The Mechanical Properties, Corrosion Resistance, and Biocompatibility of a Novel Ternary Ti-xNb-5Ta Alloy for Biomedical Applications
Abstract
1. Introduction
2. Materials and Methods
2.1. Alloy Design
2.2. Ingots Preparation
2.3. Specimen Characterization
2.4. Electrochemical Experiment
2.5. Surface Bioactivity Assessment
2.6. Cytocompatibility and Osteogenic Differentiation Assay
3. Results
3.1. Properties of Novel Ti-xNb-5Ta Alloys
3.1.1. Microstructure Analysis of Ti-xNb-5Ta Alloys
3.1.2. Mechanical Properties of Ti-xNb-5Ta Alloy
3.2. Corrosion Resistance Analysis of Ti-xNb-5Ta Alloy
3.3. The Biocompatibility of Ti-xNb-5Ta Alloys
3.3.1. Biomineralization Capacity in an SBF Solution
3.3.2. The Effect of Ti-xNb-5Ta on the Growth and Adhesion of hBMSCs
3.3.3. Effect of Ti-xNb-5Ta on ALP Activity of hBMSCs
4. Discussion
5. Conclusions
- 1.
- Microstructure: The Ti-xNb-5Ta alloys predominantly displayed an orthorhombic α″ phase with a martensitic microstructure. Increasing the Nb content reduced the grain size from 13 μm (Ti-5Nb-5Ta) to 3 μm (Ti-13Nb-5Ta).
- 2.
- Mechanical Properties: The Ti-xNb-5Ta alloys’ mechanical properties (higher tensile strength and lower elastic modulus) demonstrated potential as biomedical materials, requiring further investigations such as heat treatment or additive manufacturing.
- 3.
- Corrosion Resistance: The EIS of the Ti-xNb-5Ta alloy demonstrated that as the Nb content increased, the corrosion resistance increased. All the Ti-xNb-5Ta alloys exhibited superior corrosion resistance compared to existing biomedical materials.
- 4.
- Biocompatibility: Ti-xNb-5Ta alloys have the possibility to enhance the early osteogenic differentiation of hBMSCs. In future studies, we will conduct in vivo experiments on, for example, osseointegration, vascularization, and possible inflammatory responses to further explore the potential of Ti-xNb-5Ta alloys as biomedical materials.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Scuteri, A.; Nilsson, P.M. Chapter 4—Aging Population: Challenges and Opportunities in a Life Course Perspective. In Early Vascular Aging (EVA), 2nd ed.; Cunha, P.G., Nilsson, P.M., Olsen, M.H., Boutouyrie, P., Laurent, S., Eds.; Academic Press: Boston, MA, USA, 2024; pp. 35–39. [Google Scholar]
- Denmark, F.L.; Mulligan-Stark, T.; Stauber, A.; Kuriansky, J. Chapter 68—Impact of technology on health and well-being of the aging population in the COVID-19 era. In Resilient Health; Kuriansky, J., Kakkattil, P., Eds.; Academic Press: Cambridge, MA, USA, 2024; pp. 819–828. [Google Scholar]
- Kumar, N.; Kumar, V.; Gangwar, A.K.; Shrivastava, S.; Saxena, S.; Khangembam, S.D.; Maiti, S.K.; Udehiya, R.K.; Mishra, M.; Raghuvanshi, P.D.S.; et al. 1—An introduction to biomaterials. In Natural Biomaterials for Tissue Engineering; Kumar, N., Saxena, S., Kumar, V., Gangwar, A.K., Mathew, D.D., Shrivastava, S., Singh, N.K., Eds.; Academic Press: Cambridge, MA, USA, 2025; pp. 1–16. [Google Scholar]
- Vrana, N.E. 1—Introduction to biomaterials for tissue/organ regeneration. In Biomaterials for Organ and Tissue Regeneration; Vrana, N.E., Knopf-Marques, H., Barthes, J., Eds.; Woodhead Publishing: Sawston, CA, USA, 2020; pp. 3–17. [Google Scholar]
- Wu, H.; Chen, X.; Kong, L.; Liu, P. Mechanical and Biological Properties of Titanium and Its Alloys for Oral Implant with Preparation Techniques: A Review. Materials 2023, 16, 6860. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-E.; Yoon, Y.; Pae, A.; Kwon, Y.-D. Clinical outcome of narrow diameter dental implants: A 3-year retrospective study. Maxillofac. Plast. Reconstr. Surg. 2023, 45, 26. [Google Scholar] [CrossRef] [PubMed]
- Raikar, S.; Talukdar, P.; Kumari, S.; Panda, S.K.; Oommen, V.M.; Prasad, A. Factors Affecting the Survival Rate of Dental Implants: A Retrospective Study. J. Int. Soc. Prev. Community Dent. 2017, 7, 351–355. [Google Scholar] [CrossRef] [PubMed]
- Shavit, A.S.; Rittel, D.; Shemtov-Yona, K. The chemical and microstructural signature of peri-implantitis on titanium dental implants’ surface. Appl. Surf. Sci. Adv. 2024, 19, 100553. [Google Scholar] [CrossRef]
- Lin, Y.-C.; Hu, C.-C.; Nguyen, T.-T.; Dhawan, U.; Chou, C.-Y.; Lee, Y.-L.; Yen, H.-W.; Kuo, Y.-J.; Chung, R.-J. Study on surface hydrogenated Ti6Al4V alloy for orthopedic implants. J. Mater. Res. Technol. 2024, 28, 1504–1513. [Google Scholar] [CrossRef]
- Chen, J.; Song, C.; Deng, Z.; Huang, J.; Han, C.; Yang, Y.; Wang, J.; Xu, K. Functional gradient design of additive manufactured gyroid tantalum porous structures: Manufacturing, mechanical behaviors and permeability. J. Manuf. Process. 2024, 125, 202–216. [Google Scholar] [CrossRef]
- Saha, S.; Kiran, K.U.V.; Zhang, X.; Hou, X.; Roy, S. Investigating the tribological and corrosion behavior of Co–Cr alloy as an implant material for orthodontic applications. Wear 2023, 523, 204755. [Google Scholar] [CrossRef]
- Uzer-Yilmaz, B. Chapter 5—Mechanical performance of metallic biomaterials: Fundamentals and mechanisms. In Multiscale Cell-Biomaterials Interplay in Musculoskeletal Tissue Engineering and Regenerative Medicine; Oliveira, J.M., Reis, R.L., Pina, S., Eds.; Academic Press: Cambridge, MA, USA, 2024; pp. 113–126. [Google Scholar]
- Zhang, Q.; Niu, Q. Necroptosis in aluminum-induced neural cells and animal models of Alzheimer’s disease. JTEMIN 2024, 8, 100125. [Google Scholar] [CrossRef]
- Laupheimer, C.E.; Kolianchuk, Y.; FitzGerald, R.E.; Wilks, M.F.; Jaksch, A. Toxicological evaluation of vanadium and derivation of a parenteral tolerable intake value for medical devices. Regul. Toxicol. Pharm. 2024, 105732. [Google Scholar] [CrossRef]
- Jin, S.; Yu, Y.; Zhang, T.; Xie, D.; Zheng, Y.; Wang, C.; Liu, Y.; Xia, D. Surface modification strategies to reinforce the soft tissue seal at transmucosal region of dental implants. Bioact. Mater. 2024, 42, 404–432. [Google Scholar] [CrossRef]
- Chattopadhyay, D.; Das, B. Chapter 3—Scaffold’ properties and materials used in scaffold designing. In Design, Characterization and Fabrication of Polymer Scaffolds for Tissue Engineering; Chattopadhyay, D., Das, B., Eds.; Elsevier Science Ltd.: Amsterdam, The Netherlands, 2025; pp. 43–87. [Google Scholar]
- Wanniarachchi, C.T.; Arjunan, A.; Baroutaji, A.; Singh, M. 3D printing customised stiffness-matched meta-biomaterial with near-zero auxeticity for load-bearing tissue repair. Bioprinting 2023, 33, e00292. [Google Scholar] [CrossRef]
- Andani, M.T.; Shayesteh Moghaddam, N.; Haberland, C.; Dean, D.; Miller, M.J.; Elahinia, M. Metals for bone implants. Part 1. Powder metallurgy and implant rendering. Acta Biomater. 2014, 10, 4058–4070. [Google Scholar] [CrossRef] [PubMed]
- Čapek, J.; Stehlíková, K.; Michalcová, A.; Msallamová, Š.; Vojtěch, D. Microstructure, mechanical and corrosion properties of biodegradable powder metallurgical Fe-2 wt% X (X = Pd, Ag and C) alloys. Mater. Chem. Phys. 2016, 181, 501–511. [Google Scholar] [CrossRef]
- Manam, N.S.; Harun, W.S.W.; Shri, D.N.A.; Ghani, S.A.C.; Kurniawan, T.; Ismail, M.H.; Ibrahim, M.H.I. Study of corrosion in biocompatible metals for implants: A review. J. Alloys Compd. 2017, 701, 698–715. [Google Scholar] [CrossRef]
- Savio, D.; Bagno, A. When the Total Hip Replacement Fails: A Review on the Stress-Shielding Effect. Processes 2022, 10, 612. [Google Scholar] [CrossRef]
- Socorro-Perdomo, P.P.; Florido-Suárez, N.R.; Mirza-Rosca, J.C.; Saceleanu, M.V. EIS Characterization of Ti Alloys in Relation to Alloying Additions of Ta. Materials 2022, 15, 476. [Google Scholar] [CrossRef]
- Mahale, R.S.; Shamanth, V.; Sharath, P.C.; Raibole, V.S.; Goggi, K.P.; Kanaginahal, G.M.; Tiwary, V.G.; Rajendrachari, S.; Kakkamari, P. Chapter 12—Current and future applications of mechanically alloyed materials. In Mechanical Alloying of Ferrous and Non-Ferrous Alloys; Rajendrachari, S., Ed.; Elsevier: Amsterdam, The Netherlands, 2024; pp. 307–364. [Google Scholar]
- Abd-Elaziem, W.; Darwish, M.A.; Hamada, A.; Daoush, W.M. Titanium-Based alloys and composites for orthopedic implants Applications: A comprehensive review. Mater. Des. 2024, 241, 112850. [Google Scholar] [CrossRef]
- Chen, J.; Ma, F.; Liu, P.; Wang, C.; Liu, X.; Li, W.; Han, Q. Effects of Nb on Superelasticity and Low Modulus Properties of Metastable β-Type Ti-Nb-Ta-Zr Biomedical Alloys. J. Mater. Eng. Perform. 2019, 28, 1410–1418. [Google Scholar] [CrossRef]
- Yi, X.-y.; Cao, X.-j.; Huang, B.-w.; Sun, K.-s.; Sun, B.; Meng, X.-l.; Gao, Z.-y.; Wang, H.-z. Performance optimization of ternary Ti−Nb−Cu shape memory alloys based on d electron theory. Trans. Nonferrous Met. Soc. China 2024, 34, 861–873. [Google Scholar] [CrossRef]
- Li, Y.; Fang, H.; Chen, R.; Sun, S.; Xue, X.; Guo, J. Optimization of (α + β) microstructure and trade-off between strength and toughness: Based on Mo[eq] and d electron theory in β-Ti alloy. Mater. Des. 2023, 231, 112022. [Google Scholar] [CrossRef]
- Yu, Z. Chapter 2—Design and physical metallurgy of biomedical β-Ti alloys. In Titanium Alloys for Biomedical Development and Applications; Yu, Z., Ed.; Elsevier: Amsterdam, The Netherlands, 2022; pp. 27–53. [Google Scholar]
- Sidhu, S.S.; Singh, H.; Gepreel, M.A.-H. A review on alloy design, biological response, and strengthening of β-titanium alloys as biomaterials. Mater. Sci. Eng. C 2021, 121, 111661. [Google Scholar] [CrossRef] [PubMed]
- GB/T 4698.22-2017; Methods for chemical analysis of titanium sponge, titanium and titanium alloys—Part 22: Determination of niobium content—5-Br-PADAP spectrophotometry and inductively coupled plasma atomic emission spectrometry. China National Technical Committee on Nonferrous Metals of Standardization: Beijing, China, 2017.
- Gammon, L.M.; Briggs, R.D.; Packard, J.M.; Batson, K.W.; Boyer, R.; Domby, C.W. Metallography and Microstructures of Titanium and Its Alloys. In Metallography and Microstructures, Vander Voort, G.F., Ed.; ASM International: Almere, the Netherlands, 2004; Volume 9. [Google Scholar]
- Talbot, C.E.P.; Church, N.L.; Hildyard, E.M.; Connor, L.D.; Miller, J.R.; Jones, N.G. On the stability and formation of the α″ and ω phases in Ti-Nb alloys upon cooling. Acta Mater. 2024, 262, 119409. [Google Scholar] [CrossRef]
- Manso Gonçalves, V.R.; Lisboa Filho, P.N.; Moreira Afonso, C.R. Unravelling microstructure of novel as-cast in-situ α Ti and β Ti-Nb alloy matrix composites with NbC addition. Mater. Lett. 2023, 349, 134794. [Google Scholar] [CrossRef]
- Li, Z.; Wo, J.; Fu, Y.; Xu, X.; Wang, B.; Liu, H.; You, D.; Sun, G.; Li, W.; Wang, X. Effects of Zr Addition on the Microstructural Evolution, Mechanical Properties, and Corrosion Behavior of Novel Biomedical Ti–Zr–Mo–Mn Alloys. ACS Biomater. Sci. Eng. 2023, 9, 6935–6946. [Google Scholar] [CrossRef]
- Kumar Tiwari, A.; Kumar Singh, R.; Ji, G. Investigation on corrosion behaviour of electrical discharge machined surfaces of Titanium-C2 in NaCl solution. Mater. Today Proc. 2023. [Google Scholar] [CrossRef]
- Kim, K.-T.; Nisar, S.S.; Choe, H.-C. Mechanical octacalcium phosphate coatings on the plasma electrolytic oxidized pure titanium for bio-implant use. Surf. Coat. Technol. 2024, 480, 130602. [Google Scholar] [CrossRef]
- Atik, B.; Bozkurt, Y.B.; Kavasoğlu, Y.S.; Kovacı, H.; Çelik, A. Pitting corrosion performance of plasma oxidized Cp-Ti and effects of fabrication methods. Surf. Coat. Technol. 2024, 478, 130384. [Google Scholar] [CrossRef]
- Li, B.Q.; Xie, R.Z.; Lu, X. Microstructure, mechanical property and corrosion behavior of porous Ti–Ta–Nb–Zr. Bioact. Mater. 2020, 5, 564–568. [Google Scholar] [CrossRef]
- Miyajima, H.; Touji, H.; Iijima, K. Hydroxyapatite Particles from Simulated Body Fluids with Different pH and Their Effects on Mesenchymal Stem Cells. Nanomaterials 2021, 11, 2517. [Google Scholar] [CrossRef]
- Huang, R.; Suo, W.; Wang, Y.; Pan, Y.; Ren, G.; Hu, H.; Huang, L. Enhancing wear resistance, anti-corrosion property and surface bioactivity of a beta-titanium alloy by adopting surface mechanical attrition treatment followed by phosphorus ion implantation. Appl. Surf. Sci. 2024, 671, 160766. [Google Scholar] [CrossRef]
- Shah, A.T.; Ain, Q.; Chaudhry, A.A.; Ahmad, S.; Zarif, F.; Siddiqi, S.A.; Qasim, S.b.; Görke, O.; Khan, A.S.; Rehman, I.u. Acid catalysed synthesis of bioactive glass by evaporation induced self assembly method. J. Non-Cryst. Solids 2018, 479, 1–8. [Google Scholar] [CrossRef]
- Tiwari, K.; Blanquer, A.; Pavan, C.; Tomatis, M.; Navas, N.F.; Scaglione, F.; Fiore, G.; Turci, F.; Nogués, C.; Rizzi, P. Surface modification of Ti40Cu40Zr11Fe3Sn3Ag3 amorphous alloy for enhanced biocompatibility in implant applications. J. Mater. Res. Technol. 2024, 30, 2333–2346. [Google Scholar] [CrossRef]
- Martins Junior, J.R.; Kuroda, P.A.; Grandini, C.R. Investigation of the Chemical Composition, Microstructure, Density, Microhardness, and Elastic Modulus of the New β Ti-50Nb-xMo Alloys for Biomedical Applications. Materials 2024, 17, 250. [Google Scholar] [CrossRef]
- Marchenko, E.S.; Klopotov, A.A.; Baigonakova, G.A.; Zhukov, I.A. Regularities in the Evolution of Thermoelastic Martensitic Transformations during Cooling/Heating in the Free State and under Load of Titanium Nickelide Alloyed with Niobium. Materials 2024, 17, 175. [Google Scholar] [CrossRef] [PubMed]
- Hussein, A.H.; Gepreel, M.A.H.; Gouda, M.K.; Hefnawy, A.M.; Kandil, S.H. Biocompatibility of new Ti–Nb–Ta base alloys. Mater. Sci. Eng. C 2016, 61, 574–578. [Google Scholar] [CrossRef]
- Church, N.L.; Prasad, A.; Jones, N.G. On the design of low modulus Ti–Nb–Au alloys for biomedical applications. J. Mech. Behav. Biomed. Mater. 2024, 157, 106633. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, S.; Sun, Z.; Wang, H.; Ren, L.; Yang, K. Optimization of mechanical property, antibacterial property and corrosion resistance of Ti-Cu alloy for dental implant. J. Mater. Sci. Technol. 2019, 35, 2336–2344. [Google Scholar] [CrossRef]
- Hussein, M.A.; Madhan Kumar, A.; Azeem, M.A.; Ankah, N. Design, processing, and biocorrosion study of Ti–30Nb alloy with low elastic modulus for bioimplant applications. Mater. Chem. Phys. 2023, 309, 128413. [Google Scholar] [CrossRef]
- Correa, D.R.N.; Kuroda, P.A.B.; Lourenço, M.L.; Buzalaf, M.A.R.; Mendoza, M.E.; Archanjo, B.S.; Achete, C.A.; Rocha, L.A.; Grandini, C.R. Microstructure and selected mechanical properties of aged Ti-15Zr-based alloys for biomedical applications. Mater. Sci. Eng. C 2018, 91, 762–771. [Google Scholar] [CrossRef]
- Gölbaşı, Z.; Öztürk, B.; Sünbül, S.E.; İçin, K. Mechanical, wear and corrosion behavior of Ti–6Al–xNb (x = 3.5–21 wt%) alloys manufactured by powder metallurgy. Powder Technol. 2023, 426, 118696. [Google Scholar] [CrossRef]
- Jiang, T.; Fu, S.; Dong, J. Effect of grain boundary characteristic distribution on corrosion resistence performance of B10 cupronickel. Nonferrous Met. Mater. Eng. 2023, 44, 15–23. [Google Scholar] [CrossRef]
- Zhou, J.-l.; Cheng, Y.-h.; Wan, Y.-x.; Chen, H.; Wang, Y.-f.; Yang, J.-y. Laser clad CoCrFeNiTixNby hypoeutectic high-entropy alloy coating: Effects of Ti and Nb content on mechanical, wear and corrosion properties. Surf. Coat. Technol. 2024, 494, 131346. [Google Scholar] [CrossRef]
- Pan, B.; Xu, X.; Yang, J.; Zhan, H.; Feng, L.; Long, Q.; Yao, Q.; Deng, J.; Cheng, L.; Lu, Z.; et al. Effect of Nb, Ti, and V on wear resistance and electrochemical corrosion resistance of AlCoCrNiMx (M=Nb, Ti, V) high-entropy alloys. Mater. Today Commun. 2024, 39, 109314. [Google Scholar] [CrossRef]
- Xie, F.; Lu, D.; Cao, S.; Mu, Y.; Sun, Q. Electrochemical corrosion behavior and in vitro biocompatibility of Ti-Nb-Sn alloy for dental applications. Corros. Sci. 2023, 224, 111531. [Google Scholar] [CrossRef]
- Du, P.; Cui, Z.; Xiang, T.; Li, Y.; Zhang, L.; Cai, Z.; Zhao, M.; Xie, G. Optimizing the cell compatibility and mechanical properties in TiZrNbTa medium-entropy alloy/β-Ti composites through phase transformation. Acta Biomater. 2024, 181, 469–482. [Google Scholar] [CrossRef]
- Chmielewska, A.; Dean, D. The role of stiffness-matching in avoiding stress shielding-induced bone loss and stress concentration-induced skeletal reconstruction device failure. Acta Biomater. 2024, 173, 51–65. [Google Scholar] [CrossRef]
Alloys | Nb | Ta | C | N | H | O | Ti |
---|---|---|---|---|---|---|---|
Ti-5Nb-5Ta | 5.18 | 5.21 | 0.014 | 0.007 | 0.002 | 0.013 | Bal. |
Ti-7Nb-5Ta | 7.13 | 4.96 | 0.016 | 0.006 | 0.002 | 0.015 | Bal. |
Ti-10Nb-5Ta | 9.95 | 5.18 | 0.017 | 0.027 | 0.001 | 0.016 | Bal. |
Ti-13Nb-5Ta | 13.16 | 5.08 | 0.023 | 0.018 | 0.002 | 0.019 | Bal. |
Composition | Concentration, g/L |
---|---|
NaCl | 8.035 |
NaHCO3 | 0.355 |
KCl | 0.255 |
K2HPO4·3H2O | 0.231 |
MgCl2·6H2O | 0.311 |
CaCl2 | 0.292 |
Na2SO4 | 0.072 |
Tris | 6.118 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Ocn | GGCGCTACCTGTATCAATGG | GTGGTCAGCCAACTCGTCA |
Opn | TCCTAGCCCCACAGACCCTT | CACACTATCACCTCGGCCA |
Runx2 | GCCGGGAATGATGAGAACTA | GCCGGGAATGATGAGAACTA |
Nb Content | Elastic Modulus/GPa | Tensile Strength/MPa | Elongation/% | Vickers Hardness/HV |
---|---|---|---|---|
5 Nb | 69.4 | 505.7 | 9.59 | 197.0 ± 11.6 |
7 Nb | 82.2 | 491.5 | 22.40 | 206.8 ± 7.4 |
10 Nb | 79.6 | 585.3 | 24.29 | 221.6 ± 3.3 |
13 Nb | 90.1 | 651.2 | 16.23 | 233.9 ± 4.8 |
Nb Content | Eocp (V) | Ecorr (V) | icorr (10−6 A/cm2) |
---|---|---|---|
5 Nb | −0.19 | −0.196 | 8.71 |
7 Nb | −0.16 | −0.151 | 7.59 |
10 Nb | −0.11 | −0.103 | 3.62 |
13 Nb | −0.07 | −0.071 | 0.97 |
Nb Content | RS (Ω·cm2) | Q (F·cm−2) | Rq (Ω·cm2) | nq |
---|---|---|---|---|
5 Nb | 0.43 | 6.19 × 10−4 | 189 | 0.8 |
7 Nb | 1.06 | 2.44 × 10−4 | 788 | 0.595 |
10 Nb | 1.69 | 2.53 × 10−4 | 1009 | 0.7198 |
13 Nb | 1.01 | 3.56 × 10−4 | 1225 | 0.6119 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, H.; Jiang, T.; Kong, L.; Chen, X.; Liu, P. The Mechanical Properties, Corrosion Resistance, and Biocompatibility of a Novel Ternary Ti-xNb-5Ta Alloy for Biomedical Applications. Materials 2025, 18, 602. https://doi.org/10.3390/ma18030602
Wu H, Jiang T, Kong L, Chen X, Liu P. The Mechanical Properties, Corrosion Resistance, and Biocompatibility of a Novel Ternary Ti-xNb-5Ta Alloy for Biomedical Applications. Materials. 2025; 18(3):602. https://doi.org/10.3390/ma18030602
Chicago/Turabian StyleWu, Haochen, Tao Jiang, Linghui Kong, Xiaohong Chen, and Ping Liu. 2025. "The Mechanical Properties, Corrosion Resistance, and Biocompatibility of a Novel Ternary Ti-xNb-5Ta Alloy for Biomedical Applications" Materials 18, no. 3: 602. https://doi.org/10.3390/ma18030602
APA StyleWu, H., Jiang, T., Kong, L., Chen, X., & Liu, P. (2025). The Mechanical Properties, Corrosion Resistance, and Biocompatibility of a Novel Ternary Ti-xNb-5Ta Alloy for Biomedical Applications. Materials, 18(3), 602. https://doi.org/10.3390/ma18030602