Sex Determination During Inflorescence Bud Differentiation in Monoecious Pistacia chinensis Bunge
Abstract
1. Introduction
2. Materials and Methods
2.1. Sex Identification Using PCR-Based Molecular Markers
2.1.1. Plant Materials and Genomic DNA Isolation
2.1.2. PCR and SCAR–PCR Amplification
2.1.3. Primer Design and Confirmation
2.2. Sex Expression of Grafted Trees from Scions of Different Sex Types on Monoecious P. chinensis
2.3. Sex Differences During the Development of Male and Female Inflorescence Buds and Shoots
2.3.1. Plant Materials
2.3.2. Experimental Methods
3. Results
3.1. Sex Identification Using Molecular Markers
3.2. Sex Expression on Grafted Trees
3.3. The External and Internal Morphological Differentiation Processes of Male and Female Flower Buds
3.3.1. Undifferentiated Phase
3.3.2. Initial Differentiation Phase
3.3.3. Sex Differentiation Phase
3.3.4. The Late Phase of Sex Differentiation
3.3.5. Sex Organ Development Phase
3.3.6. Sex Gametophyte Development Phase
3.4. Flower Bud Morphological Differentiation and Phenological Phases of Male and Female Shoots
4. Discussion
4.1. Sex Differences at The Molecular and Phenotypic Levels
4.2. Possible Formation Mechanisms of Monoecious P. chinensis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dong, S.B.; Liu, Y.L.; Xiong, B.; Jiang, X.N.; Zhang, Z.X. Transcriptomic analysis of a potential bioenergy tree, Pistacia chinensis Bunge, and identification of candidate genes involved in the biosynthesis of oil. BioEnergy Res. 2016, 9, 740–749. [Google Scholar] [CrossRef] [Scilit]
- Wang, T. Situation and prospect of major woody energy plants resources for biomass fuel oil in China. Sci. Technol. Lead. 2005, 23, 12–14. [Google Scholar]
- Zohary, M. A monographical study of the genus Pistacia. Palest. J. Bot. Jerus. Ser. 1952, 5, 187–228. [Google Scholar]
- Özbek, S.; Ayfer, M. A hermaphrodite Pistacia found in the vicinity of Antep, Turkey. Proc. Am. Soc. Hort. Sci. 1958, 72, 240–241. [Google Scholar]
- Crane, J.C. Hermaphroditism in Pistacia. Calif. Agric. 1974, 28, 3–4. [Google Scholar]
- Kafkas, S.; Perl-Treves, R.; Kaska, N. Unusual Pistacia atlantica Desf. monoecious sex types in the Yunt Mountains of the Manisa province of Turkey. Isr. J. Plant Sci. 2000, 48, 277–280. [Google Scholar] [CrossRef]
- Avanzato, D.; Quarta, R. Monoecious Pistacia terebinthus found in Bulgari. Crop Wild Relat. 2004, 2, 14–16. [Google Scholar]
- İsfendiyaroğlu, M. Hermaphroditism in Pistacia atlantica Desf.: A New Report from Izmir/Turkey. Ege Univ. Ziraat Fak. Derg. 2007, 44, 1–12. [Google Scholar]
- Hou, L.H. Monoecious “energy” tree in the wild. In Forestry Chapter of Anyang Yearbook; Zhongzhou Ancient Books Publishing House: Anyang, China, 2009; p. 155. [Google Scholar]
- Zhao, Z.Z. Early report the inflorescence observation of hermaphrodite Pistacia. J. For. Sci. Technol. 2011, 2, 47. [Google Scholar]
- Bai, Q.; Su, S.C.; Lin, Z.; Leng, P.S.; Wang, W.H. The Variation Characteristics and Blooming Phenophase of Monoecious Pistacia chinensis Bunge. HortScience 2016, 51, 961–967. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.W.; He, H.; Bai, Q.; Qi, P.; Su, S.C.; Fu, X.; Chen, F. Hermaphroditism and Fertility in Pistacia chinensis Bunge. Acta Hort. ISHS 2015, 1074, 129–133. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.P.; Kong, D.J.; Liu, Q.X. Advances in research on the relationship between mineral nutrient and bud flower differentiation of fruit trees. J. Yunnan Agric. Univ. JCR-SCI 2009, 24, 908–912. [Google Scholar]
- Abe, K.; Oshima, M.; Akasaka, M.; Konagaya, K.I.; Nanasato, Y.; Okuzaki, A.; Taniguchi, Y.; Tanaka, J.; Tabei, Y. Development and characterization of transgenic dominant male sterile rice toward an outcross-based breeding system. Breed. Sci. 2018, 68, 248–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hormaza, J.I.; Dollo, L.; Polito, V.S. Identification of a RAPD marker linked to sex determination in Pistacia vera using bulked segregant analysis. Theor. Appl. Genet. 1994, 89, 9–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kafkas, S.; Cetiner, M.S.; Perl-Treves, R. RAPD markers linked to sex in the genus Pistacia. Plant Prod. Protect. Div. 2001, 56, 251–255. [Google Scholar]
- Tan, D.M.; Luo, S.P.; Li, J.; Han, H.T. Sex identification of Pistachio by using RAPD analysis. J. Fruit Sci. 2003, 20, 124–126. [Google Scholar]
- Avanzato, D.; Quarta, R.; Vendramin, E.; Djouvinof, V. Osservazioni morfologiche e molecolari su accessioni monoiche di Pistacia terebinthus L. In Proceedings of the Atti VII Giornate SOI, Napoli, Italy, 4–6 May 2004; pp. 1–496. [Google Scholar]
- Yakubov, B.; Barazani, O.; Golan-Goldhirsh, A. Combination of SCAR primers and Touchdown-PCR for sex identification in Pistacia vera L. Sci. Horticult. 2005, 103, 473–478. [Google Scholar] [CrossRef] [Scilit]
- Andinova, T.; Vendramin, E.; Micali, S. Molecular characterization of Pistacia genus using RAPD markers. G22. In Proceedings of the Atti 50° Congresso Annuale SIGA, Ischia, Italy, 10–14 September 2006. Abstract. [Google Scholar]
- Ehsanpour, A.A.; Tavassoli, M.; Arab, L. Sex determination of Pistacia vera L. using ISSR markers. Malays. Appl. Biol. 2008, 37, 25–28. [Google Scholar]
- Esfandiyari, B.; Nejad, G.H.D.; Kiani, F.A.S.M. Sex determination in Pistacia species using molecular markers. Compliment. Copy 2010, 12, 122–124. [Google Scholar] [CrossRef] [Scilit]
- Cheng, S.P. Tissue Culture and Rapid Propagation of Cotyledonary Nodes and Sex Identification of Pistacia chinensis Bunge. Master’s Thesis, Henan University of Science and Technology, Luoyang, China, 2011. [Google Scholar]
- Davarynejad, G.H.; Shahriari, A.F.; Kiani, F.M. Data to the sex determination in Pistacia species using molecular markers. Euphytica 2012, 185, 227–231. [Google Scholar]
- Sun, Q.; Yang, X.; Li, R. SCAR marker for sex identification of Pistacia chinensis Bunge (Anacardiaceae). Genet. Mol. Res. 2014, 13, 1395–1401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamiab, F.; Ebadi, A.; Panahi, B.; Tajabadi, A. RAPD Analysis for Sex Determination in Pistacia vera L. J. Nuts 2014, 5, 51–55. [Google Scholar]
- Kafkas, S.; Khodaeiaminjan, M.; Guney, M.; Kafkas, E. Identification of sex-linked SNP markers using RAD sequencing suggests ZW/ZZ sex determination in Pistacia vera L. BMC Genom. 2015, 16, 98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khodaeiaminjan, M.; Kafkas, E.; Güney, M.; Kafkas, S. Development and linkage mapping of novel sex-linked markers for marker-assisted cultivar breeding in pistachio (Pistacia vera L.). Mol. Breed. 2017, 37, 98. [Google Scholar] [CrossRef] [Scilit]
- Heikrujam, M.; Sharma, K.; Prasad, M.; Agrawal, V. Review on different mechanisms of sex determination and sex-linked molecular markers in dioecious crops: A current update. Euphytica 2015, 201, 161–194. [Google Scholar] [CrossRef] [Scilit]
- Charlesworth, D. Plant sex determination and sex chromosomes. Heredity 2002, 88, 94–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pannell, J.R. Plant Sex Determination. Curr. Biol. 2017, 27, R191–R197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsunaga, S.; Kawano, S. Sex determination by sex chromosomes in dioecious plants. Plant Biol. 2001, 3, 481–488. [Google Scholar] [CrossRef] [Scilit]
- Bachelier, J.B.; Endress, P.K. Development of inflorescences, cupules, and flowers in Amphipterygium and comparison with Pistacia (Anacardiaceae). Int. J. Plant Sci. 2007, 168, 1237–1253. [Google Scholar] [CrossRef] [Scilit]
- Hormaza, J.I.; Polito, V.S. Pistillate and staminate flower development in dioecious Pistacia vera (Anacardiaceae). Am. J. Bot. 1996, 83, 759–766. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.Q.; Qi, G.H.; Li, B.G.; Guo, S.P.; Qi, K.; Yin, Y.J. Study on the development process of leaf bud in Pistacia chinensis Bunge. J. Anhui Agric. Sci. 2011, 21, 12924–12926. [Google Scholar]
- Zhang, Y.Q.; Qi, G.H.; Li, B.G.; Guo, S.P.; Zhang, X.M.; Qi, K. Female Flower Bud Differentiation in Pistacia chinensis. Acta Bot. Boreal-Occident. Sin. 2011, 31, 972–976. [Google Scholar]
- Copeland, H.F. The reproductive structures of Pistacia chinensis (Anacardiaceae). Phytomorphology 1955, 5, 440–449. [Google Scholar]
- Hormaza, J.I.; Wünsch, A. Pistacia. In Wild Crop Relatives: Genomic and Breeding Resources; Kilian, B., Mammen, K., Eds.; Springer: Berlin/Heidelberg, Germany, 2011; pp. 119–128. [Google Scholar]
- Qiu, Z.F.; Li, B.G.; Gu, Y.H.; Li, Y.C.; Zhang, Y.Q.; Qi, K. Megasporogenesis, microsporogenesis and development of female and male gametophyte of Pistacia chinensis Bunge. Acta Bot. Boreal-Occident. Sin. 2010, 7, 1359–1365. [Google Scholar]
- Wang, Z.C.; Liu, Q.G.; Xu, X.M.; Yang, J.L.; Zhang, T.; Li, C.H. Identification of microRNAs associated with male flower bud development of Populus simonii x Populus nigra. Trees Struct. Funct. 2015, 29, 1329–1339. [Google Scholar] [CrossRef] [Scilit]
- Kersten, B.; Pakull, B.; Fladung, M. Genomics of sex determination in dioecious trees and woody plants. Trees Struct. Funct. 2017, 31, 1113–1125. [Google Scholar] [CrossRef] [Scilit]
- Li, W.X.; He, Z.C.; Zhan, L.; Lu, Z.G.; Xu, J.; Cui, J.E.; Wang, L.; Jin, B. miRNAs involved in the development and differentiation of fertile and sterile flowers in Viburnum macrocephalum f. keteleeri. BMC Genom. 2017, 18, 783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.B. Next-generation Sequencing Sheds New Light on Small RNAs in Plant Reproductive Development. Curr. Issues Mol. Biol. 2018, 27, 143–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsou, C.C.; Tsai, C.F.; Tsui, Y.H.; Sudhir, P.R.; Wang, Y.; Chen, Y.; Chen, J.Y.; Sung, T.Y.; Hsu, W.L. IDEAL-Q: An automated tool for label-free quantitation analysis using an efficient peptide alignment approach and spectral data validation. Mol. Cell Proteom. 2010, 9, 131–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iglesias, F.M.; Cerdán, P.D. Maintaining Epigenetic Inheritance During DNA Replication in Plants. Front. Plant Sci. 2016, 7, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yaish, M.W. Editorial: Epigenetic Modifications Associated with Abiotic and Biotic Stresses in Plants: An Implication for Understanding Plant Evolution. Front. Plant Sci. 2017, 8, 1983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glawe, G.A.; de Jong, T.J. Environmental conditions affect sex expression in monoecious, but not in male and female plants of Urtica dioica. Sex. Plant Reprod. 2005, 17, 253–260. [Google Scholar] [CrossRef] [Scilit]
- Martin, A.; Troadec, C.; Boualem, A.; Rajab, M.; Fernandez, R.; Morin, H.; Pitrat, M.; Dogimont, C.; Bendahmane, A. A transposon-induced epigenetic change leads to sex determination in melon. Nature 2009, 461, 1135–1138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinclair, J.P.; Emlen, J.; Freeman, D.C. Biased sex ratios in plants: Theory and trends. Bot. Rev. 2012, 78, 63–86. [Google Scholar] [CrossRef] [Scilit]






| Primer | Sequence | Species | References | |
|---|---|---|---|---|
| 1 | OPO-08 | CCTCCAGTGT | P. vera | Hormaza et al., 1994; Tan et al., 2003; Yakubov et al., 2005 |
| 2 | BC1200 | GCCTGATTGC | P. vera | Davarynejad et al., 2012; Esfandiyari et al., 2010 |
| 3 | OPP-03 | CTGATACGCC | Andinova et al., 2006 | |
| 4 | OPA-01 | CAGGCCCTTC | Andinova et al., 2006 | |
| 5 | OPA-03 | AGTCAGCCAC | Andinova et al., 2006 | |
| 6 | OPA-12 | TCGGCGATAG | Andinova et al., 2006 | |
| 7 | OPAD-16 | AACGGGCGTC | Andinova et al., 2006 | |
| 8 | OPK-09 | CCCTACCGAC | P. terebinthus | Avanzato et al., 2004; Avanzato and Quarta 2004 |
| 9 | OPK-19 | CACAGGCGGA | Andinova et al., 2006 | |
| 10 | OPL-11 | ACGATGAGCC | P. terebinthus | Kafkas et al., 2001 |
| 11 | S218 | GATGCCAGAC | P. chinensis | Cheng 2011 |
| 12 | S263 | GTCCGGAGTG | P. chinensis | Cheng 2011 |
| 13 | S267 | CTGGACGTCA | P. chinensis | Cheng 2011 |
| 14 | S1420 | AAGGCTCACC | P. chinensis | Cheng 2011 |
| 15 | S1421 | AGCAGCGCAC | P. chinensis | Cheng 2011 |
| 16 | S1426 | GTGGAGTCAG | P. chinensis | Cheng 2011 |
| 17 | S1 | GTTTCGCTCC | P. chinensis | Sun et al., 2014 |
| 18 | S281 | GTGGCATCTC | P. chinensis | Sun et al., 2014 |
| 19-1 | S-a | ACACACACACACACACCG | P. vera | Ehsanpour et al., 2009 |
| 19-2 | S-b | ACACACACACACACACTA | P. vera | |
| 20-1 | S1421-11CF | CTTCTCGGACCAATTAGGGAAGAC | P. chinensis | Cheng 2011 |
| 20-2 | S1421-11CR | CTTCTCGGACTAGCACGGCAGAG | P. chinensis | |
| 21-1 | PVF1 | GTCGTAGATGAAAACACC | P. khinjuk, P. atlantica, P. vera | Davarynejad et al., 2012; Esfandiyari et al., 2010; Yakubov et al., 2005 |
| 21-2 | PVF2 | TAATAGAAGCCATAGA | P. khinjuk, P. atlantica, P. vera | |
| 22-1 | SCO-08-1 | CCTCCAGTGTGAATCAAGTAAAC | P. vera | Yakubov et al., 2005 |
| 22-2 | SCO-08-2 | CCTCCAGTGTTATGTAATACCAAAA | P. vera | |
| 23-1 | S1-1 | CGCTCCTTCTAATGTTGATGACAA | P.chinensis | Sun et al., 2014 |
| 23-2 | S1-2 | TCGCTCCCTCCAAATCCAATAAAC | P.chinensis | |
| 24-1 | S281-1 | CCTGGTTGCTTGTGTTGATTAG | P.chinensis | Sun et al., 2014 |
| 24-2 | S281-2 | GAGTGTCATCAAGCCATCTGTC | P.chinensis |
| Primer | Sequence |
|---|---|
| A1-F | ATACGCCTCAAAATATGCCCCCG |
| A1-R | CGCCAAGTAGTACCCATATTAGTTATTTG |
| A2-F | TGCTGGAGGCAAGGAATCACAT |
| A2-R | CCCACCATCATCGCCTGAATAA |
| A4-F | GCCAAGTAGTACCCATATTAGTTATTTG |
| A4-R | CTCAAAATATGCCCCCGATTCC |
| B1-F | GCCACTTCACAATCTTCCAAA |
| B1-R | ATCCCAACAACAATAAACAAACC |
| B3-F | CCACCAGCGCACGCCATCACCTG |
| B3-R | GGTGGAGATGACGACTGTTTGGATG |
| B6-F | ATGAGTAGAAAGTGGTCCGGGTCAAACCA |
| B6-R | ATTTGTGATGCCGAGTCGGACAGGT |
| C2-F | CGACCCTGGAGCAGCAACACTA |
| C2-R | TCGGTGGGACGACTGGCTTATT |
| C3-F | GCCACACTGGACCCTGCAGATTT |
| C3-R | GGCCAAAATAATTTTCAATAAATAACGG |
| C8-F | CATAGTCGGGGCACGCTCATAC |
| C8-R | AGGGGCTCATTGTCGGGCAGAT |
| D1-F | TTCGAGTTGGCCACGGGGC |
| D1-R | GGCCCTTCTACTTGACTAAGTAGTATTCCACTC |
| D2-F | ACTAGCAGCAGAGCAGTGAACCG |
| D2-R | CAGCCACATCTCCAATCCCTTTT |
| D6-F | CTTCTACTTGACTAAGTAGTATTCCACTC |
| D6-R | CTTCGAGTTGGCCACGGGGCAAC |
| D8-F | CCACGTGTATGGTGGTGATCCATCT |
| D8-R | TTTCATCAAAAAGAAATCTACCTACAGAG |
| E1-F | GCCACGTCTACAGCAATATAAAAG |
| E1-R | GCAGAAAAATATAGAGCAAGAATCAC |
| E5-F | ACGTGTATGGTGGTGATCCGCTC |
| E5-R | TTTCATCAAAAAATCTACCTACGAAAC |
| E6-F | ACAGCAAAACGACCTCAAAAGG |
| E6-R | GGATGATGGGACGACTAAGCAG |
| Sex Expression of Scions | Sex Expression of Grafted Trees | Amount |
|---|---|---|
| monoecious | female | 1 |
| male | female | 2 |
| female | female | 8 |
| male | monoecious | 1 |
| non-flower | monoecious | 1 |
| Date | Female | Male |
|---|---|---|
| April 7–April 10 | Blooming period of male | |
| April 11–April 16 | Blooming period of female, and terminal buds burst | |
| Late April | Vegetative phase, and new shoots grew vigorously | |
| April 27 | Flower bud initial differentiation and new shoot growing phase, leaves spread out and fruits grew fast | Vegetable phase, new shoots grew vigorously and leaves developed |
| May 4 | Bracts and deputy panicle differentiation phase, new shoots stopped growing | |
| May 17 | Floret primordium differentiation phase | Flower bud initial differentiation and new shoot growing phase, leaves spread out |
| May 24 | First round tepal differentiation phase | Bracts and deputy panicle appeared, floret primordium differentiation, and new shoots stopped growing |
| Late May | Stamen primordia appeared and fruits stopped growing | Stamen primordia appeared and developed |
| June 8 | Second round tepal differentiation phase | Pistil primordium sunk down |
| June 16 | Pistil primordium disappeared, anther-like structures expanded | |
| June 29 | Pistil primordium differentiation phase, bracts became brown | |
| July 8 | Flower bud stopped growing, bracts continued materialization | Bracts became brown |
| July 16 | Fruit developmental phase | |
| July 25 | Fruit-embryo developmental phase | Flower bud stopped growing, bracts continued materialization |
| Beginning of October | Fruit maturation, and leaves became yellow | Leaves became yellow |
| November | Leaves fell off and then entered into dormancy period | Leaves fell off and then entered into dormancy period |
| Mid-March | Bud burst stage, pistil differentiation phase, and carpel primordia emerged | Bud burst stage, and anthers developed, and pollen sacs formed |
| Beginning of April | Carpel and ovule appeared, and inflorescences developed | Inflorescences developed and pollen appeared |
| April 14–April 18 | Blooming period of male | |
| April 19–April 25 | Blooming period of female |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, Q.; Zhu, C.; Lei, X.; Cao, T.; Su, S.; Leng, P. Sex Determination During Inflorescence Bud Differentiation in Monoecious Pistacia chinensis Bunge. Forests 2019, 10, 202. https://doi.org/10.3390/f10030202
Bai Q, Zhu C, Lei X, Cao T, Su S, Leng P. Sex Determination During Inflorescence Bud Differentiation in Monoecious Pistacia chinensis Bunge. Forests. 2019; 10(3):202. https://doi.org/10.3390/f10030202
Chicago/Turabian StyleBai, Qian, Chenyi Zhu, Xia Lei, Tao Cao, Shuchai Su, and Pingsheng Leng. 2019. "Sex Determination During Inflorescence Bud Differentiation in Monoecious Pistacia chinensis Bunge" Forests 10, no. 3: 202. https://doi.org/10.3390/f10030202
APA StyleBai, Q., Zhu, C., Lei, X., Cao, T., Su, S., & Leng, P. (2019). Sex Determination During Inflorescence Bud Differentiation in Monoecious Pistacia chinensis Bunge. Forests, 10(3), 202. https://doi.org/10.3390/f10030202

