zhang, F., & Zhou, Q. (2022). Genome-Wide Identification and Characterization of Calmodulin and Calmodulin-like Genes Family in Tea Plant and Their Roles under Abiotic Stress. Forests, 13(10), 1578. https://doi.org/10.3390/f13101578

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop