Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Metal Salt Solutions
2.2. Cell Culture
2.3. Cellular Activity
2.4. Analysis of Gene Expression
2.5. Quantification of Cytokine Release in Cell Culture Supernatants
2.6. ROS Assay
2.7. Statistical Analyses
3. Results
3.1. Effects of Metal Ions on Cell Number and Cellular Activity in THP-1 Monocytes and Macrophages
3.2. Effects of Metal ions on ROS Production in THP-1 Monocytes and Macrophages
3.3. Influence of Metal Ions on Gene Expression and Protein Release of Inflammatory Mediators in THP-1 Monocytes and Macrophages
3.3.1. Gene Expression and Protein Release of the Proinflammatory Cytokine IL-1β
3.3.2. Gene Expression and Protein Release of Chemokines
3.3.3. Gene Expression and Protein Release of Mediators of Macrophage Differentiation
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kurtz, S.; Ong, K.; Lau, E.; Mowat, F.; Halpern, M. Projections of primary and revision hip and knee arthroplasty in the United States from 2005 to 2030. J. Bone Jt. Surg. Am. 2007, 89, 780–785. [Google Scholar] [CrossRef]
- Herberts, P.; Malchau, H. Long-term registration has improved the quality of hip replacement: A review of the Swedish THR Register comparing 160,000 cases. Acta Arthop. Scand. 2000, 79, 111–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patel, N.R.; Gohil, P.P. A Review on Biomaterials: Scope, Applications & Human Anatomy Significance. IJETAE 2012, 2, 91–101. [Google Scholar]
- Bitar, D.; Parvizi, J. Biological response to prosthetic debris. World J. Orthop. 2015, 6, 172–189. [Google Scholar] [CrossRef] [PubMed]
- Purdue, P.E. Alternative macrophage activation in periprosthetic osteolysis. Autoimmunity 2008, 41, 212–217. [Google Scholar] [CrossRef]
- Gallo, J.; Konttinen, Y.T.; Goodman, S.B.; Thyssen, J.P.; Gibon, E.; Pajarinen, J.; Takakubo, Y.; Schalock, P.; Mackiewicz, Z.; Jämsen, E.; et al. Aseptic Loosening of Total Hip Arthroplasty as a Result of Local Failure of Tissue Homeostasis. In Recent Advances in Arthroplasty; Fokter, S.K., Ed.; IntechOpen: London, UK, 2012; pp. 319–362. [Google Scholar] [CrossRef] [Green Version]
- Hallab, N.J.; Jacobs, J.J. Chemokines Associated with Pathologic Responses to Orthopedic Implant Debris. Front. Endocrinol. 2017, 8. [Google Scholar] [CrossRef] [Green Version]
- Gu, Q.; Shi, Q.; Yang, H. The Role of TLR and Chemokine in Wear Particle-Induced Aseptic Loosening. J. Biomed. Biotechnol. 2012, 596870. [Google Scholar] [CrossRef] [Green Version]
- Sundfeld, M.; Carlsson, L.V. Aseptic loosening, not only a question of wear: A review of different theories. Acta Orthop. 2006, 77, 177–197. [Google Scholar] [CrossRef]
- Sabella, S.; Carney, R.P. A general mechanism for intracellular toxicity of metal-containing nanoparticles. Nanoscale 2014, 6, 7052–7061. [Google Scholar] [CrossRef] [Green Version]
- Jonitz-Heincke, A.; Sellin, M.L.; Seyfarth, A.; Peters, K.; Mueller-Hilke, B.; Fiedler, T.; Bader, R.; Klinder, A. Analysis of Cellular Activity Short-Term Exposure to Cobalt and Chromium Ions in Mature Human Osteoblasts. Materials 2019, 12, 2771. [Google Scholar] [CrossRef] [Green Version]
- Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Chana, M.; Lewis, J.B.; Davis, R.; Elam, Y.; Hobbs, D.; Lockwood, P.E.; Wataha, J.C.; Messer, R.L. Biological effects of Ni(II) on monocytes and macrophages in normal and hyperglycemic environments. J. Biomed. Mater. Res. A 2018, 106, 2433–2439. [Google Scholar] [CrossRef] [PubMed]
- Italiani, P.; Boraschi, D. From Monocytes to M1/M2 Macrophages: Phenotypical vs. Functional Differentiation. Front. Immunol. 2014, 5. [Google Scholar] [CrossRef] [Green Version]
- Shi, C.; Pamer, E.G. Monocyte recruitment during infection and inflammation. Nat. Rev. Immunol. 2011, 11, 762–774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwon, Y.M.; Xia, Z.; Glyn-Jones, S.; Beard, D.; Gill, H.S.; Murray, D.W. Dose-dependent cytotoxicity of clinically relevant cobalt nanoparticles and ions on macrophages in vitro. Biomed. Mater. 2009, 4, 25018. [Google Scholar] [CrossRef]
- Stohs, S.J.; Bagchi, D. Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 1995, 18, 321–336. [Google Scholar] [CrossRef] [Green Version]
- Warnatsch, A.; Tsourouktsoglou, T.D.; Branzk, N.; Wang, Q.; Reincke, S.; Herbst, S.; Gutierrez, M.; Papayannopoulos, V. Reactive Oxygen Species Localization Programs Inflammation to Clear Microbes of Different Size. Immunity 2017, 46, 421–432. [Google Scholar] [CrossRef] [Green Version]
- Petit, A.; Mwale, F.; Tkaczyk, C.; Antoniou, J.; Zukor, D.J.; Huk, O.L. Induction of protein oxidation by cobalt and chromium ions in human U937 macrophages. Biomaterials 2005, 26, 4416–4422. [Google Scholar] [CrossRef]
- Scharf, B.; Clement, C.C.; Zolla, V.; Perino, G.; Yan, B.; Elci, S.G.; Purdue, E.; Goldring, S.; Macaluso, F.; Cobelli, N.; et al. Molecular analysis of chromium and cobalt-related toxicity. Sci. Rep. 2014, 4, 5729. [Google Scholar] [CrossRef] [Green Version]
- Sansone, V.; Pagani, D.; Melato, M. The effects on bone cells of metal ions released from orthopaedic implants. A review. Clin. Cases Miner. Bone Metab. 2013, 10, 34–40. [Google Scholar] [CrossRef]
- Ferko, M.A.; Catelas, I. Effects of metal ions on caspase-1 activation and interleukin-1β release in murine bone marrow-derived macrophages. PLoS ONE 2018, 13, e0199936. [Google Scholar] [CrossRef]
- Huk, O.L.; Catelas, I.; Mwale, F.; Antoniou, J.; Zukor, D.J.; Petit, A. Induction of apoptosis and necrosis by metal ions in vitro. J. Arthoplast. 2004, 19, 84–87. [Google Scholar] [CrossRef]
- Simonsen, L.O.; Harbak, H.; Bennekou, P. Cobalt metabolism and toxicology—A brief update. Sci. Total Environ. 2012, 432, 210–215. [Google Scholar] [CrossRef]
- Shrivastava, R.; Upreti, R.K.; Seth, P.K.; Chaturvedi, U.C. Effects of chromium on the immune system. FEMS Immunol. Med. Microbiol. 2002, 34, 1–7. [Google Scholar] [CrossRef]
- Bagchi, D.; Stohs, S.J.; Downs, B.W.; Bagchi, M.; Preuss, H.G. Cytotoxicity and oxidative mechanisms of different forms of chromium. Toxicology 2002, 180, 5–22. [Google Scholar] [CrossRef]
- Fleury, C.; Petit, A.; Mwale, F.; Antoniou, J.; Zukor, D.J.; Tabrizian, M.; Huk, O.L. Effect of cobalt and chromium ions on human MG-63 osteoblasts in vitro: Morphology, cytotoxicity, and oxidative stress. Biomaterials 2006, 27, 3351–3360. [Google Scholar] [CrossRef]
- Boyette, L.B.; Macedo, C.; Hadi, K.; Elinoff, B.D.; Walters, J.T.; Ramaswami, B.; Chalasani, G.; Taboas, J.M.; Lakkis, F.G.; Metes, D.M. Phenotype, function, and differentiation potential of human monocyte subsets. PLoS ONE 2017, 12, e0176460. [Google Scholar] [CrossRef]
- Gallo, J.; Goodman, S.B.; Konttinen, Y.T.; Raska, M. Particle disease: Biologic mechanisms of periprosthetic osteolysis in total hip arthroplasty. Innate Immun. 2013, 19, 213–224. [Google Scholar] [CrossRef] [Green Version]
- Boyce, B.F.; Xing, L. The RANKL/RANK/OPG pathway. Curr. Osteoporos. Rep. 2007, 5, 98–104. [Google Scholar] [CrossRef]
- Arana, L.; Gangoiti, P.; Ouro, A.; Rivera, I.G.; Ordoñez, M.; Trueba, M.; Lankalapalli, R.S.; Bittman, R.; Gomez-Muñoz, A. Generation of reactive oxygen species (ROS) is a key factor for stimulation of macrophage proliferation by ceramide 1-phosphate. Exp. Cell Res. 2012, 318, 350–360. [Google Scholar] [CrossRef]
- Mantovani, A.; Biswas, S.K.; Galdiero, M.R.; Sica, A.; Locati, M. Macrophage plasticity and polarization in tissue repair and remodelling. J. Pathol. 2013, 229, 176–185. [Google Scholar] [CrossRef]
- Glanz, V.; Myasoedova, V.A.; Sukhorukov, V.; Grechko, A.; Zhang, D.; Romaneneko, E.B.; Orekhova, V.A.; Orekhov, A. Transcriptional Characteristics of Activated Macrophages. Curr. Pharm. Des. 2019, 25, 213–217. [Google Scholar] [CrossRef]
- Sitia, R.; Rubartelli, A. The unconventional secretion of IL-1β: Handling a dangerous weapon to optimize inflammatory responses. Semin. Cell Dev. Biol. 2018, 83, 12–21. [Google Scholar] [CrossRef]
- Talwar, H.; Bauerfeld, C.; Bouhamdan, M.; Farshi, P.; Liu, Y.; Samavati, L. MKP-1 negatively regulates LPS-mediated IL-1β production through p38 activation and HIF-1α expression. Cell. Signal. 2017, 34, 1–10. [Google Scholar] [CrossRef]
- Hallab, N.J.; Jacobs, J.J. Biologic effects of implant debris. Bull. NYU Hosp. Jt. Dis. 2009, 67, 182–188. [Google Scholar]
- Mortier, A.; Van Damme, J.; Proost, P. Overview of the mechanisms regulating chemokine activity and availability. Immunol. Lett. 2012, 145, 2–9. [Google Scholar] [CrossRef]
- Graham, G.J.; Locati, M. Regulation of the immune and inflammatory responses by the ‘atypical’ chemokine receptor D6. J. Pathol. 2013, 229, 168–175. [Google Scholar] [CrossRef]
- Savino, B.; Borroni, E.M.; Torres, N.M.; Proost, P.; Struyf, S.; Mortier, A.; Mantovani, A.; Locati, M.; Bonecchi, R. Recognition versus adaptive up-regulation and degradation of CC chemokines by the chemokine decoy receptor D6 are determined by their N-terminal sequence. J. Biol. Chem. 2009, 284, 26207–26215. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequences (5′-3′) |
---|---|
Hypoxanthine-guanine phosphoribosyl transferase (HPRT) | for: CCCTGGCGTCGTGATTAGTG rev: TCGAGCAAGACGTTCAGTCC |
Interleukin 1β (IL-1β) | for: TACTCACTTAAAGCCCGCCT rev: ATGTGGGAGCGAATGACAGA |
Interleukin 8 (IL-8) | for: TCTGTGTGAAGGTGCAGTTTTG rev: ATTTCTGTGTTGGCGCAGTG |
Monocyte chemotactic protein 1 (MCP-1) | for: CCGAGAGGCTGAGACTAACC rev: GGCATTGATTGCATCTGGCTG |
Macrophage colony-stimulating factor (M-CSF) | for: TCCAGCCAAGATGTGGTGAC rev: AGTTCCCTCAGAGTCCTCCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Loeffler, H.; Jonitz-Heincke, A.; Peters, K.; Mueller-Hilke, B.; Fiedler, T.; Bader, R.; Klinder, A. Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions. Materials 2020, 13, 1150. https://doi.org/10.3390/ma13051150
Loeffler H, Jonitz-Heincke A, Peters K, Mueller-Hilke B, Fiedler T, Bader R, Klinder A. Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions. Materials. 2020; 13(5):1150. https://doi.org/10.3390/ma13051150
Chicago/Turabian StyleLoeffler, Henrike, Anika Jonitz-Heincke, Kirsten Peters, Brigitte Mueller-Hilke, Tomas Fiedler, Rainer Bader, and Annett Klinder. 2020. "Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions" Materials 13, no. 5: 1150. https://doi.org/10.3390/ma13051150
APA StyleLoeffler, H., Jonitz-Heincke, A., Peters, K., Mueller-Hilke, B., Fiedler, T., Bader, R., & Klinder, A. (2020). Comparison of Inflammatory Effects in THP-1 Monocytes and Macrophages after Exposure to Metal Ions. Materials, 13(5), 1150. https://doi.org/10.3390/ma13051150