Isolation and Fatty Acid Profile of Selected Microalgae Strains from the Red Sea for Biofuel Production
Abstract
:1. Introduction
2. Results and Discussion
2.1. Pre-enrichment of Cultures
2.2. Isolation of Strains by FACS

2.3. Identification of Strains by 18S rDNA Sequencing
| Strain | Phylum | rDNA Marker |
|---|---|---|
| Nannochloris sp. SBL1 | Chlorophyta | 18S (PS) |
| Picochlorum sp. SBL2 | Chlorophyta | 18S (PS), 5.8S (PS), ITS2, 28S (PS) |
| Desmochloris sp. SBL3 | Chlorophyta | 18S (PS), 5.8S (PS), ITS2, 28S (PS) |
| Nannochloris sp. SBL4 | Chlorophyta | 18S (PS) |
2.4. Fluorescence Microscopy of Cells Stained with BODIPY 505/515

2.5. Total Lipid Content and Fatty Acid Profile

| Fatty acid (%) | Nannochloris sp. SBL1 | Picochlorum sp. SBL2 | Desmochloris sp. SBL3 | Nannochloris sp. SBL4 |
|---|---|---|---|---|
| C15:0 | n.d. | n.d. | 4.19 ± 0.20 | n.d. |
| C16:0 | 32.48 ± 3.24 | 26.16 ± 2.03 | 33.63 ± 1.65 | 28.52 ± 1.18 |
| C18:0 | 2.28 ± 0.30 | 3.22 ± 0.60 | 1.94 ± 0.59 | n.d. |
| ∑ SFA | 34.77 ± 3.55 | 29.37 ± 2.62 | 39.76 ± 2.44 | 28.52 ± 1.18 |
| C16:1 | 12.19 ± 1.63 | 12.05 ± 1.26 | n.d. | 17.10 ± 1.15 |
| C18:1 | 33.82 ± 2.28 | 21.96 ± 1.39 | 28.17 ± 1.22 | 40.41 ± 4.02 |
| ∑ MUFA | 46.00 ± 3.91 | 34.01 ± 2.65 | 28.17 ± 1.22 | 57.51 ± 5.16 |
| C16:2 | n.d. | 7.18 ± 0.20 | n.d. | n.d. |
| C16:3 | 3.80 ± 0.48 | 5.68 ± 0.37 | 1.32 ± 0.07 | 4.46 ± 0.64 |
| C18:2 | 15.44 ± 2.12 | 23.76 ± 0.36 | 28.55 ± 2.23 | 9.50 ± 0.59 |
| C18:3 | n.d. | n.d. | 2.21 ± 0.08 | n.d. |
| ∑ PUFA | 19.23 ± 2.60 | 36.62 ± 0.93 | 32.07 ± 2.38 | 13.97 ± 1.23 |
| Iodine value | 86 | 99 | 84 | 88 |
3. Experimental Section
3.1. Sampling and Storage
3.2. Isolation of Microalgae Strains by Fluorescence Activated Cell Sorting
3.3. Identification of Strains by rDNA Sequencing
| Gene locus | Primer name | Sequence (5’ to 3’) |
|---|---|---|
| 18S | 18SUnivFor | ACCTGGTTGATCCTGCCAGT |
| 18S | 18SUnivRev | TCAGCCTTGCGACCATAC |
| 5.8S, ITS2, 28S | 5.8SFor | AAGAACGCAGCGAAATGC |
| 5.8S, ITS2, 28S | 28SRev | GACTCCTTGGTCCGTGTTTC |
3.4. Microscopy
3.5. Assessment of Total Lipid Content and Fatty Acid Profile by Gas Chromatography Coupled with Mass Spectrometry
4. Conclusions
Acknowledgments
Conflict of Interest
References
- Hannon, M.; Gimpel, J.; Tran, M.; Rasala, B.; Mayfield, S. Biofuels from algae: Challenges and potential. Biofuels 2010, 1, 763–784. [Google Scholar] [CrossRef] [PubMed]
- Rahman, S.M.; Khondaker, A.N. Mitigation measures to reduce greenhouse gas emissions and enhance carbon capture and storage in Saudi Arabia. Renew. Sust. Energ. Rev. 2012, 16, 2446–2460. [Google Scholar] [CrossRef]
- Chisti, Y. Biodiesel from microalgae. Biotechnol. Adv. 2007, 25, 294–306. [Google Scholar] [CrossRef] [PubMed]
- Schenk, P.M.; Thomas-Hall, S.R.; Stephens, E.; Marx, U.; Mussgnug, J.H.; Posten, C.; Kruse, O.; Hankamer, B. Second generation biofuels: High-efficiency microalgae for biodiesel production. BioEnergy Res. 2008, 1, 20–43. [Google Scholar] [CrossRef]
- Walker, T.L.; Purton, S.; Becker, D.K.; Collet, C. Microalgae as bioreactors. Plant Cell Rep. 2005, 24, 629–41. [Google Scholar] [CrossRef] [PubMed]
- Spolaore, P.; Joannis-Cassan, C.; Duran, E.; Isambert, A. Commercial applications of microalgae. J. Biosci. Bioeng. 2006, 101, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Mata, T.M.; Martins, A.A.; Caetano, N.S. Microalgae for biodiesel production and other applications: A review. Renew. Sust. Energ. Rev. 2010, 14, 217–232. [Google Scholar] [CrossRef]
- Hu, Q.; Sommerfeld, M.; Jarvis, E.; Ghirardi, M.; Posewitz, M.; Seibert, M.; Darzins, A. Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances. Plant J. 2008, 54, 621–639. [Google Scholar] [CrossRef] [PubMed]
- Rodolfi, L.; Zittelli, G.C.; Bassi, N.; Padovani, G.; Biondi, N.; Bonini, G.; Tredici, M.R. Microalgae for oil: Strain selection, induction of lipid synthesis and outdoor mass cultivation in a low-cost photobioreactor. Biotechnol. Bioeng. 2009, 102, 100–112. [Google Scholar] [CrossRef] [PubMed]
- Mutanda, T.; Ramesh, D.; Karthikeyan, S.; Kumari, S.; Anandraj, A.; Bux, F. Bioprospecting for hyper-lipid producing microalgal strains for sustainable biofuel production. Bioresour. Technol. 2011, 102, 57–70. [Google Scholar] [CrossRef] [PubMed]
- Reckermann, M. Flow sorting in aquatic ecology. Sci. Mar. 2000, 64, 235–246. [Google Scholar] [CrossRef]
- Doan, T.Y.; Sivaloganathan, B.; Obbard, J.P. Screening of marine microalgae for biodiesel feedstock. Biomass Bioenerg. 2011, 35, 2534–2544. [Google Scholar] [CrossRef]
- Pereira, H.; Barreira, L.; Mozes, A.; Florindo, C.; Polo, C.; Duarte, C.V.; Custódio, L.; Varela, J. Microplate-based high throughput screening procedure for the isolation of lipid-rich marine microalgae. Biotechnol. Biofuels 2011, 4. [Google Scholar] [CrossRef]
- Olsen, G.J.; Lane, D.J.; Giovannoni, S.J.; Pace, N.R. Microbial ecology and evolution: A ribosomal RNA approach. Annu. Rev. Microbiol. 1986, 40, 337–365. [Google Scholar] [CrossRef] [PubMed]
- Olmos, J.; Paniagua, J.; Contreras, R. Molecular identification of Dunaliella sp. utilizing the 18S rDNA gene. Lett. Appl. Microbiol. 2000, 30, 80–84. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, M.; Nishikawa, T.; Kajitani, H.; Kawano, S. Patterns of asexual reproduction in Nannochloris bacillaris and Marvania geminata (Chlorophyta, Trebouxiophyceae). Planta 2007, 226, 917–927. [Google Scholar] [CrossRef] [PubMed]
- Cooper, M.S.; Hardin, W.R.; Petersen, T.W.; Cattolico, R.A. Visualizing “green oil” in live algal cells. J. Biosci. Bioeng. 2010, 109, 198–201. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-J.; Choi, Y.E.; Kim, E.J.; Park, W.-K.; Kim, C.W.; Yang, J.-W. Serial optimization of biomass production using microalga Nannochloris oculata and corresponding lipid biosynthesis. Bioprocess Biosyst. Eng. 2012, 35, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Takagi, M.; Watanabe, K.; Yamaberi, K.; Yoshida, T. Limited feeding of potassium nitrate for intracellular lipid and triglyceride accumulation of Nannochloris sp. UTEX LB1999. Appl. Microbiol. Biotechnol. 2000, 54, 112–117. [Google Scholar] [CrossRef] [PubMed]
- De la Vega, M.; Díaz, E.; Vila, M.; León, R. Isolation of a new strain of Picochlorum sp. and characterization of its potential biotechnological applications. Biotechnol. Prog. 2011, 27, 1535–1543. [Google Scholar] [CrossRef] [PubMed]
- Demirbas, A. Production of biodiesel from algae oils. Energy Sources 2009, 31, 163–168. [Google Scholar] [CrossRef]
- European Standard EN 14214 Automotive Fuels-Fatty Acid Methyl Esters (FAME) for Diesel Engines—Requirements and Test Methods; European Committee for Standardization: Brussels, Belgium, 2004.
- Westfall, P.J.; Gardner, T.S. Industrial fermentation of renewable diesel fuels. Curr. Opin. Biotech. 2011, 22, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Fábregas, J.; Abalde, J.; Herrero, C.; Cabezas, B.V.; Veiga, M. Growth of the marine microalga Tetraselmis suecica in batch cultures with different salinities and nutrient concentrations. Aquaculture 1984, 42, 207–215. [Google Scholar] [CrossRef]
- Bligh, E.G.; Dyer, W.J. A rapid method for the total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Lepage, G.; Roy, C.C. Improved recovery of fatty acid through direct transesterification without prior extraction or purification. J. Lipid Res. 1984, 25, 1391–1396. [Google Scholar] [PubMed]
- Pereira, H.; Barreira, L.; Figueiredo, F.; Custódio, L.; Vizetto-Duarte, C.; Polo, C.; Rešek, E.; Engelen, A.; Varela, J. Polyunsaturated fatty acids of marine macroalgae: potential for nutritional and pharmaceutical applications. Mar. Drugs 2012, 10, 1920–1935. [Google Scholar] [CrossRef] [PubMed]
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Pereira, H.; Barreira, L.; Custódio, L.; Alrokayan, S.; Mouffouk, F.; Varela, J.; Abu-Salah, K.M.; Ben-Hamadou, R. Isolation and Fatty Acid Profile of Selected Microalgae Strains from the Red Sea for Biofuel Production. Energies 2013, 6, 2773-2783. https://doi.org/10.3390/en6062773
Pereira H, Barreira L, Custódio L, Alrokayan S, Mouffouk F, Varela J, Abu-Salah KM, Ben-Hamadou R. Isolation and Fatty Acid Profile of Selected Microalgae Strains from the Red Sea for Biofuel Production. Energies. 2013; 6(6):2773-2783. https://doi.org/10.3390/en6062773
Chicago/Turabian StylePereira, Hugo, Luísa Barreira, Luísa Custódio, Salman Alrokayan, Fouzi Mouffouk, João Varela, Khalid M. Abu-Salah, and Radhouan Ben-Hamadou. 2013. "Isolation and Fatty Acid Profile of Selected Microalgae Strains from the Red Sea for Biofuel Production" Energies 6, no. 6: 2773-2783. https://doi.org/10.3390/en6062773
APA StylePereira, H., Barreira, L., Custódio, L., Alrokayan, S., Mouffouk, F., Varela, J., Abu-Salah, K. M., & Ben-Hamadou, R. (2013). Isolation and Fatty Acid Profile of Selected Microalgae Strains from the Red Sea for Biofuel Production. Energies, 6(6), 2773-2783. https://doi.org/10.3390/en6062773

