Next Article in Journal
Climate Change Is Driving Shifts in Dragonfly Species Richness across Europe via Differential Dynamics of Taxonomic and Biogeographic Groups
Next Article in Special Issue
Forest Matters Most for Hirsutiella zachvatkini (Schluger, 1948): A Survey of Rodent Infestation in Four Localities within the Mazury Lake District, NE Poland
Previous Article in Journal
Traditional Knowledge of Textile Dyeing Plants: A Case Study in the Chin Ethnic Group of Western Myanmar
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

New Morphological and Molecular Data Reveal an Underestimation of Species Diversity of Mites of the Genus Geckobia (Acariformes: Pterygosomatidae) in India

1
Department of Molecular Biology and Genetics, Institute of Biological Sciences, Cardinal Stefan Wyszynski University, Wóycickiego 1/3, 01-938 Warsaw, Poland
2
Centre for Ecological Sciences, Indian Institute of Science, Bangalore 560012, India
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(12), 1064; https://doi.org/10.3390/d14121064
Submission received: 20 September 2022 / Revised: 28 November 2022 / Accepted: 29 November 2022 / Published: 2 December 2022
(This article belongs to the Special Issue Host-Parasitic Mite Interactions and Co-evolution)

Abstract

Mites of the genus Geckobia (Acariformes: Pterygosomatidae) are permanent and highly specialised ectoparasites of geckos (Gekkota). We conducted a local study on Geckobia mites associated with the geckos of the family Gekkonidae found mainly in the territory of the Indian Institute of Science’s campus (Bangalore, India). In total, we examined 208 lizards belonging to two genera: Hemidactylus and Cnemaspis. We assessed the prevalence of the mites and identified the preferred site for their infestation. We extended the standard morphological identification of the mite species by using DNA barcode markers, partial sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene and nuclear ribosomal gene sequences: 18S rRNA and hypervariable region D2 of nuclear 28S rRNA. We checked the suitability of COI and nuclear (D2 of 28S rRNA) markers for species delimitations and identification purposes of the genus. The distance- and phylogeny-based approaches were applied: (i) to test the presence of a barcoding gap, we used the automated barcoding gap discovery tool (ABGD) and investigated intra- and interspecific genetic distances, and (ii) to reconstruct evolutionary relationships within the species, we performed maximum likelihood (ML) and Bayesian inference with Markov-Chain Monte Carlo (BI) analyses. As a result, we described five new species—Geckobia gigantea sp. n., G. treutleri sp. n., G. unica sp. n. and G. brevicephala sp. n.—from four Hemidactylus species: H. giganteus, H. treutleri, H. parvimaculatus and H. frenatus, respectively, and G. mysoriensis sp. n. from Cnemaspis mysoriensis. Additionally, we found three already described species: Geckobia indica Hirst, 1917 on H. treutleri (new host), Geckobia bataviensis Vitzhum, 1926 on H. parvimaculatus (new host) and H. frenatus (new locality) and Geckobia phillipinensis Lawrence, 1953 on H. frenatus (new locality). The diagnoses of G. indica and G. phillipinensis were improved and supplemented by descriptions of the males and juveniles. Both topologies of the BI and ML phylogenetic trees, as well as genetic distances, supported the species boundaries in the mite population shown by the morphological data. Hemidactylus frenatus was the most infected gecko species (61% prevalence), with the highest number of mite species (three spp.). The scale-mite richness was higher than expected; therefore, further research is required to evaluate the true diversity of Geckobia mites.

1. Introduction

Geckobia Mégnin, 1878 is the most species-rich genus belonging to the family Pterygosomatidae (Acariformes: Prostigmata). To date, there are over 80 valid species and subspecies associated with reptiles from all zoogeographical regions, except for Antarctica [1,2,3,4]. The range of their hosts comprises six lizard families (Gekkonidae, Phyllodactylidae, Diplodactylidae, Carphodactylidae, Eublepharidae and Liolamidae) and with one species, Geckobia enigmatica Bertrand and Pedrono, 1999, found on the Astrochelys yuniphora (Vaillant) (Testudinidae) [5].
All species of this genus are permanent and obligatory ectoparasites of reptiles and cannot survive in the off-host environment; therefore, they have evolved over diverse morphological specialisations that allow them to spend their entire life on the host’s body (e.g., idiosoma, which is wider than it is longer and allows hiding beneath the scales; unequal legs directed forward and numerous idosomal setae, which play a role in fixing to the host’s body). This strong dependency has led to the paradigm that scale mites are highly host-specific, being mono- or oligoxenous parasites, and co-evolved with their reptilian hosts [1]. However, this literature review [1] reveals the fragmentary examination of numerous host species (testing for mites in phylogenetically distant gecko species taken frequently from distant localities). Therefore, the meticulous checking for mites from closely related hosts may reveal that mites considered as oligoxenous, infesting different host species from distant localities, might be monoxenous (i.e., cryptic taxa) or stenoxenous species that infest closely related hosts.
Previous records of Geckobia mites include 23 species described from 13 species of Asian geckos, of which six species have been reported on three host species in India [1,6,7]. Recently, several new species of Hemidactylus (which are common hosts of Geckobia mites) have been described in India, and numerous species complexes have been identified, e.g., [8,9]. Because the distribution of Geckobia species on their hosts is highly host-specific, we suspect that the actual number of Geckobia species is much larger.
Despite their diversity and species richness, mites of the genus Geckobia are rarely targeted for biodiversity assessments because of serious taxonomic issues that have also been observed in other groups of mites [10]. The status of many species is uncertain due to synonymies [11,12,13], obscure morphological differences or vague species description, e.g., [14,15]. Moreover, immature life stages are excluded from many surveys as they are rarely collected or lack diagnostic morphological characteristics. The morphological identification of immature stages and males of closely related scale mites is a laborious task even for experienced taxonomists. In addition to all these challenges, there is a scarcity of taxonomic experts specialised in the morphological identification of pterygosomatid mites. Consequently, surveys have often been limited to new species’ descriptions based on records from a single locality or host specimen, which prevents detailed assessments of the mite fauna, such as the examination of species turnover on the hosts in space or time.
Currently, Geckobia mites are arranged into five species groups based on the trochanter-tibia chaetotaxy of legs I–IV (i.e., latasti, haplodactyli, ovambica, indica and simplex) and into groups A and B based on differences in the tarsal chaetotaxy of leg I (see [3,6,16]). Nonetheless, approximately one-third of the species in this genus has not been assigned to any group because of their vague descriptions or unique morphological characteristics. So far, all species descriptions of Geckobia mites have been made solely based on external morphology. This was mostly dictated by the fact that the morphology-based investigations were carried out on pterygosomatids collected from museum host specimens caught at the turn of the 20th century and initially conserved in the industrial methylated spirit. In such materials, the DNA is often too highly degraded to undertake molecular-based investigation of the mites. Moreover, for most species, the gene sequence template for designing primers is not available; thus, they cannot be identified by molecular techniques. So far, more than 180 species of the family Pterygosomatidae have been identified in nature [1,17], whereas less than 10 species have molecular data available in GenBank.
Recently, the systematics of acariform mites have largely benefited from the ongoing development of molecular techniques. An integrative approach combining morphology and mitochondrial and nuclear sequences has been successfully used in delimiting species boundaries, e.g., [18], and discovering cryptic taxa, e.g., [19,20,21], but previous research has focused on phylogenetic studies of a few species or genera, e.g., [19,22]. Hence, the molecular data of Geckobia mites, which have not been included in any investigations of the mites before, hold much promise for documenting and understanding both the extent and patterns of species diversity by providing a transparent, consistent method for delineating species, which also allows the inclusion of all life stages and both sexes.
Therefore, this paper aims to (i) describe new species and conduct the first comprehensive assessment of diversity within the analysed population of Geckobia spp., using both morphological and molecular data; (ii) check the suitability of cytochrome c oxidase subunit I and nuclear markers for species delimitation and identification; (iii) assess the levels of genetic variability in the analysed population of Geckobia spp.; (iv) conduct preliminary analysis of the phylogenetic relationship of the analysed species; (v) assess the prevalence of mites and confirm or exclude the possibility of host switches between hosts living sympatrically in the Indian Institute of Science campus (IISc); and (vi) identify the preferred site of mite infestation.

2. Materials and Methods

Mite sampling. The mite material used in this study was obtained from the geckos collected from 13 September 2019 to 13 November 2019 in IISc from approximately 6.30 pm. to 11.30 p.m. The lizards (179 geckos) were kept in separate containers, and each specimen was identified to species following the key in [23] and the description presented by [24]. Additional lizards were checked for mites in the National Centre for Biological Sciences (NCBS) campus in Bangalore (Karnataka, India) on 29 November 2019 (20 geckos) and in Yerramaranahalli (Karnataka, India) on 12 November 2019 (9 geckos). All collected lizards were examined for mites, which were removed from the lizards under the stereo microscope LEICA M205 C. Mites infesting different regions of the host’s body were counted to identify the preferred sites of their infestation and placed in small vials (2 mL) containing 96% ethyl alcohol. Then, the lizards were released in the place of their collection.
Morphological analysis. Some mite specimens were used a day after collection for DNA extraction, where the remaining specimens, before mounting in Hoyer’s medium, were cleared and softened in Nesbitt’s solution at +45 °C for 1–5 h. Then, all specimens (including exoskeletons left after DNA extraction) were mounted as vouchers, using Hoyer’s medium on a glass slide using the standard method [25]. Fragments of the mites crushed during the extraction were also mounted for species identification. The mites were studied using a Leica DMD108 microscope. In the species descriptions, names of the leg and idiosomal setae followed [26,27] as described by [28], whereas those of the palpal setae followed [29]. Grandjean’s nomenclatures [26,27,29] were applied to the family Pterygosomatidae by [30]. All measurements in the descriptions and values for scale bars in figures are presented in micrometres (μm), and data for the holotype are followed in brackets by the ranges for corresponding paratypes. The scientific names of lizards followed [24].
All specimens and vouchers were deposited in the mite collection of the Centre of Ecological Sciences (CES) in IISc, Bangalore, India.
DNA extraction and PCR amplification. Several mite specimens kept in 96% ethanol, before mounting on microscope slides, were subjected to DNA extraction using a DNeasy Blood and Tissue Kit (Qiagen), following a previously reported modified protocol described by [19].
The complete 18S rRNA (about 1.8 kb) was PCR-amplified in two overlapping fragments of approximately 950 and 1500 bp, each using primer pairs 18SF/rev960 and fw770/rev18d, respectively. The COI gene fragment (covering about 650 bp of the 5’-terminus of the COI gene) was amplified by PCR using the primers bcdF04 and bcdR04. The D2 region of the 28S rRNA gene (c. 900 bp) was amplified using the 28F0001 and 28R0990 primers (all primers are listed in Table 1).
PCR amplifications were conducted in 25 µL reaction volumes containing Taq reaction buffer B, 2.5 mM MgCl2, 0.25 mM dNTPs, 0.25 µL of each primer, 1 U Taq polymerase (GeNeiTM, Bangalore, India) and 3 µL of DNA template using a thermocycling profile of 12 min at 95 °C followed by 35 cycles consisting of 95 °C for 15 s, 50 °C for 1 min and 72 °C for 1 min, with a final step of 7 min at 72 °C. After amplification, 2 µL of each PCR product was analysed by electrophoresis on a 1% agarose gel. Samples containing visible bands were purified with the QIAquick PCR & Gel Cleanup Kit (Qiagen). Purified PCR products were sent for sequencing to Barcode Biosciences, Bangalore.
DNA matrices and sequence alignments. Sequences of three gene (COI, 18S and 28S) fragments of Geckobia spp. representing eight morphospecies were blasted in GenBank and checked for possible contaminants. The sequence chromatograms were also checked for accuracy and edited using Chromas Lite 2.1.1 (Technelysium Pvt. Ltd., South Brisbane, QLD, Australia).
Alignments of the sequence data were prepared by the ClustalW algorithm in MEGA ver. 11.0.8 software with the default parameters [31]. The nucleotide sequences of COI were converted into amino acid sequences to check for sequencing errors and pseudogenes.
All sequences were deposited in GenBank under the accession number presented in Table 2.
Genetic distance, barcode gap discovery and species delimitation. Genetic distances were calculated for COI, 18S and 28S fragments using MEGA ver. 11.0.8 [31] under the Kimura two-parameter (K2P) model [32] for all codon positions. To calculate the genetic distances between populations of different genera, we used sequences of Pterygosomatidae previously deposited in GenBank (Table 2).
Additionally, the sequence data were analysed using Automatic Barcode Gap Discovery (ABGD) method to delimit the genetic clusters by detecting a significant gap in pairwise distance distribution [33]. We used the ABGB web server for performing the analysis (https://bioinfo.mnhn.fr/abi/public/abgd/, accessed on 30 January 2021), with the default settings and K2P distance model.
Phylogenetic analysis. Phylogenetic relationships among the studied taxa were estimated with two methods: maximum likelihood (ML) and Bayesian inference (BI). For the two likelihood-based methods, an appropriate model of DNA sequence evolution was determined using PartitionFinder v.1.1.1 [34]. As a result, for each codon position of COI, subsequent models were used: TrN + I, F81 + G and HKY. For nuclear data, K81uf + G was used as a sequence evolution model.
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerSequenceProductSource
bcdF04TTTTCTACHAAYCAYAAAGATATCOI[19]
bcdR04TATAAACYTCDGGATGNCCAAAAAACOI[35]
18SfwCTTGTCTCAAAGATTAAGCCATGCA18S rDNA[35]
rev960GACGGTCCAAGAATTTCAC18S rDNA[35]
fw770ACTTTGAAAAAATTAGAGTGC18S rDNA[35]
rev18STGATCCTTCCGCAGGTTCACCT18S rDNA[35]
28SF0001ACCCVCYNAATTTAAGCATAT28S rDNA[21]
28SR0990CCTTGGTCCGTGTTTCAAGAC28S rDNA[21]
Similar settings were used when analysing nuclear and mitochondrial data. ML was performed in raxmlGUI v.1.5 using the GRTGAMMA model, and a thorough bootstrap was carried out for 1000 reps with 10 ML searches [36]. The nodes supported by bootstrap values (BSP) ≥ 70% were considered strongly supported [37]. Bayesian analysis was performed in MrBayes v. 3.2.6. Each run of 5 million generations was sampled every 500 [38]. The value of the estimated sample sizes was checked in Tracer v. 1.6 to ensure appropriate chain length and to check for stationarity. The first 25% of the tress was discarded as “burn-in”. Nodes supported by posterior probabilities (BPP) ≥ 95% were considered strongly supported [39]. Tree visualisations were prepared using FigTree ver. 1.4.3 [40].
Table 2. Mites and sequences used in this study.
Table 2. Mites and sequences used in this study.
Mite SpeciesHost SpeciesSample IDAccession No.Reference
COID218SCOID218S
Geckobia gigantea sp.n.Hemidactylus giganteus


88_28SF01
86_28SF01
87_28SF01
84_28SF01
88_18SF
86_18SF
87_18SF
84_18SF



MZ824666
MZ824665
MZ824667
MZ824668
MZ666419
MZ666420
MZ666421
MZ666422
This study
Geckobia mysoriensis sp.n.Cnemaspis mysoriensis



15_bcdF04
16_bcdF04


1_28SF001
2_28SF001
13_28SR0990
14_28SF001
15_28SF001
16_28SF001
24_28SF001
47_28SF001
13_18SGF
27_18SF
1_18SF
2_18SF
16_18SF
14_18SF
24_18SF
15_18SF
47_18SF




MZ682028
AF142139


MZ683418
MZ683419
MZ683420
MZ683421
MZ683422
MZ683423
MZ683424
MZ683425
MZ683429
MZ683430
MZ683431
MZ683432
MZ683433
MZ683434
MZ683435
MZ683437
MZ683436
This study
Geckobia bataviensis Vitzhum, 1926Hemidactylus frenatus
Hemidactylus parvimaculatus




28_bcdF04



58_bcdF04
59_bcdF04

3_28SF001
9_28SF001
21_28SF001
23_28SF001
28_28SF0001
40_28SF0001
42_28SF0001
57_28SF0001
58_28SF0001
59_28SF0001
78_28SF0001
3_18SF
9_18SF
21_18SF
23_18SF
28_18SF
40_18SF
42_18SF
57_18SF
59_18SF
58_18SF
78_18SREV
92_18SF




OK668315



OK647841
OK647840

MZ750859
MZ750860
MZ750861
MZ750862
MZ750863
MZ750864
MZ750865
MZ750866
MZ750867
MZ750868
MZ750869
MZ750870
MZ750871
MZ750872
MZ750873
MZ750874
MZ750875
MZ750876
MZ750877
MZ750878
MZ750879
MZ750880
MZ750881
This study
Geckobia treutleri sp. n.Hemidactylus treutleri
70_28SF001
73_28SF001
70_18SF
72_18SF

OK256888
OK256887
OK256880
OK256881
This study
Geckobia indica Hirst, 1917Hemidactylus treutleri71_bcdF04
79_bcdF04
71_28SF001
79_28SF001
71_18SF
79_18SF
OK668260
OK668316
OK256886
OK256885
OK256878
OK256879
This study
Geckobia phillipinensis Lawrence, 1953Hemidactylus frenatus


60_28SR0990
100_28SF0001

51_18SF
60_18SF
99_18SF
100_18SF



OK360925
OK360924

OK360926
OK360928
OK360929
OK360927
This study
Geckobia unica sp. n.Hemidactylus parvimaculatus49_bcdF0449_28S000149_18SFOK626786OK642373OK642374This study
Geckobia brevicephala sp. n.Hemidactylus frenatus
4_28SF001
7_28SF001
4_18SF
7_18SF

OL334759
OL334760
OL334757
OL334758
This study
Pimeliaphilus hemidactyli Fajfer and Karanth, 2021











MT668542
MT668543
MT668545
MT668541
MT668544
MT669008
MT669007
MT669009
MT669006
MT669005
MT669010[41]
Pterygosoma theobaldi Fajfer Melnikov and Dabert, 2016Phrynocephalus theobaldiKT962103 KT962106[42]
Pterygosoma pallidum Fajfer Melnikov and Dabert, 2016Trapelus pallidusKT962104KT962105[42]
Pterygosoma parasiniatum Fajfer, Melnikov and Dabert, 2016Pseudotrapelus cf. sinaitusKT962107[42]

3. Results

3.1. Species Composition

Eight species of the genus Geckobia were found on six gecko species based on morphological criteria. Five of the recorded mite species corresponded to new undescribed species: Geckobia gigantea sp. n., Geckobia mysoriensis sp. n., Geckobia treutleri sp. n., Geckobia unica sp. n. and Geckobia brevicephala sp. n. In addition, three already described species have been found: Geckobia indica Hirst, 1917, Geckobia bataviensis Vitzhum, 1926 and Geckobia phillipinensis Lawrence, 1953. The largest number of scale-mite species was hosted by Hemidactylus frenatus (three spp.), whereas the remaining host species harboured their own scale-mite species (Table 3).

3.2. Systematics

Family Pterygosomatidae Oudemans, 1910.
Genus Geckobia Mégnin, 1878.

3.2.1. Description

Geckobia gigantea sp. n. (Figure 1, Figure 2, Figure 3, Figure 4 and Figure 5).
Female (holotype, range for nine paratypes). Gnathosoma. Chelicerae 85 (80–95) long. Swollen, proximal part of cheliceral base 45 (30–40) long and slender distal part 45 (45–55) long. Movable cheliceral digit three-pronged while fixed cheliceral digit spinous and approximately 5 (5–10) long. Palpal femur with thick plumose seta dF 15 (15–20) long; palpal genu with filiform smooth seta dG, 65 (50–60) long. Palpal tibia with three smooth setae (dTi, l′Ti and l″Ti) and slender curved claw. Palpal tarsi with four smooth setae. Subcapitular seta n filiform and smooth, about 45 (40–50) long. Each branch of peritremes with barely visible chambers 75 (70–85) long. Hypostome with ornamented apex (Figure 2b). Idiosoma 210 (155–260) long and 305 (295–385) wide. Dorsum (Figure 1). Propodonotal shield well outlined, 110 (85–115) long and 230 (220–270) wide, covered by minute punctations (Figure 2a). On propodonotal shield, small eyes situated on lateral margins present and 73 (73–81) stout and plumose setae, 10–20 long. These setae decrease in length from anterior to posterior part of propodonotal shield. Posterior to propodonotal shield, four rows of numerous stout and plumose setae (about 15) long present. These setae increase in length from anterior to posterior part of idiosoma (10–15 long) and resemble setae situated posteriorly on propodonotal shield. Postero-lateral and most posterior part of idiosoma with numerous flattened longer setae (20–50 long) that increase in length from anterior to posterior part of idiosoma; these setae are slightly serrate only at tip (as in Figure 2c). Venter (Figure 1b). Anterior part with numerous thick and plumose setae (10–15 long) and posterior part with about 60 pairs of thick and flattened setae (40–50 long). Genital region (Figure 1c). Genital setae represented by four pairs of slender blunt pointed setae g1g4. Setae g1 and g2 about 20 long, g3 about 10 long and g4 about 30 long. Setae g1g3 situated medially on genital valves and setae g4 situated laterally. Pseudanal series represented by 11 pairs of blunt-pointed smooth and flattened setae ps1ps11, about 50 (40–55) long. Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b, 4a, 4b and 4c arranged in formula: 2–2–2–3. All coxal setae thick and plumose, except for filiform and smooth setae 1a and 1b. Two plumose setae present between coxal plates I and II. Leg chaetotaxy as follows: tibiae I–IV (5–5[4]–4–5), genua I–IV (1–0–0–1), femora I–IV (3–2–1–2) and trochanters I–IV (1–1–1–2). Setae d′TiIIV, d″TiI, d′TiIV, v′TiIIV, v″TiIIV, l′TiIIV, lGI, lGIV, dlFIIV and dFIV filiform and smooth; setae d″FI, vFIII, vTrI–IV and v″TrIV filiform and serrate. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Solenidion ω1 (about 25 long) longer than seta ft (about 5 long). Setae tc′, tc″, it′ and it″ of leg I represented by euphatidia; tc′ and tc″ of legs II–IV, u′, u″, vs′, vs″, a′, a″ and pl′ of legs I–IV filiform.
MALE (range for two paratypes). Gnathosoma as in female. Chelicerae 80 long; swollen proximal part and slender distal part subequal in length, about 40 long. Fixed cheliceral digit about 5 long. Setae dF and dG 15 and 45 long, respectively. Subcapitular setae n 35 long. Each branch of peritremes 50 long. Idiosoma 150–155 long and 145–180 wide. Dorsum (Figure 3a). Propodonotal shield reniform, 45–55 long and 70 wide, with small eyes present on lateral margins and six plumose and thick setae: two pairs (15 long) present antero-laterally and four pairs (10–20 long) present postero-laterally. Posterior to propodonotal shield, 21–23 pairs of slightly plumose setae (10–40 long) present. These setae increase in length from anterior to posterior part of idiosoma. Venter (Figure 3b) with 18 short and plumose setae in antero-medial part, 5–10 long, and 29 thick and smooth setae in postero-lateral part, 20–40 long. Aedeagus 90 long, ended with spine-like structure. Most posteriorly situated one pair of spine-like setae about 10 long. Ano-genital opening covered with two curved spines, about 5 long. Laterally to aedeagus one pair of slightly serrate setae, 20 long, present. Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b and 4a arranged in formula: 2–2–2–1. All coxal setae thick and plumose, except for filiform and smooth setae 1a and 1b. Leg chaetotaxy: tibiae I–IV (5–5–5[4]–5), genua I–IV (1–0–1–1), femora I–IV (3–1–1–2) and trochanters I–IV (1–1–1–1). Setae d’TiIIV, d”TiI–IV, lTiI–IV, v’TiIIV, v”TiI–IV, l’GI, lGIII–IV, vFI, l’FI and vFIV filiform and smooth; setae l”FI with barely discernible serration; setae l”FII–FIV slightly serrate and setae lTrI–IV filiform and smooth. Setation of tarsi I–IV as in female.
Deutonymph (one paratype). Gnathosoma as in female. Chelicerae about 45 long. Swollen proximal part of chelicerae 20 long, slender distal part 25 long. Fixed cheliceral digit spinous, 5 long. Palpal tibia and tarsi with smooth setae. Each branch of peritremes 50 long. Idiosoma 150 long and 200 wide. Dorsum. Propodonotal shield 150 wide and 40 long, punctuate, with 16 plumose setae, 15–20 long. Dorsum covered by setae resembling that of propodonotal shield, about 15 long. Posterior and posteo-lateral setae serrate and 35–40 long. Venter with 20 pairs of short (about 15 long) plumose setae situated in anterior half of idiosoma and 13 pairs of longer (about 40 long) slightly serrate setae situated in posterior half of idiosoma as in Figure 4. Genital region (Figure 5a). Genital setae slightly serrate, setae g1 20 long, g2 and g3 about 10 long each. Pseudanal setae ps1–ps3 slightly serrate 30, 35 and 20 long, respectively. Additional unpaired seta ps4 on one side of idiosoma present. Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b and 4a arranged in formula: 2–2–2–1. Coxal seta 1a and 1b filiform, 2a, 2b, 3a, 3b and 4a spur-like and serrate. All coxae punctate. Chaetotaxy of trochanters-tibiae I–IV as in female, except for lack of setae v”TrIV. All setae of tibiae-trochanters I–IV filiform and smooth. Setation of tarsi I–IV as in female.
Larva (range for two paratypes). Gnathosoma as in female. Chelicerae 35 long. Swollen proximal part of chelicerae 15 long and slender distal part 20 long. Fixed cheliceral digit about 5 long. Setae dF slightly serrate, and 20 long and setae dG filiform and smooth, 25 long. Each branch of peritremes 30 long. Hypostome 30 long. Idiosoma 195–210 wide and 155–185 long. Dorsum with barely discernible punctate propodonotal shield 45 long and 70 wide and with 11 serrate setae (10–30 long) situated as in Figure 5b. Eyes present laterally to propodonotal shield. Venter devoid of any setation (Figure 5c). Genital region. Genital setal series represented by three pairs of filiform setae g1g3 5–10 long; pseudanal setal series represented by two pairs of filiform pseudanal setae ps1 and ps2 with barely discernible serration. Setae ps1 10–15 long and setae ps2 about 20 long. Legs. Coxal setation arranged in formulae: 2–0–1. Coxal setae 1a filiform and smooth; 1b filiform and slightly serrate; setae 3a thick and serrate. Chaetotaxy of legs I–III as follows: tibiae I–III (5–4–4), genua I–III (1–0–0), femora I–III (3–2–1) and trochanters I–III (0–0–0). Setation of tarsi I–III as in female, except for lack of setae p” on tarsi I.
Type material.
Female holotype and paratypes: nine females, two males, one deutonymph and two larvae (CES19109) from Hemidactylus giganteus Stoliczka (Squamata: Gekkonidae) (no. CES19101), India, Karnataka, Yerramaranahalli, 13°32′55.4″ N, 77°39′18.5″ E, 12.11.2019, coll. P. Karanth.
Molecular data.
The D2 region of 28S rRNA of G. gigantea is 898 bp long and comprises four sequences represented by two haplotypes differing in terms of five nucleotide positions (0.04%, SD = 0.002, K2P). The 18S region of the rRNA is 1708 bp (two sequences) and 844 bp long (two sequences) and comprises four sequences represented by two haplotypes differing by two nucleotide positions (0.20%, SD = 0.001, K2P).
Etymology.
The species name is derived from the species name of the host.
Differential diagnosis.
This species is most similar to Geckobia indica Hirst, 1917 from Hemidactylus gleadowi Murray, India (“Upper Sind” according to original description of Hirst [43]) [10,40]. In both species, the propodonotal shield and eyes are present, the shape and arrangement of the dorsal and ventral setae are the same, palpal setae dF are thick and serrate and the setation of tarsi I–IV is the same. In Geckobia gigantea sp. n., the propodonotal shield has a rounded posterior part and 73–81 setae on the shield, which decrease in length from the anterior to posterior part; leg seta dFIII is absent, and setae lGIV and v”TrIV are present. In G. indica, the propodonotal shield is concave in its posterior part and possesses 34–46 setae, which increase in length from the anterior to posterior part of the shield; leg setae dFIII are present, and setae lGIV and v”TrIV are absent.
Geckobia mysoriensis sp. n. (Figure 6, Figure 7, Figure 8, Figure 9, Figure 10 and Figure 11).
Female (holotype, range for eight paratypes). Gnathosoma (Figure 8a). Chelicerae 110 (105–110) long. Swollen proximal cheliceral part 40 (40–45) long and slender distal part 70 (70) long. Movable cheliceral digit three-pronged. Fixed cheliceral digit spinous, about 5 long. Palpal femur with serrate seta dF, 20 (20–25) long; palpal genu with smooth setae dG, 50 (50–55) long. Palpal tibia with three smooth setae: l′Ti, l″Ti and vTi. Palp tarsi with four filiform smooth setae. Supcapitular setae n serrate and 50 (50) long. Each peritremal branch about 80 long. Idiosoma 480 (395–490) long and 515 (445–520) wide. Dorsum covered by numerous serrate setae, 20–35 long, arranged as in Figure 6. These setae slightly increase from anterior to posterior part of idiosomal dorsum. Small eyes present. Venter (Figure 7) with numerous setae that cover all idiosoma except for most posterior part. These setae are less serrate than those on dorsum and 30–45 long. Genital series with one pair of filiform slightly serrate genital setae g1, about 20 long and 10–11 pairs of serrate pseudanal setae ps (in holotype, 10 setae ps present on left side and 11 pairs on right side of idiosoma), 35–55 long. Legs. Coxal setae as follows: 2–2–2–3. Setae 1a and 1b filiform and smooth 2a, 2b, 3a, 3b, 4a, 4b and 4c thick and serrate apically. Setae of tibiae I–IV (5–5–5–5), genua I–IV (1–0–0–1), femora I–IV (3–2–2–2) and trochanters I–IV (1–1–1–1). Setae vTrI–IV thick and serrate, vFI–IV short and serrate, dFI and lFI–IV filiform and slightly serrate, lGI and lGIV with barely discernible serration. Setae v′TiI–IV, v″TiI–IV, d′TiI–IVd″TiI–IV and l′TiI–IV smooth. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Setae it′, it″, tc′ and tc″ of legs I in form of euphatidia. Setae pl′ smooth, setae a′, a″, u′, u″, vs′ and vs″ serrate. Setae ft smooth, about 5 long.
Deutonymph (one paratype). Gnathosoma as in female. Chelicerae 70 long. Swollen cheliceral part 20 long and slender cheliceral part 50 long. Setae dF thick and serrate, 25–30 long; setae dG filiform with barely discernible serration, about 30 long. Each peritremal branch about 45 long. Subcapitular setae n 20 long. Idiosoma 310–335 wide and 300–315 long. Dorsum with about 30 pairs of dorsal serrate setae (30–40 long) arranged as in Figure 9a. Venter with five–six short setae, 10–20 long, situated anteriorly and longer setae, about 35 long, situated on remaining part of idiosomal venter, except for most posterior part. Genital region (Figure 9b) with three genital setae g1–g3 10–15 long and three pseudanal setae ps1ps3. Setae ps1 35 long, ps2 30 long and ps3 20 long. Legs. Coxal setae as follows: 2–2–2–2. Coxal setae 1a and 1b filiform with barely visible serration, 2a, 2b, 3a, 3b, 4a and 4b thick and serrate. Setae of tibiae-trochanters I–IV as in female except for lack of setae lGI and lFIII.
Protonymph (one paratype). Gnathosoma as in female. Chelicerae 70 long. Swollen proximal part of chelicerae 30 long and slender distal part about 40 long. Setae dF and dG filiform and serrate, about 35 long. Subcapitular setae n slightly serrate, about 45 long. Peritremes about 55 long. Idiosoma 165–195 wide and 185–190 long. Dorsum with numerous serrate setae 25–30 long situated as in Figure 10a. Venter (Figure 10b) with four short serrate setae situated anteriorly (10–15 long) and numerous longer setae situated in posterior half of idosomal venter, 25–30 long. Genital region with three setae g1g3, about 15 long, and three pseudanal setae ps1ps3. Setae ps1 15–20 long, ps2 and ps3 20–35 long. Legs. Coxal setae as follows: 2–2–2–2. Setae 1a and 1b filiform and slightly serrate, setae 2a, 2b, 3a, 3b, 4a and 4b plumose, thick and spur-like. Setae of tibiae-trochanters I–IV as in female except for lack of setae lGI, lGIV and lFII–III.
Larva (range for five paratypes). Gnathosoma as in female. Chelicerae about 55 long. Slender proximal part about 30 long and swollen distal part 25–30 long. Fixed cheliceral digit 5 long. Setae dF slightly serrate,15 long, setae dG filiform and smooth 20 long. Each branch of peritremes 65–70 long. Idiosoma 145 long and 190 wide. Dorsum with barely discernible propodonotal shield 50 long and 70 wide. On propodonotal shield, four pairs of setae present; setae situated most laterally 20 long, setae situated medially 15 long. Additional six serrate setae, 20–35 long on the remaining part of idiosoma present. Eyes present laterally to propodonotal shield. Genital area with two pairs of genital setae g1 and g2 and three pairs of pseudanal setae ps1ps3. Setae g1 and g2 5–10 long, ps1ps3 15–20 long. Legs. Coxae in formula: 2–1–1. Coxae 1a, 1b and 2b filiform and smooth, setae 3a spur-like and serrate. Setae of tibiae-femora I–III as in female, except for lack of setae v’TrI–III.
Type material examined.
Female holotype and paratypes: two females, one deutonymph, one protonymph and five larvae (CES19110) from Cnemaspis mysoriensis (Jerdon) (Squamata: Gekkonidae), India, Karnataka state, Bangalore, IISc, 19.09.2019, coll. Achyuthan Srikanthan; six female paratypes from same host species and locality, 17.10.2019, coll. Achyuthan Srikanthan, two females from the same host, India, Karnataka state, Bangalore, IISc, 09.10.2019, coll. Caleb Daniel.
Molecular data.
The COI sequence data of 646 bp were generated from two females. Both specimens shared the same COI haplotype. The alignment of the hypervariable D2 region of the nuclear 28S rRNA of G. mysoriensis is 909 bp long and comprises eight sequences represented by one haplotype. The 18S region od rRNA is 1681 bp long and comprises nine sequences represented by one haplotype.
Etymology.
The species name is derived from the species name of the host.
Differential diagnosis.
This species is most similar to Geckobia uenoi from Eublepharis splendens Nakamura and Ueno, 1959 (Squamata: Eublepharidae) from the Tokunoshima Island [14,44]. In both species, the body is almost circular, and the dorsal setae slightly increase in length from the anterior to posterior part of the idiosoma. The arrangement of the idiosomal setae and setation of tibia–coxae I–IV are the same. Geckobia mysoriensis sp. n. differs from G. uenoi in terms of the presence of serrate subcapitular setae n, densely serrate dorsal setae with long ciliations, the absence of the propodonotal shield and lack of coxal setae 4c. In G. uenoi, the subcapitular setae n are smooth, the dorsal setae are slightly serrate with short ciliations, the propodonotal shield is present and coxal setae 4c are absent.
Remarks. For the first time, an active protonymph in a species of the genus Geckobia has been observed. The protonymph (sample ID: 14_28_SF001 and 14_18SF) and deutonymph (sample ID: 24_SF001 and 24_SF001) of the species are represented by the same haplotype, whereas, simultaneously, the significant morphological differences between the mite stages are observed (e.g., size of idiosoma, shape of setae dF or leg chaetotaxy pattern). These findings suggest that the protonymph can be either an active or inactive feeding stage depending on the Geckobia species. So far, only in mites of the genus Pterygosoma and Neopterygosoma have active protonymphs been frequently found, e.g., [17], whereas in the remaining pterygosomatids they are commonly represented by inactive forms.
Geckobia treutleri sp. n. (Figure 12).
Female (holotype, range for one paratype). Gnathosoma. Chelicerae 130 (135) long; swollen cheliceral part 50 (55) long and slender distal part 80 (80) long. Movable cheliceral digit three-pronged. Fixed cheliceral digit spinous, 5 (5) long. Setae dF and dG filiform and smooth, 55 (50) and 65 (65) long, respectively. Subcapitular seta n filiform and smooth, 60 (65) long. Each branch of peritremes 85 (85) long. Idiosoma 320 (295) long and 350 (325) wide. Propodonotal shield absent. Small eyes present laterally. Dorsum with numerous serrate setae, 30–50 (25–50) long, distributed as in Figure 12a. Venter (Figure 12b) with about 28 short and plumose setae in anterior part, 10–15(10–20) long and longer serrate setae, 25–50 (30–50) long in posterior part. Genital series represented by one slightly serrate seta g1 and seven serrate pseudanal setae ps1–ps7. Seta g1 20–25 (25) long; setae ps1–ps7 45 (50), 40 (40), 30 (35), 20 (30), 20 (25), 30 (30) and 25 (25) long, respectively. Coxae in formula: 2–2–2–2. Setae 1a and 1b filiform and smooth, setae 2a, 2b, 3a, 3b, 4a, 4b spur-like and serrate at tip. Setae of tibiae I–IV (5–5–5–5), genua I–IV (0–0–0–1), femora I–IV (2–1–1–1), trochanters I–IV (1–1–1–1[0]). All setae of trochanter–genua I–IV filiform and smooth. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Setae it′, it″, tc′ and tc″ of legs I in form of euphatidia. Setae pl′ smooth, setae tc′ and tc″ of legs II–IV and all setae vs′, vs″, a′, a″ slightly serrate. Setae ft smooth and about 5 long. Solenidion ω1 of legs I about 25 long.
Type material.
Female holotype and one female paratype (CES19111) from Hemidactylus treutleri Mahony, 2009 (under toepads), (Squamata: Gekkonidae) (CES19102), India, Karnataka, Yerramaranahalli, 13°32′55.4″ N, 77°39′18.5″ E, 12.11.2019, coll. P. Karanth.
Molecular data.
The alignment of the D2 region of 28rRNA of G. treutleri is 927 bp long and comprises two sequences represented by two haplotypes differing in terms of three nucleotide positions (0.02%, SD = 0.001, K2P). The 18S region of rRNA was approximately 850 bp long and comprises two sequences represented by two haplotypes differing in one nucleotide position (0.12%, SD = 0.001).
Etymology.
The species name is derived from the species name of the host.
Differential diagnosis.
This species is most similar to Geckobia keegani Lawrence 1953 from Hemidactylus frenatus on Philippine Island [45], Australia [46] and Costa Rica [47]. In both species, the idiosoma is circular; the dorsal and ventral setae have the same general shape; the setation of tibiae I–IV, genua I–III, femora I–IV and trochanters I–IV is the same and legs I–IV are subequal in length. G. treutleri differs from G. keegani by the presence of smaller idiosoma (320 long and 350 wide), setae in the posterior part of the idiosoma, one pair of genital setae, seta lGIV and the absence of the propodonotal shield. In G. keegani, the idiosoma is bigger (513–616 long and 496–630 wide), setae in the posterior part of idiosoma are absent, four pairs of genital setae are present, seta lGIV is absent and the propodonotal shield is present.
Geckobia unica sp. n. (Figure 13).
Female (holotype). Gnathosoma. Chelicerae 80 long. Swollen, proximal part of cheliceral base and slender distal part subequal in length, 40 long. Movable cheliceral digit three-pronged. Fixed cheliceral digit spinous, about 5 long. Palpal femur with filiform serrate setae dF and dG 40 and 55 long, respectively. Setae dF only slightly thicker than setae dG. Palpal tibia with three smooth setae (dTi, l′Ti and l″Ti) and curved claw. Palpal tarsi with four smooth setae. Subcapitular seta n filiform and serrate, about 35 long. Each branch of peritremes with barely visible chambers about 75 long. Hypostome with ornamented apex. Idiosoma 340 long and 335 wide. Dorsum. Propodonotal shield well outlined, reniform, 110 long and 195 wide, sparsely punctate but in some parts covered by small unsclerotized lacunae (as in Figure 13a). On propodonotal shield, small eyes situated on lateral margins and 34 stout and plumose setae present. Setae situated antero-medially 25–30 long; setae situated posteriorly and laterally 35–40 long. Posterior to propodonotal shield longer setae (40 long) that decrease in length to median part of idiosoma (25–35 long) and then increase in length in the posterior part (40–55 long). Postero-lateral parts and most posterior part with numerous slightly serrate (50–60 long) and blunt-pointed setae. Venter (Figure 13b) with 26 short and plumose setae (10–15 long) situated anteriorly and numerous slightly flattened setae (60 long) with slightly serrated tip situated posteriorly. Genital region. Genital setae represented by four pairs of setae g1–g4. Setae g1–g3 slightly serrate and 50, 45 and 20 long, respectively. Setae g4 (30 long) thinner than g1–g3 and situated on valvae. Pseudanal setal series represented by nine setae ps about: 75, 35, 40, 55, 60, 55, 45, 60 and 55 long, respectively, Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b, 4a, 4b and 4c arranged in formula: 2–2–2–3. All coxal setae thick and plumose, except for filiform, slightly serrate setae1a and 1b. Leg chaetotaxy as follows: tibiae I–IV (5–5–5–5), genua I–IV (1 + k–0–1[0]–0), femora I–IV (3–2–2–2) and trochanters I–IV (1–1–1–2). Setae d′TiIIV, d″TiI, v′TiIIV, v″TiIIV, l′TiIIV, vFI–II, lGI and lGIII filiform and smooth; setae l′FI–IV filiform and slightly serrate; setae vFIII and vFIV thick and serrate, and TrI–IV filiform and serrate. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Solendion ω1 (about 25 long) of legs I longer than seta ft (about 5 long). Setae tc′, tc″, it′, it″ of leg I represented by euphatidia; tc′ and tc″ of legs II–IV, u′, u″, vs′, vs″, a′, a″ and pl′ of legs I–IV filiform.
Type material.
Female holotype (CES19114) from Hemidactylus cf. parvimaculatus India, Karnataka state, Bangalore, NCBS campus, 30 October 2019, coll. Chaitanya R.
Molecular data.
The COI sequence data of 639 bp is generated from the holotype female. The D2 alignment of G. unica is 918 bp long, and the 18S region of rDNA is 1680 bp.
Etymology.
The species name is derived from the Latin adjective “unique” which means “one, uncommon” and refers to unique setation of mite’s trochanter IV.
Differential diagnosis
This species is most similar to G. bataviensis Vitzthum, 1926 from Hemidactylus frenatus [48]. In both species, the idiosoma is almost circular; the propodonotal shield and the eyes are present; dorsal and ventral setae are plumose; palpal setae dF and dG are serrate; the chaetotaxy of coxae I–IV, tibiae I–IV and femora I–IV is the same, and four genital setae are present. In G. unica sp. n., the propodonotal shield is punctate, reniform and convex in its posterior margin; 34 setae are present on the propodonotal shield; dorsal setae decrease in length to the median part of the idiosoma and then increase in length in the posterior part of the idiosoma; subcapitular setae n are serrate, and leg setae lGIII and lTrIV are present. In G. bataviensis, the propodonotal shield is smooth and concave in its posterior margin, 40 setae are present on the propodonotal shield, the dorsal setae increase in length posteriorly, subscapular setae n has barely discernible serration and setae lGIII and lTrIV are absent.
Geckobia brevicephala sp. n. (Figure 14 and Figure 15).
Female (holotype, range for one paratype). Gnathosoma. Chelicerae 90 (90) long; swollen cheliceral part 40 (40) long and slender distal part 50 (55) long. Fixed cheliceral digit rounded. Setae dF and dG serrate, 25 (30) and 40 (40) long, respectively. Setae dF slightly thicker than dG. Subcapitular setae n with barely discernible serration, about 60 (60) long. Tibial setae (v, l′ and l″) smooth. Palp tarsi with four slightly serrate setae. Each branch of peritremes 70 (75) long. Idiosoma 405 (415) long and 665 (670) wide. Dorsum. Propodonotal shield 190 (200) wide and 85 (90) long, punctuate (as in Figure 14) and with 18 plumose setae, subequal in length, 25–30 (25–30) long. Small eyes present laterally on propodonotal shield. Posteriorly to propodonotal shield, two rows of plumose setae, about 20 (20) long, resembling those on propodonotal shield, present. Medial part of idiosoma with short plumose setae, about 10 (15) long. Most posterior part of idiosoma and lateral parts with serrate setae 70–75 (70–80) long. Venter. Antero-medial part with numerous plumose setae that slightly decrease in length from anterior, 15 (15) long, to posterior part of idiosoma 10 (10) long (Figure 15). Posterior and postero-lateral parts of idiosomal venter with slightly serrate flattened setae 40–55 long. Genital region. Setae g1 and g2 30 (30) long, setae g3 20 (25) long. Pseudanal setae ps1–ps10 65–80 (70–80) long. Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b, 4a, 4b and 4c arranged in formula: 2–2–2–3. All coxal setae thick and plumose, except for filiform, slightly serrate setae 1a and 1b. Between coxae I and II, two thick plumose setae present. Leg chaetotaxy as follows: tibiae I–IV (5–5–5–5), genua I–IV (1–0–0–0), femora I–IV (3–2–1–2) and trochanters I–IV (1–1–1–1). Setae d′TiIIV, d″TiI, v′TiIIV, v″TiIIV, l′TiIIV, vFI–IV, dFI–IV, dGI, vGI long filiform and smooth, vFIII, vFIV short and slightly serrate, lFI short and slightly serrate and setae lTrI–IV densely serrate. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, P′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Solendion ω1 of legs I (about 25 long) longer than seta ft (about 5 long). Setae tc′, tc″, it′ and it″ of leg I represented by euphatidia; tc′ and tc″ of legs II–IV, u′, u″, vs′ and vs. of legs I–IV, pl′, a′, a″ of legs I–IV filiform.
Type material.
Female holotype and one female paratype (CES 19113) from Hemidactylus frenatus, India, Karnataka state, Bangalore, IISc campus, 19.09.2019, coll. Caleb Daniel.
Molecular data.
The D2 alignment of G. brevicephala is 918 bp long and comprises two sequences represented by one haplotype. The 18S region of rRNA is 1679 bp long and comprises two sequences represented by one haplotype.
Etymology.
The species name is derived from the Latin word brevis which means “short” and cephale which means “head” and refers to the short gnathosoma of the species.
Differential diagnosis.
This species is very similar to Geckobia gibbonsi Bertand and Ineich, 1987 taken from a gecko Lepidodactylus sp. from Eua Island of Tonga [49]. In both species, the idiosoma is much wider than long, the propodonotal shield is present, the eyes are present and the chaetotaxy of legs I–IV is the same. This new species differs from G. gibbonsi in terms of the shape of the propodonotal shield, which is straight in its anterior and posterior part; 18 setae and eyes are present on the shield and short setae in the middle of the idiosomal dorsum. In G. gibbonsi, the propodonotal shield is concave in the anterior and posterior parts, 14 setae are present on the shield, the eyes are situated outside the shield and the dorsal setae increase in length from the anterior to posterior part of the idiosomal dorsum.

3.2.2. New Data of Already Described Species

Geckobia indica Hirst, 1917 (Figure 16, Figure 17, Figure 18, Figure 19 and Figure 20).
G. indica Hirst, 1917: 139; 1926: 185 Figure 8; Haitlinger 2005: 96.
Redescription.
Female (range for five specimens). Chelicerae 90–95 long. Swollen cheliceral part 45–50 long and slender distal part 45–50 long. Movable cheliceral digit three-pronged. Fixed cheliceral digit spinous, about 5 long. Setae dF thick and densely serrate, serrate dG slender and slightly serrate (as in Figure 16c). Setae dF and dG subequal in length and 25–30 long. Subcapitular setae n slightly serrate and about 40 long. Hypostomal apex smooth. Each branch of peritremes 75–85 long. Idiosoma 290–325 long and 430–460 wide. Dorsum (Figure 16a). Propodonotal shield almost smooth, 95 long and 240 wide. Inconspicuous eyes present laterally between most anterior setae. About 23–26 pairs of plumose setae (20–40 long) present on propodonotal shield. Posterior to propodonotal shield row of setae resembling setae on propodonotal shield (20–30 long) present. Below shorter plumose setae (about 10–15 long) present. Most posteriorly slender slightly serrate setae 50–70 long present. Venter (Figure 16b) with short plumose setae about 15–20 long situated antero-laterally. Longer numerous setae (60–70 long) situated posteriorly and laterally. Genital area. Genital setal series represented by four pairs of slightly serrate setae g1–g4, about 30 long. Pseudanal setal series represented by eight blunt-pointed serrate setae ps1–ps8 60–75 long. Legs. Coxae in formula: 2–2–2–3. Setae 1a and 1b filiform and smooth, setae 2a and 2b serrate, setae 3a, 3b, 4a, 4b and 4c spur-like and serrate. Setae of tibiae I–IV (5–5–5–5), genua I–IV (1–0–0–0), femora I–IV (3–2–2–2) and trochanters I–IV (1–1–1–1). Setae l′TiI–IV, l″TiI–IV, v′TiI–IV, v″TiI–IV, dTiI–IV, vFI and vGI smooth; setae dFIIV and lFI–IV slightly serrate and setae vTrI–IV serrate. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1 (Figure 16d); tarsi II: 10 setae (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Setae it′, it″, tc′ and tc″ of legs I in form of euphatidia. Setae a′, a″, u′ and u″ of legs I–IV serrate. Setae pl′, tc′ and tc″ of legs II–IV and setae vs′ and vs″ of legs I–IV smooth. Setae ft smooth and about 5 long. Solenidion ω1 of legs I about 25 long.
Description.
Male (range for three specimens). Gnathosoma. Chelicerae about 75 long; swollen cheliceral part about 35 long and slender distal part about 40 long. Setae dF thick and serrate, about 15 long; setae dG filiform and smooth, about 30 long. Fixed cheliceral digit spinous, 5 long. Subcapitular seta n filiform with barely discernible serration about 40 long. Each branch of peritremes about 50 long. Idiosoma 180–205 wide and 145–185 long with weakly outlined propodonotal shield in anterior part. Dorsum (Figure 17a) with about 20 pairs of short serrate setae (15–25 long) in anterior part of idiosoma and with 23 pairs of longer serrate setae (about 35 long) in posterior part. Venter (Figure 17b) with 20–34 pairs of short serrate setae (5–15 long) situated antero-medially and 20–25 pairs of longer setae (20–45 long) situated posteriorly. Aedeagus 90–120 long, bifurcated at the end. Genital cone with one pair of smooth and slightly serrate setae (about 15 long) situated most anteriorly, two pairs of smooth spine-like setae (about 10 long) situated medially and one pair of longer smooth setae (15–20 long) situated most posteriorly. Legs as in female.
Deutonymph (range for two specimens). Chelicerae 70–75 long. Swollen cheliceral part 30–35 long and slender distal part about 40 long. Fixed cheliceral digit spinous and 5 long. Setae dG filiform and smooth, 35 long; setae dF slightly serrate and 20 long. Each branch of peritremes 45 long. Idiosoma 220–255 long and 320–330 wide. Dorsum (Figure 18a) propodonotal shield (about 90 wide and 65 long) weakly outlined, with minute punctations in anterior part and five serrate setae, 20–35 long. Laterally to propodonotal shield, small platelets (15 long and 15 wide) with eye and one pair of serrate setae about 20 long present. Posterior to propodonotal shield short plumose setae (about 15 long) present in medial part of idiosoma. These setae increase in size from medial to posterior and lateral parts of idiosoma, 20–40 long. Venter (Figure 18b) with about 35 short plumose setae in antero-medial part (10–30 long) and about 45 longer serrate setae (40–70 long) in posterior part. Genital setae series represented by three pairs of slightly serrate setae g1–g3 25, 20 and 15 long, respectively. Setae ps1–ps3 serrate and 45, 40 and 25 long, respectively. Legs as in female.
Protonymph (range for three specimens). Gnathosoma as in female (Figure 20a). Chelicerae 55–70 long. Swollen cheliceral part 30 long and slender cheliceral part 40 long. Setae dG filiform, 25–30 long; setae dF serrate, 20–25 long. Subcapitular setae n 30 long. Each branch of peritremes 45 long. Idiosoma 150–195 long and 185–225 wide. Dorsum (Figure 19a). Propodonotal shield about 85 wide and 55 long; punctate only in its anterior part and with five pairs of serrate setae situated laterally. Small eyes present on lateral platelets (20 wide 15 long), accompanied by one serrate seta, about 25 long. Posterior to propodonotal shield serrate, longer setae (30–35 long) present. These setae longer than setae in posterior (20–25 long) part. Venter (Figure 19b) with about 20 pairs of plumose short setae 5–15 long. These setae increase in size from anterior to medial part of idiosoma. From medial to posterior part of idiosomal venter, 21 pairs of longer serrate setae (20–40 long) present. Genital setal series represented by slightly serrate setae g1–g3. Setae g1 15 long; setae g2 and g3 10 long. Pseudanal setal series represented by serrate setae ps1ps3 40, 30–35 and 20 long, respectively. Legs as in female.
Nymphchrysalis (range for one specimen). Idiosoma 165 long and 360 wide with barely discernible coxae.
Larva (ranges for five specimens). Gnathosoma. Chelicerae 45–50 long. Swollen cheliceral part and slender distal part subequal in length, 20–25 long. Setae dF serrate and 15 long; setae dG filiform and smooth 20 long. Subcapitular seta n absent. Each peritremal branch about 25 long. Idiosoma 145–190 long and 180–225 wide. Dorsum with 11 serrate setae. Propodonotal shield 65 wide and 50 long with four pairs of setae: setae situated medially shorter, 15–20 long; setae situated laterally longer, about 25 long (Figure 20b). Eyes present on barely discernible lateral platelets with accompanied serrate seta about 30 long. Six pairs of setae situated in posterior half of idiosoma, 30–35 long. Genital area with three genital setae g1–g3 (10–15 long) and two pseudanal setae ps1 and ps2 (20–25 long). Legs. Coxae in formula: 2–1–1. Coxae 1a, 1b and 2b filiform and smooth; setae 3a spur-like and serrate. Setae of tibiae I–III (5–5–4) genua I–III (1–0–0) femora I–III (3–2–2) and trochanters I–III (0–0–0). Setation of tarsi I–III as in female, except for lack of setae p” on tarsi I.
Type material (not examined).
Types from Hemidactylus gleadowi Murray (Squamata: Gekkonidae), ASIA: India, the northernmost portion of Sind (“upper Sind” according to Hirst 1917).
Type material deposition.
Unknown (it is not stated in the paper, i.e., [10,43]).
Non-type material (examined).
Five females, three males, two deutonymphs, three protonymphs, three males, five larvae and one nymphchrysalis (CES19112) from Hemidactylus treutleri Mahony (Squamata: Gekkonidae) (CES19104), India, Karnataka, Yerramaranahalli 13°32′55.4″ N, 77°39′18.5″ E, 12 November 2019, coll. P. Karanth.
Molecular data.
The COI sequence data of 661 bp were generated from one female. The D2 alignment of G. indica is 918 bp long and comprises two sequences represented by two haplotypes differing in terms of two nucleotide positions (0.32%, SD = 0.002, K2P). The 18S region of rRNA is 1688 bp and 844 long and comprises two sequences represented by two haplotypes differing in terms of two nucleotide positions (0.36%, SD = 0.002, K2P).
Host and distribution.
This species was collected from Hemidactylus gleadowi Murray [43] and “Hemidactylus gleadowi (=Hemidactylus brookii Gray)” from India [10], the undetermined Hemidactylus sp. from Sri Lanka [7] and Hemidactylus treutleri Mahony (new host) (present study) from India, Karnataka state, Yerramaranahalli (new locality) (present study).
Remarks.
This species was originally described by Hirst [43] based on females collected from the ventral scales of a gecko Hemidactylus gleadowi Murray, 1884 from India. The species description was incomplete; only detailed chaetotaxy of idiosomal dorsum and venter was presented. The author neither provides the drawing of the species nor the description of the chaetotaxy of gnathosoma, legs and genital region. Later on, in 1926, Hirst presented a figure with a dorsal view of Geckobia indica and mentioned that the mites were collected from “Hemidactylus gleadowi (=H. brooki)” [10]. In 1964, Jack, based on loaned-type specimens, described the chaetotaxy of trochanters-tibiae I–IV of Geckobia indica; however, the chaetotaxy of coxae I–IV and tarsi I–IV was not presented [16]. Then, Haitlinger [7] collected G. indica from undetermined Hemidactylus sp. from Sri Lanka, exceeding the species distribution. Moreover, the measurements of many structures of the species were presented for the first time [7]. Here, we present a full description of the species and provide detailed figures based on the material collected from Hemidactylus treutleri. Additionally, males and immature stages are described for the first time. However, the neotype is not designated for this species because the specimens are not taken from the type of host and locality (see Article 75.3.6 of ICZN [50,51]).
Geckobia bataviensis Vitzthum, 1926 (Figure 21 and Figure 22).
G. bataviensis Vitzthum, 1926: 122 Figure 76; Haitlinger 1998: 161 Figure 1, Figure 2, Figure 3, Figure 4, Figure 5, Figure 6, Figure 7, Figure 8, Figure 9, Figure 10, Figure 11, Figure 12 and Figure 13; Prawasti Farajallahrika and Raffiudin 2013: 83 Figure 3; Jacinavicius, Bassini-Silva, Oda, Kaiser 2021: 1 Figure 1 and Figure 2.
G. gleadoviana Hirst, 1926: 185 Figure 9; Haitlinger 2005: 96.
G. nepalii Hiregaudar, Joshee and Soman, 1959: 66 Figure 2; Haitlinger 2005: 96.
G. cosymboti Cuy, 1979: 156 Figure 1.
Material examined.
Two females from Hemidactylus frenatus Duméril and Bibron (Gekkonidae) (CES/08/035) India, Kerala state, Peechi, 24.01.2008, coll. P. Karanth; one female from the same host species from India, Karnataka, Bangalore, IISc, 14 September 2019, coll. Caleb Daniel; one female from the same host species and locality, 19 September 2019, coll. Caleb Daniel; one female from the same host species and locality, 19 September 2019, coll. Caleb Daniel; one female from the same host species and locality, 9 October 2019, coll. Caleb Daniel; one specimen from the same host species and locality, 19 October 2019, coll. Caleb Daniel; one female from the same host species, India, Karnataka, Bangalore, NCBS campus, 29 October 2019, coll. Caleb Daniel, one female from the same host species and locality, 29 October 2019, coll. Caleb Daniel; one female from the same host species and locality, 29 October 2019, coll. Caleb Daniel; one female from the same host species, India, Karnataka, Yerramaranahalli, 13°32′55.4″ N 77°39′18.5″ E, 12.11.2019, coll. P. Karanth; one female from H. parvimaculatus India, Karnataka, Bangalore, NCBS campus, 29 October 2019, coll. Chaitanya R.
Molecular data.
The COI sequence data of 660–668 bp were generated from three females of G. bataviensis and represented by two haplotypes. The pairwise comparison of the two COI haplotypes is high and amounts to 4.2% (SE = 0.009). The nuclear data, including 918 positions for the D2 region of 28S rRNA, are obtained for 11 specimens of G. bataviensis and represented by one haplotype. The 18S region of rRNA is 1679 bp long and comprises 12 sequences represented by 7 haplotypes. Intraspecific K2P divergence of 18S region of rDNA in G. bataviensis is 0.28% (SD = 0.001), and the pairwise distance between the haplotypes ranges from 0.1 to 1.05% (SD = 0.002).
Remarks.
We adopt the convention of Domrow [46] regarding G. gleadoviana Hirst, 1926, G. nepalii Hiregauder, Joshee and Soman, 1959 and G. cosymboti Cuy, 1973 as junior synonyms of G. bataviensis Vitzthum, 1926. We reject the view of Haitlinger that these might be subspecies of G. bataviensis [15] or separate species [7]. The author in his latter paper [7] shows in Table 1 the differences between the of G. gleadoviana and G. nepalii (e.g., the species differs in length of the idiosomal and gnathosomal structures) all of which are exclusively quantitative characteristics which cannot be the only differences between species. However, we observe significant variability in size between engorged and non-engorged females of G. bataviensis (compare Figure 21 and Figure 22 with, for example, Figure 76 in the original description or Figure 2 in [11]); therefore, quantitative characteristics cannot be the only differences between the species.
Geckobia phillipinensis Lawrence, 1953 (Figure 23, Figure 24, Figure 25 and Figure 26).
Geckobia phillipinensis Lawrence, 1953: 12 Figure 4 and Figure 5.
Diagnosis.
Female (range for five specimens). Gnathosoma. Swollen cheliceral part shorter than slender distal part. Subcapitular setae n slightly serrate. Setae dF serrate, setae dG filiform and smooth. Fixed cheliceral digit spinous. Hypostome with small depression present at apex. Idiosoma 230–270 long and 360–405 wide. Dorsum (Figure 23) with six thick setae situated antero-laterally. In median and lateral parts short plumose setae present. Posterior, lateral and peripheral setae numerous and serrate. Venter (Figure 24). Antero-medial and lateral part of idiosoma with short plumose setae. Posterior half of idiosoma with lanceolate setae with minute serration on the surface. Most posterior peripheral setae more elongate and narrower than setae in medial part. Genital area represented by four slender genital setae g1–g4 and eight densely serrate pseudanal setae ps1–ps8. Coxal setae 1a and 1b filiform; setae 2b and 3b thick and serrate; setae 2a, 3a, 4a, 4b and 4c spur-like and serrate.
Description.
Male (range for six specimens). Gnathosoma. Chelicerae 60–70 long. Slender cheliceral part 30–40 long and swollen basal part 30 long. Fixed cheliceral digit about 5 long. Dorsal palpal setae dF thick and serrate, 10–15 long. Setae dG filiform and smooth, 25–40 long. Subcapitular setae n filiform and smooth, 30–50 long. Each branch of peritremes about 45 long. Idiosoma 130–175 long and 170–190 wide. Dorsum with about 22 pairs of setae situated as in Figure 25a. Setae situated anteriorly longer (40–45 long) than setae situated posteriorly (about 35 long). Eyes present. Venter (Figure 25b) with 14 short serrate setae (10–15 long) situated medially and 32 longer serrate setae (15–30 long) situated in posterior half of idiosoma. Aedeagus 100–125 long. Genital cone with three setae 15, 10 and 5 long, respectively. One serrate seta situated laterally to genital cone, about 15 long, present. Legs. Coxal setation: 1a, 1b, 2a, 2b, 3a, 3b, 4a and 4b arranged in formula: 2–2–2–2. Setae 1a and 1b filiform with barely discernible serration, setae 2b serrate, setae 3b slightly serrate, setae 2a, 3a, 4a and 4b spur-like, thick and serrate. Setae of tibiae I–IV (5–5–5–5), genua I–IV (1–0–0–1), femora I–IV (3–2–2–12) and trochanters I–IV (1–1–1–1). Setae l′TiI–IV, l″TiI–IV, v′TiI–IV, v″TiI–IV, dTiI–IV, dFI–IV, vFI–III, lGI and lGIV filiform and smooth; setae vFIV slender and slightly serrate; setae lFI, lTrI–IV thick and serrate. Setae dFI–IV much longer than vFI–IV. Setation of tarsi I: 14 setae (ft, tc′, tc″, p′, p″, a′, a″, it′, it″, u′, u″, vs′, vs″ and pl′) and solenidion ω1; tarsi II: 10 setae (tc′, tc″, P′, p″, a′, a″, u′, u″, vs′ and vs″) and ω1; tarsi III and IV with 10 setae each (tc′, tc″, p′, p″, a′, a″, u′, u″, vs′ and vs″). Setae tc′, tc″, it′ and it″ of legs I in form of euphatidia. Setae pl′ smooth, setae tc′ and tc″ of legs II–IV and all setae vs′, vs″, a′ and a″ slightly serrate. Setae ft smooth, about 5 long. Solenidion ω1 of legs I about 25 long. Length of legs I–IV as follows: 120, 130, 160 and 195 long, respectively.
Deutonymph (range for three specimens). Gnathosoma. Chelicerae 85 long; slender cheliceral part 50 long and swollen basal part 35 long. Palpal femora with dorsal densely serrate seta dF, 20 long; palpal genua with filiform and smooth dorsal seta dG 35 long. Subcapitular setae n filiform and serrate 50 long. Each branch of peritremes 50 long. Idiosoma 220–245 long and 380–395 wide. Dorsum (Figure 26a). Propodonotal shield (about 85 wide and 75 long) barely discernible, smooth and slightly concave in its anterior part. Four pairs of serrate thick setae (20–25 long) situated antero-medially on propodonotal shield. Anterior setae situated near propodonotal shield plumose and 10–15 long. Posterior half of idiosoma with thick densely serrate setae 50–70 long. Eyes present on small lateral platelets and accompanied by two densely serrate setae, 20 long. Lateral setae densely serrate and 55–70 long. Venter (Figure 26b). Anterior part with numerous slightly serrate setae, about 10 long. Medial part with lanceolate setae, about 25 long and posterior part with longer, narrower and serrate setae, 50–60 long. Genital area with five pseudanal thick, flattened and densely serrate setae 35–30 long. Legs as in female.
Material examined.
Five females, six males and three deutonymphs (CES19115) from Hemidactylus frenatus, India, Karnataka state, Bangalore, NCBS campus, 29.10.2019, coll. Chaitanya R., Karanth P.
Molecular data.
The D2 alignment of G. phillipinensis is 910 bp long and comprises two sequences represented by one haplotype. The 18S region of rDNA is 1709 long and comprises four sequences represented by three haplotypes differing in one–two nucleotides (0.09%, SE = 0.0001). The amplification of COI was unsuccessful using both, universal and specific primers [35,52]. In all cases, Wolbachia endosymbiont was detected.
Host and distribution.
G. phillipinensis was described from Hemidactylus frenatus from the Philippine Islands [45] and India (new record).

3.3. Prevalence and Topical Specificity

A total of 208 lizards belonging to two genera and six species of the family Gekkonidae were examined. In 77 (37%) lizards, at least one mite species was found. Most of the host specimens (=179) were from IISc. Among the IISc host specimens, 44 were H. frenatus and 21 were C. mysoriensis, and together they hosted up to four mite species. The prevalence of the mites differed significantly between the host species: it was highest in Hemidactylus frenatus (61%), followed by Cnemaspis mysoriensis (47%) and H. parvimaculatus (12%). No mites of the genus Geckobia were collected from H. leschenaultii on IISc, although on the host species, Pimeliaphilus hemidactyli Fajfer and Karanth, 2021 was found [41].
In NCBS, 20 host specimens belonging to three species (Hemidactylus frenatus, H. parvimaculatus and C. mysoriensis) were checked for mites, of which nine were infested by three Geckobia species (prevalence = 45%): G. bataviensis, G. phillipinensis and G. unica. Additionally, four geckos of Hemidactylus giganteus and five geckos of H. treutleri were checked for mites in Yerramaranahalli. As a result, three species of Geckobia spp. were found, of which two were new to science: G. gigantea and G. treutleri.
The data for the preferred attachment site of all Geckobia spp. in the examined lizards were also collected. Most mites were almost completely hidden under the lizards’ scales (Figure 27a,b and Figure 28b,c,e) (i.e., G. brevicephala, G. treutleri, G. indica and females of G. phillipiensis). The former species was found under the ventral scales of the host’s tail, whereas the three latter were found under the belly scales. The males of G. phillipinensis were found in the tympanum (Figure 28d) where they moved freely and were not firmly attached to the skin.
Mites of G. mysoriensis were attached to exposed sites of the hosts (Figure 27c): the head, neck and lateral sites of the lizard’s body as they are morphologically unable to shelter under scales (their idiosoma is rounded). G. unica and mites of G. bataviensis were found on the toes of hosts at the base of the claws (mostly distal phalanges) (Figure 28a), whereas G. gigantea was found under the lamellae of hindlimbs where they might have protection from the itching activity of the hosts.

3.4. Genetic Distance and Molecular Delimitation of the Geckobia Species

The final alignment for species delimitation was comprised of 710 nucleotide position (nps) for seven COI sequences. The nucleotide sequences were translated into amino acid sequences, and no stop codons or frameshifts were observed. In the COI dataset, 236 out of 710 nps were variable.
The pairwise K2P interspecies distances of the COI gene fragment ranged from 7.1 to 32.7% (Table 4), and the intraspecies variation ranged from 0 to 4.2%. The greatest genetic intraspecies distances occurred in G. bataviensis. The COI distance within the genus has the largest values among analysed pterygosomatid genera (Table 5).
For D2 of 28S rRNA, the interspecies distances ranged from 0.66 to 10.06% (average = 6.9%) (Table 6), and the intraspecies variation ranged from 0 to 2.1 (average = 0.3). The greatest intraspecies genetic variation occurred in G. mysoriensis. For 18S, the intraspecies distances ranged from 0 to 0.36% (average = 0.17%), and the interspecies variation ranged from 0.18 to 1.75% (SD = 0.00, average = 0.86%) (Table 7). The greatest genetic intraspecies variation occurred in G. indica.
The ABGD of COI delimited three initial partitions with prior intraspecific divergence (P) varying from 0.1 to 10% (Figure 29). Barcode gaps were observed at K2P distances of 2–4%, 9–15%, 8–20%, 22–31% and 33–35%. Initial partitions were identical at 17 molecular operational taxonomic units (MOTUs), which was consistent with our prior morphospecies, except for the population of G. bataviensis, which was grouped with G. unica. For D2 of 28S rRNA, ABGD delimited eight MOTUs, with P varying from 0.1 to 5.9%, corresponding to our morphologically identified eight species. Barcode gaps were observed at K2P distances of 3–4% and 6–7%.
Genetic distance of COI within the genus Geckobia was much higher than the genetic distance of D2 of 28S rRNA fragment (Table 5). The COI genetic distance between genera Geckobia and Pimeliaphilus was higher (35.6, SD = 0.02) than between Geckobia and Pterygosoma (32.5, SD = 0.02), whereas the D2 of 28S rRNA fragment shows that the genetic distance between the former genera was lower (32.6, SD = 0.02) than between the latter genera (40.2, SD = 0.02).

3.5. Relationship between Analysed Species

The COI alignment was 671 nps long and comprises seven sequences of Geckobia species (ingroup), two sequences of Pterygosoma spp. and one sequence of Pimeliaphilus hemidactyli (outgroup). The BI and ML analyses revealed that the analysed Geckobia are a monophyletic taxon with strong support (BPP = 1) (Figure 30). According to our analysis, the first subclade (G. indica + G. unica + G. bataviensis) associated with Hemidactylus geckos represents a separate branch, whereas the mites of the second subclade (G. mysoriensis) associated with Cnemaspis mysoriensis form the second branch.
The D2 of 28S rRNA alignment was 945 bp long and comprises 32 sequences of Geckobia species (ingroup) and one sequence of Pimeliaphilus hemidactyli (outgroup). The ML and BI analyses showed very similar topologies (Figure 31). All species formed well-supported monophyletic groups (BPP = 0.96–1.00), with a basic division into eight Geckobia species. The first clade contains a subclade of G. brevicephala + G. indica as sister to G. treutleri + G.unica + G.bataviensis, with the genetic distance between the two subclades being 3.2%. The second well-supported clade (BS = 85, BPP = 1) includes G. gigantea as sister to G. phillipinensis + G mysoriensis. In general, we observed good support for the external branches but weaker support for the deeper nodes, which is a common feature of the phylogenetic reconstruction of the datasets.

4. Discussion

The present study is the first record of Geckobia mite’s diversity investigated at a local scale using an integrative taxonomy approach. Our results generally confirm morphological species delimitations but also show that Geckobia species’ richness is underestimated, and molecular methods provide complimentary information, although they are not essential to delimit the species boundaries. At the beginning of our research, we expected to find cryptic species, but our studies showed that the analysed Geckobia mite species have variable appearance and many unique morphological features which provide enough data for correct species delimitation by a specialist. However, the original morphological description of many already described species of the genus are vague, which results in problems with correct species delimitations based solely on morphological characteristics. Our results show that molecular data reliably complement morphological species identification and have many advantages, especially when used to identify multiple species simultaneously. The distance-based species delimitation methods have shown that, for each marker, the estimates of intraspecific genetic divergence between sequences representing COI and the D2 region of the 28S rRNA are 0.0–4.1% and 0.0–2.1%, respectively which is relatively high compared to other parasitic acariform taxa, e.g., [20], but seems to be typical in scale mites [42]. As the D2 of the 28S rDNA marker region shows distinct barcoding gaps and a clear species identification threshold, we recommend using it together with COI for identifying scale mites at species level.
The distance- and morphology-based results were confirmed by applying a phylogenetic approach. A monophyly of individuals belonging to the same species was evident. Both the distance-based method and phylogeny-based species delimitation revealed eight morphologically identified species: Geckobia gigantea sp. n., Geckobia mysoriensis sp. n., Geckobia treutleri sp. n., Geckobia indica Hirst, 1917, Geckobia bataviensis Vitzhum, 1926, Geckobia phillipinensis Lawrence, 1953, Geckobia unica sp. n. and Geckobia brevicephala sp. n. In one case, the COI ABGD results differed from the other methods by grouping two morphologically distinct species—G. bataviensis and G. unica—as one species. However, the species are phylogenetically sister taxa with high support values; therefore, we suspect that ABGD erroneously grouped the respective sequences and underestimated the number of species. Moreover, the ABGD initial and recursive partition of 28S grouped G. unica either as a separate species or together with G. bataviensis. The possibility of differentiation shown by recursive partition, together with the results of the phylogenetic analysis and morphological analysis, allows the placement of G. unica as a single species. Nevertheless, this taxa differentiation is based on a single individual. Therefore, further individuals from different host populations should be collected.
Although the results suggest the monophyly of the Geckobia mites used in this study, we cannot draw any certain conclusion regarding the whole genus. The representatives of the genus Geckobia are recorded from all gecko families [1], and according to the concept of Bochkov and Mironov [6] (based on parasitological data on associations of the genus Geckobia with the geckons), the mites might have parasitised on a common ancestor of these hosts (infraorder Gekkonomorpha). Nonetheless, the recent findings of Geckobia on iguanas (Liolaemidae) [2] challenge this thesis and indicate the need for further research including the mite species taken from host taxa distributed worldwide. To investigate species relationships and fully resolve the mite’s taxonomy, we indicate the necessity of complementing the standard barcoding marker of COI with at least one additional gene marker (e.g., 28S or 18S), as proposed by [53].
Our findings show that in addition to the taxon assignment limitations when using COI alone, the primer bias problem needs to be considered when scale mites are targeted in molecular studies, as universal COI primers show unsatisfactory amplification performance. We attempted to address this problem by combining more specific COI primers commonly used in other acariform mites, e.g., [35,42,52], or even designing new primers for this mite genus. However, our attempts were unsuccessful, and only a few COI sequences from analysed Geckobia spp. were obtained. Instead of the COI sequences, in some cases the intercellular symbiont Wolbachia was detected while using specific primers. Wolbachia are bacteria vertically inherited by transovarial transmission, which generally acts as reproductive parasite in arthropods, inducing a wide range of phenotypic effects, such as: parthenogenesis, feminisation, male-killing and cytoplasmic incompatibility, the inability of infected males to successfully fertilise eggs from uninfected females [54]. Our routine observations, as well as analysis of literature, show that the sex ratio in different scale-mite species (or even within different populations of the same species), is highly variable. Most populations are strongly female-biased, and in extreme cases, the host individuals are inhabited exclusively by females. Furthermore, males were never observed in at least half of all known pterygosomatid species, suggesting that they reproduce through parthenogenesis. So far, pterygosomatids have not been examined for the presence of any bacteria that potentially influence reproduction mechanisms. Consequently, we can only suspect that the sex-ratio biases observed in these scale mites are induced by Wolbachia. Interestingly, arthropods with a limited diet, such as vertebrate blood, often harbour endosymbiotic bacteria to obtain essential nutrients, e.g., [55], which shows an even more interesting area for future research on scale mites.
We found that Geckobia spp., in the presence of closely related host species living in sympatry on IISc, shows a high degree of host specificity even though the mites have good dispersal ability and can potentially switch between different host species during accidental encounters. Our results suggest a high level of host specificity for the mites that are infesting geckos with no evidence of host switching. It is plausible that factors such as odour signals (such as pheromones) could be used by the mites to differentiate between host species. Therefore, Geckobia mites seem to spend their entire lives on the same individual or switch the hosts only during their mating. However, our studies were limited to the restricted area of IISc campus; therefore, the host-specificity pattern may change after checking multiple hosts’ species living outside IISc.
Geckobia mites live on various parts of the host’s body, and species differ in the type of microhabitat they inhabited. G. brevicephala, G. treutleri, G. indica and females of G. phillipiensis are completely hidden under the scales; therefore, and they all possess short chelicerae, and their idiosoma is considerably wider than long. This is partly congruent with the observation of Hirst [10] made on Asian Geckobia species. The author [10,43] also noticed that the species living under the lizard’s scales have scale-like setae on the venter instead of typical setae. However, this is true only for G. phillipinensis; the remaining three species of Geckobia have typical smooth and long setae in the posterior part of the idiosoma. The rest of the mite species investigated are morphologically unable to take shelter under the scales. Their idiosoma is almost as wide as it is long, and the chelicerae and legs are longer when compared to the species sheltering beneath the scales. Therefore, they inhabit exposed sites of the host’s body (e.g., G. mysoriensis), attach to the hosts’ toes at the base of the claws (e.g., G. bataviensis and G. unica) or hide in the tympanum (e.g., males of G. phillipinensis). Interestingly, inhabiting two separate niches on one individual host by one Geckobia species (i.e., females of G. phillipinensis are completely hidden under the scales, whereas males move freely in the tympanum) has not been observed for the genus Geckobia before. Moreover, in several instances, one host individual harboured more than one Geckobia species (Table 3). However, the mite species did not come into direct competition and were associated with different body regions of hosts.
In conclusion, this is the first attempt to combine three types of data for integrative taxonomical investigations of Geckobia mites—morphological, molecular and ecological—to investigate diversity and species delineation in Geckobia mites. Through comprehensive analysis on a local scale, the presented studies have revealed that the scale-mite fauna is substantially more diverse than expected. Previous records of Geckobia mites include 23 species described from Asian geckos (13 spp.), of which six species have been reported on three host species in India [1,6,7]. Our study almost doubled the hitherto known number of species in India, but we assume that Geckobia diversity can even mirror the diversity of its vast range of hosts. There is a need for similar investigations on a wider scale to understand the global diversity of the mites. Undoubtedly, the integrative approach proposed here can be used in the future to not only reveal the further hidden biodiversity of Geckobia mites but also help build more reliable phylogenetic hypotheses, as the hypotheses of a pterygosomatid’s phylogenies are based solely on morphology and built only for two genera [56,57].

Author Contributions

Conceptualization, M.F. and P.K.; methodology, M.F.; investigation, M.F. and P.K.; resources and material collection, P.K.; writing—original draft preparation, M.F.; writing—review and editing, M.F. and P.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was possible due to financing from EMBO Short-Term Fellowship No. 8277. The molecular work in India was supported by the DBT-IISc partnership program.

Data Availability Statement

The molecular data that support this study are available online (NCBI). The remaining material is stored in the Centre for Ecological Science (IISc, Bangalore) and will be shared upon reasonable request to Praveen Karanth.

Acknowledgments

We would like to thank Caleb and Achuthan for their help with field work and host identification.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fajfer, M. Acari (Chelicerata)—Parasites of Reptiles. Acarina 2012, 20, 108–129. [Google Scholar]
  2. Fajfer, M. Mites of the new species group nitidus (Acariformes: Pterygosomatidae: Geckobia), parasites of lizards in South America. Syst. Parasitol. 2015, 90, 213–222. [Google Scholar] [CrossRef] [Scilit]
  3. Fajfer, M. New species and records of scale mites (Acariformes: Pterygosomatidae) from geckos (Squamata: Gekkonidae and Carphodactylidae). BioMed Res. Int. 2018, 2018, 9290308. [Google Scholar] [CrossRef] [Scilit]
  4. Machado, I.B.; Gazêta, G.S.; Pérez, J.; Cunha, R.; Giupponi, A.P.D.L. Two new species of the genus Geckobia Mégnin, 1878 (Acariformes, Prostigmata, Pterygosomatidae) from Peru. Zootaxa 2019, 4657, 333–351. [Google Scholar] [CrossRef] [Scilit]
  5. Bertrand, M.; Pedrono, M. Euryxeny and stenoxeny of the genus Geckobia Mégnin (Actinedida: Pterygosomatidae): Geckobia enigmatica n. sp. collected from the Madagascan tortoise (Geochelone yniphora). Acarologia 1999, 40, 147–153. [Google Scholar]
  6. Bochkov, A.V.; Mironov, S.V. Two new species of the genus Geckobia (Acari: Pterygosomatidae) from geckons (Lacertilia: Gekkonomorpha) with a brief review of host-parasite associations of the genus. Russ. J. Herpetol. 2000, 7, 61–68. [Google Scholar]
  7. Haitlinger, R. New records of Geckobia species (Acari, Prostigmata, Pterygosomatidae) from India and Sri Lanka, with description of Geckobia myanmarensis n. sp. from Myanmar. Acarologia 2005, 64, 95–102. [Google Scholar]
  8. Lajmi, A.; Giri, V.B.; Singh, T.; Agarwal, I. Two new species of yellow-tailed Hemidactylus Goldfuss, 1820 (Squamata: Gekkonidae) from rocky outcrops on the Telangana Plateau, India. Zootaxa 2020, 489, 483–504. [Google Scholar] [CrossRef] [Scilit]
  9. Khandekar, A.; Thackeray, T.; Agarwal, I. A cryptic new species of rupicolous Hemidactylus Goldfuss, 1820 (Squamata: Gekkonidae) allied to H. aaronbaueri Giri, 2008 from the northern Western Ghats of Maharashtra, India. Zootaxa 2021, 5020, 434–456. [Google Scholar] [CrossRef] [Scilit]
  10. Young, M.R.; Behan-Pelletier, V.M.; Hebert, P.D.N. Revealing the hyperdiverse mite fauna of subarctic Canada through DNA barcoding. PLoS ONE 2012, 7, e48755. [Google Scholar] [CrossRef] [Scilit]
  11. Hirst, A.S. On the parasitic mites of the suborder Prostigmata (Trombidioidea) found on lizards. J. Proc. Linn. Soc. Zool. 1926, 36, 173–200. [Google Scholar] [CrossRef] [Scilit]
  12. Hiregaudar, L.; Joshee, A.; Soman, P. On some pterygosomid mites parasitic on Indian lizards. J. Biol. Sci. 1959, 2, 64–66. [Google Scholar]
  13. Cuy, L.S. Synopsis of Philippine Pterygosomatidae. Kalikasan 1979, 8, 155–161. [Google Scholar]
  14. Kawashima, K. Notes on some japanese lizard mites, including description of a new species (Acarina: Pterygosomidae). Kyushu J. Med. Sci. 1962, 13, 273–275. [Google Scholar]
  15. Haitlinger, R. Species of Geckobia Megnin, 1878 (Acari, Prostigmata, Pterygosomidae) from Madagascar and Vietnam. Wiad. Parazytol. 1988, 34, 161–175. [Google Scholar]
  16. Jack, K.M. Leg-chaetotaxy with special reference to the Pterygosomatidae (Acarina). Ann. Natal. Mus. 1964, 16, 152–171. [Google Scholar]
  17. Fajfer, M. A systematic revision of the scale mite genus Pterygosoma Peters, 1849 (Acariformes: Pterygosomatidae). Zootaxa 2020, 4805, zootaxa-4805. [Google Scholar] [CrossRef] [Scilit]
  18. Glowska, E.; Dragun-Damian, A.; Dabert, J. A new quill mite Syringophiloidus pseudonigritae sp. nov. (Prostigmata, Syringophilidae) parasitizing Pseudonigrita arnaudi (Passeriformes, Ploceidae)—A combined description using morphology and DNA barcode data. Zootaxa 2012, 3532, 64–68. [Google Scholar] [CrossRef] [Scilit]
  19. Dabert, J.; Ehrnsberger, R.; Dabert, M. Glaucalges tytonis sp. n. (Analgoidea, Xolalgidae) from the barn owl Tyto alba (Strigiformes, Tytonidae): Compiling morphology with DNA barcode data for taxon descriptions in mites (Acari). Zootaxa 2008, 1719, 41–52. [Google Scholar] [CrossRef] [Scilit]
  20. Głowska, E.; Dragun-Damian, A.; Dabert, J. DNA-barcoding contradicts morphology in quill mite species Torotrogla merulae and T. rubeculi (Prostigmata: Syringophilidae). Folia Parasitol. 2013, 60, 51–60. [Google Scholar] [CrossRef] [Scilit]
  21. Mironov, S.V.; Dabert, J.; Dabert, M. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae)—Morphological description with DNA barcode data. Zootaxa 2012, 3253, 54–61. [Google Scholar] [CrossRef] [Scilit]
  22. Heethoff, M.; Laumann, M.; Weigmann, G.; Raspotnig, G. Integrative taxonomy: Combining morphological, molecular and chemical data for species delineation in the parthenogenetic Trhypochthonius tectorum complex (Acari, Oribatida, Trhypochthoniidae). Front. Zool. 2011, 8, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Lajmi, A.; Giri, V.B.; Karanth, K.P. Molecular data in conjunction with morphology help resolve the Hemidactylus brookii complex (Squamata: Gekkonidae). Org. Divers. Evol. 2016, 16, 659–677. [Google Scholar] [CrossRef] [Scilit]
  24. The Reptile Database. Available online: http://www.reptile-database.org (accessed on 1 December 2019).
  25. Krantz, G.W.; Walter, D.E. A Manual of Acarology; Texas Tech University Press: Lubbock, TX, USA, 2009. [Google Scholar]
  26. Grandjean, F. Les Segments Post-Larvaires de L’hystérosoma Chez Les Oribates (Acariens). Bull. Soc. Zool. Fr. 1939, 64, 273–284. [Google Scholar]
  27. Grandjean, F. Observations sur les Acariens de la famille des Stigmaeidae. Arch. Sci. Phys. Nat. 1944, 26, 103–1131. [Google Scholar]
  28. Norton, R.A. A review of F. Grandjean’s system of leg chaetotaxy in the Oribatei and its application to the Damaeidae. Biol. Oribatid Mites 1977, 33, 122. [Google Scholar]
  29. Grandjean, F. Au sujet de l’organe de Claparede, des eupathides multiples et des taenidies mandiubulaires chez les Acariens actinochitineux. Arch. Sci. Phys. Nat. 1946, 28, 63–87. [Google Scholar]
  30. Bochkov, A.V.; OConnor, B.M. A review of the external morphology of the family Pterygosomatidae and its systematic position within the Prostigmata (Acari: Acariformes). Parasitologiya 2006, 40, 201–214. [Google Scholar]
  31. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evo. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  32. Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [Scilit]
  33. Puillandre, N.; Lambert, A.; Brouillet, S.; Achaz, G. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 2012, 21, 1864–1877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Lanfear, R.; Calcott, B.; Ho, S.Y.W.; Guindon, S. PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 2012, 29, 1695–1701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Dabert, M.; Witalinski, W.; Kazmierski, A.; Olszanowski, Z.; Dabert, J. Molecular phylogeny of acariform mites (Acari, Arachnida): Strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol. Phyl. Evol. 2010, 56, 222–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Silvestro, D.; Michalak, I. raxmlGUI: A graphical front-end for RAxML. Org. Divers. Evol. 2012, 12, 335–337. [Google Scholar] [CrossRef] [Scilit]
  37. Hillis, D.M.; Bull, J.J. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 1993, 42, 182–192. [Google Scholar] [CrossRef] [Scilit]
  38. Ronquist, F.; Huelsenbeck, J.P. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
  39. Alfaro, M.E. Bayes or bootstrap? A simulation study comparing the performance of Bayesian Markov Chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Mol. Biol. Evol. 2003, 20, 255–266. [Google Scholar] [CrossRef] [Scilit]
  40. Tree Figure Drawing Tool, Version 1.4.3, Institute of Evolutionary Biology, University of Edinburgh. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 14 July 2021).
  41. Fajfer, M.; Karanth, P. Integrating a morphological description with DNA barcode data of a new species of the genus Pimeliaphilus (Acariformes: Pterygosomatidae) with the analysis of its host specificity and a key to the genus. Syst. Appl. Acarol. 2021, 26, 43–8454. [Google Scholar] [CrossRef] [Scilit]
  42. Fajfer, M.; Melnikov, D.; Dabert, M. Three new species of the genus Pterygosoma Peters, 1849 (Acariformes: Pterygosomatidae) from agamid lizards (Sauria: Agaminae) with DNA barcode data. Syst. Parasitol. 2016, 93, 791–814. [Google Scholar] [CrossRef] [Scilit]
  43. Hirst, A.S. On some new mites living on lizards. Ann. Mag. Nat. Hist. 1917, 8, 136–143. [Google Scholar] [CrossRef] [Scilit]
  44. Kawashima, K.; Kamo, H. Description of a new lizard mite, Geckobia uenoi sp. nov. from Is. Tokunoshima, southern Japan (Acarina: Pterygosomidae). Kyushu J. Med. Sci. 1960, 11, 99–102. [Google Scholar]
  45. Lawrence, R. Two new scale-mite parasites of lizards. Proc. U. S. Natl. Mus. 1953, 103, 9–18. [Google Scholar] [CrossRef] [Scilit]
  46. Domrow, R. Acari from Operation Drake in New Guinea. Acarologia 1983, 24, 393–402. [Google Scholar]
  47. Frenkel, C.; Vargas, M. The immature stages and adults of Geckobia keegani (Acari: Pterygosomatidae), parasite of Hemidactylus frenatus (Gekkonidae) in Costa Rica. Acarologia 2005, 45, 77–83. [Google Scholar]
  48. Vitzthum, H.G. Malayische Acari. Treubia 1926, 8, 1–198. [Google Scholar]
  49. Bertrand, M.; Ineich, I. Sur deux nouvelles especes de Pterygosomatidae ectoparasites de Gekkonidae. Relations entre les distributions de l’hôte et du parasite. Acarologia 1987, 27, 141–149. [Google Scholar]
  50. International Code of Zoological Nomenclature. Fourth Edition. London, U.K. Available online: https://code.iczn.org/?frame=1 (accessed on 20 January 2021).
  51. ICZN. Amendment of Articles 8, 9, 10, 21 and 78 of the International Code of Zoological Nomenclature to expand and refine methods of publication. ZooKeys 2012, 219, 1–10. [Google Scholar] [CrossRef] [Scilit]
  52. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome C Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Marine Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  53. Dabert, M.; Proctor, H.; Dabert, J. Higher-level molecular phylogeny of the water mites (Acariformes: Prostigmata: Parasitengonina: Hydrachnidiae). Mol. Phyl. Evol. 2016, 101, 75–90. [Google Scholar] [CrossRef] [Scilit]
  54. Stouthamer, R.; Breeuwer, J.A.J.; Hurst, G.D.D. Wolbachia pipientis: Microbial manipulator of arthropod reproduction. Ann. Rev. Microbiol. 1999, 53, 71–102. [Google Scholar] [CrossRef] [Scilit]
  55. Nikoh, N.; Hosokawa, T.; Moriyama, M.; Oshima, K.; Hattori, M.; Fakatsu, T. Evolutionary origin of insect–Wolbachia nutritional mutualism. Proc. Natl. Acad. Sci. USA 2014, 111, 10257–10262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Paredes-León, R.; Klompen, H.; Pérez, T.M. Systematic revision of the genera Geckobiella Hirst, 1917 and Hirstiella Berlese, 1920 (Acari: Prostigmata: Pterygosomatidae) with description of a new genus for American species parasites on geckos formerly placed in Hirstiella. Zootaxa 2012, 3510, 1–40. [Google Scholar] [CrossRef] [Scilit]
  57. Fajfer, M. Systematics of reptile-associated scale mites of the genus Pterygosoma (Acariformes: Pterygosomatidae) derived from external morphology. Zootaxa 2019, 4603, 401–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Geckobia gigantea sp. n. female: (a) in dorsal view; (b) in ventral view; (c) genital region, enlarged.
Figure 1. Geckobia gigantea sp. n. female: (a) in dorsal view; (b) in ventral view; (c) genital region, enlarged.
Diversity 14 01064 g001
Figure 2. Geckobia gigantea sp. n., female, details: (a) propodonotal shield; (b), gnathosoma in dorsal view; (c) posterior dorsal setae.
Figure 2. Geckobia gigantea sp. n., female, details: (a) propodonotal shield; (b), gnathosoma in dorsal view; (c) posterior dorsal setae.
Diversity 14 01064 g002
Figure 3. Geckobia gigantea sp. n., male: (a) in dorsal view; (b) in ventral view.
Figure 3. Geckobia gigantea sp. n., male: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g003
Figure 4. Geckobia gigantea sp. n. deutonymph in ventral view.
Figure 4. Geckobia gigantea sp. n. deutonymph in ventral view.
Diversity 14 01064 g004
Figure 5. Geckobia gigantea sp. n.: (a) dorsal view of genital region of deutonymph; (b) larva in dorsal view; (c) larva in ventral view.
Figure 5. Geckobia gigantea sp. n.: (a) dorsal view of genital region of deutonymph; (b) larva in dorsal view; (c) larva in ventral view.
Diversity 14 01064 g005
Figure 6. Geckobia mysoriensis sp. n. female in dorsal view.
Figure 6. Geckobia mysoriensis sp. n. female in dorsal view.
Diversity 14 01064 g006
Figure 7. Geckobia mysoriensis sp. n. female in ventral view.
Figure 7. Geckobia mysoriensis sp. n. female in ventral view.
Diversity 14 01064 g007
Figure 8. Geckobia mysoriensis sp. n. female, details: (a) gnathosoma in ventral view; (b) coxae III and IV.
Figure 8. Geckobia mysoriensis sp. n. female, details: (a) gnathosoma in ventral view; (b) coxae III and IV.
Diversity 14 01064 g008
Figure 9. Geckobia mysoriensis sp. n.: (a) deutonymph in dorsal view; (b) genital region of larva.
Figure 9. Geckobia mysoriensis sp. n.: (a) deutonymph in dorsal view; (b) genital region of larva.
Diversity 14 01064 g009
Figure 10. Geckobia mysoriensis sp. n. protonymph: (a) in dorsal view; (b) in ventral view.
Figure 10. Geckobia mysoriensis sp. n. protonymph: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g010
Figure 11. Geckobia mysoriensis sp. n. larva with forming chrysalis, dorsal view.
Figure 11. Geckobia mysoriensis sp. n. larva with forming chrysalis, dorsal view.
Diversity 14 01064 g011
Figure 12. Geckobia treutleri sp. n. female: (a) in dorsal view; (b) in ventral view. Scale bar represents µm.
Figure 12. Geckobia treutleri sp. n. female: (a) in dorsal view; (b) in ventral view. Scale bar represents µm.
Diversity 14 01064 g012
Figure 13. Geckobia unica sp. n. female: (a) in dorsal view; (b) in ventral view.
Figure 13. Geckobia unica sp. n. female: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g013
Figure 14. Geckobia brevicephala sp. n. female in dorsal view.
Figure 14. Geckobia brevicephala sp. n. female in dorsal view.
Diversity 14 01064 g014
Figure 15. Geckobia brevicephala sp. n. female in ventral view.
Figure 15. Geckobia brevicephala sp. n. female in ventral view.
Diversity 14 01064 g015
Figure 16. Geckobia indica Hirst, 1917, female: (a) idiosoma in dorsal view; (b) idiosoma in ventral view; (c) palps in dorsal view; (d) tarsi I in lateral view.
Figure 16. Geckobia indica Hirst, 1917, female: (a) idiosoma in dorsal view; (b) idiosoma in ventral view; (c) palps in dorsal view; (d) tarsi I in lateral view.
Diversity 14 01064 g016
Figure 17. Geckobia indica Hirst, 1917, male: (a) in dorsal view; (b) in ventral view.
Figure 17. Geckobia indica Hirst, 1917, male: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g017
Figure 18. Geckobia indica Hirst, 1917 deutonymph: (a) in dorsal view; (b) in ventral view.
Figure 18. Geckobia indica Hirst, 1917 deutonymph: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g018
Figure 19. Geckobia indica Hirst, 1917 protonymph: (a) in dorsal view; (b) in ventral view.
Figure 19. Geckobia indica Hirst, 1917 protonymph: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g019
Figure 20. Geckobia indica Hirst, 1917: (a) part of gnathosoma of protonymph in dorsal view; (b) outlined propodonotal shield in larva; (c) chrysalis (tritonymph) in ventral view.
Figure 20. Geckobia indica Hirst, 1917: (a) part of gnathosoma of protonymph in dorsal view; (b) outlined propodonotal shield in larva; (c) chrysalis (tritonymph) in ventral view.
Diversity 14 01064 g020
Figure 21. Geckobia bataviensis Vitzhum, 1926 female in dorsal view.
Figure 21. Geckobia bataviensis Vitzhum, 1926 female in dorsal view.
Diversity 14 01064 g021
Figure 22. Geckobia bataviensis Vitzhum, 1926 female in ventral view.
Figure 22. Geckobia bataviensis Vitzhum, 1926 female in ventral view.
Diversity 14 01064 g022
Figure 23. Geckobia phillipinensis Lawrence, 1953 female in dorsal view.
Figure 23. Geckobia phillipinensis Lawrence, 1953 female in dorsal view.
Diversity 14 01064 g023
Figure 24. Geckobia phillipinensis Lawrence, 1953 female in ventral view.
Figure 24. Geckobia phillipinensis Lawrence, 1953 female in ventral view.
Diversity 14 01064 g024
Figure 25. Geckobia phillipinensis Lawrence, 1953 male: (a) dorsal view; (b) ventral view.
Figure 25. Geckobia phillipinensis Lawrence, 1953 male: (a) dorsal view; (b) ventral view.
Diversity 14 01064 g025
Figure 26. Geckobia phillipinensis Lawrence, 1953 deutonymph: (a) in dorsal view; (b) in ventral view.
Figure 26. Geckobia phillipinensis Lawrence, 1953 deutonymph: (a) in dorsal view; (b) in ventral view.
Diversity 14 01064 g026
Figure 27. (a) Geckobia sp. attached to venter of Hemidactylus frenatus Duméril and Bibron; (b) Geckobia brevicephala sp. n. attached to venter scales of a tail of H. frenatus; (c) Geckobia mysoriensis sp. n. attached to lateral sides of Cnemaspis mysoriensis (Jerdon).
Figure 27. (a) Geckobia sp. attached to venter of Hemidactylus frenatus Duméril and Bibron; (b) Geckobia brevicephala sp. n. attached to venter scales of a tail of H. frenatus; (c) Geckobia mysoriensis sp. n. attached to lateral sides of Cnemaspis mysoriensis (Jerdon).
Diversity 14 01064 g027
Figure 28. (a) Geckobia bataviensis Vitzhum, 1926 on toe of Hemidactylus frenatus Duméril and Bibron; (b) Geckobia sp. attached to H. cf. frenatus; (c) female of Geckobia phillipinensis under the ventral scales of H. frenatus; (d) Geckobia indica Hirst, 1917 under the ventral scales of Hemidactylus treutleri Mahony; (e) males of Geckobia phillipinensis Lawrence, 1953 in tympanum of H. frenatus.
Figure 28. (a) Geckobia bataviensis Vitzhum, 1926 on toe of Hemidactylus frenatus Duméril and Bibron; (b) Geckobia sp. attached to H. cf. frenatus; (c) female of Geckobia phillipinensis under the ventral scales of H. frenatus; (d) Geckobia indica Hirst, 1917 under the ventral scales of Hemidactylus treutleri Mahony; (e) males of Geckobia phillipinensis Lawrence, 1953 in tympanum of H. frenatus.
Diversity 14 01064 g028
Figure 29. ABDG delimitation of Geckobia species: (a) COI gene; (b) 28S gene.
Figure 29. ABDG delimitation of Geckobia species: (a) COI gene; (b) 28S gene.
Diversity 14 01064 g029
Figure 30. Maximum likelihood of COI mt DNA tree of the analysed Geckobia spp. Bayesian analysis yielded almost identical tree topology with only branches of the two Pterygosoma not resolved (polytomous). The support of branches is given as bootstrap value for 1000 replications followed by posterior probability index.
Figure 30. Maximum likelihood of COI mt DNA tree of the analysed Geckobia spp. Bayesian analysis yielded almost identical tree topology with only branches of the two Pterygosoma not resolved (polytomous). The support of branches is given as bootstrap value for 1000 replications followed by posterior probability index.
Diversity 14 01064 g030
Figure 31. Maximum likelihood of 28S rRNA tree of the analysed Geckobia spp. Bayesian analysis yielded almost identical tree topology. The support of branches is given as bootstrap value for 1000 replications followed by posterior probability index.
Figure 31. Maximum likelihood of 28S rRNA tree of the analysed Geckobia spp. Bayesian analysis yielded almost identical tree topology. The support of branches is given as bootstrap value for 1000 replications followed by posterior probability index.
Diversity 14 01064 g031
Table 3. Prevalence of Geckobia spp. in different species (specimens caught from September 2019 to November 2019).
Table 3. Prevalence of Geckobia spp. in different species (specimens caught from September 2019 to November 2019).
Host Species:No. of Checked Host Specimens:No. of Infested Host SpecimensPrevalence (%)
at IISc and NCBS, respectively:
Hemidactylus frenatus Duméril and Bibron, 183672/1244/7 161/58
H. parvimaculatus Deraniyagala, 195349/60/2 212/33
H. leschenaultii Duméril and Bibron, 183613/00/0 2-
Cnemaspis mysoriensis (Jerdon, 1853)45/221/047/0
at Yerramaranahalli
Hemidactylus treutleri Mahony, 200952 340
Hemidactylus giganteus Stoliczka, 18714125
1G. phillipinensis was found on four host specimens together with G. bataviensis at IISc. 2 These species were infested also by Pimeliaphilus mites (see [41]). 3 G. indica and G. treutleri sp. n. were found on different host specimens.
Table 4. Estimates of evolutionary divergences between COI sequences of Geckobia species.
Table 4. Estimates of evolutionary divergences between COI sequences of Geckobia species.
1.2.3.4.
1.G. bataviensis Vitzhum, 1926----
2.G. indica Hirst, 191718.7 (0.02)---
3.G. mysoriensis sp. n.32.2 (0.03)32.7 (0.03)--
4.G. unica sp. n.7.1 (0.01)17.5 (0.02)30.0 (0.03)-
Table 5. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between D2 sequences and COI among genera and between genera.
Table 5. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between D2 sequences and COI among genera and between genera.
D2 28S rRNACOI
Mite Genuswithin Genusbetween Generawithin Genusbetween Genera
1.2.3. 1.2.3.
1. Geckobia spp.14.0 (0.17)-40.2 (0.02)32.6 (0.02)21.8 (0.01)-32.5 (0.02)35.6 (0.02)
2. Pterygosoma spp.22.9 (0.01)--43.1 (0.02)20.1 (0.02)--30.7 (0.02)
3. Pimeliaphilus spp.0.00 (0.00)---0.00 (0.00)---
Table 6. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between D2 sequences of analysed Geckobia species. The analysis included 45 sequences.
Table 6. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between D2 sequences of analysed Geckobia species. The analysis included 45 sequences.
Mite Species1.2.3.4.5.6.7.8.
1. G. bataviensis Vitzhum, 1926--------
2. G. brevicephala sp. n.2.66 (0.01)-------
3. G. gigantea sp. n.7.18 (0.01)7.53 (0.01)------
4. G. indica Hirst, 19173.06 (0.01)1.82 (0.00)7.58 (0.01)-----
5. G. mysoriensis sp. n.9.37 (0.01)9.00 (0.01)10.06 (0.01)8.43 (0.01)----
6. G. phillipinensis Lawrence, 19538.97 (0.01)8.99 (0.01)9.26 (0.01)9.30 (0.01)7.47 (0.01)---
7. G. treutleri sp. n.4.16 (0.01)5.09 (0.01)9.05 (0.01)5.09 (0.01)10.75 (0.01)9.94 (0.01)--
8. G. unica sp. n.0.66 (0.00)2.21 (0.01)7.05 (0.01)2.61 (0.01)8.99 (0.01)8.84 (0.01)4.05 (0.01)-
Table 7. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between 18S sequences of analysed Geckobia species. The analysis included 35 sequences.
Table 7. Kimura two-parameter distances (presented as percentages with standard error estimates in parentheses) between 18S sequences of analysed Geckobia species. The analysis included 35 sequences.
Mite Species1.2.3.4.5.6.7.8.
1. G. bataviensis Vitzhum, 1926--------
2. G. brevicephala sp. n.0.43 (0.00)-------
3. G. gigantea sp. n.0.87 (0.00)0.60 (0.00)------
4. G. indica Hirst, 19170.67 (0.00)0.24 (0.00)0.75 (0.00)-----
5. G. mysoriensis sp. n.1.75 (0.00)1.30 (0.00)1.46 (0.00)1.44 (0.00)----
6. G. phillipinensis Lawrence, 19530.98 (0.00)0.71 (0.00)0.82 (0.00)0.65 (0.00)0.73 (0.00)---
7. G. treutleri sp. n.1.22 (0.00)0.70 (0.00)1.22 (0.00)0.68 (0.00)1.72 (0.00)0.95 (0.00)--
8. G. unica sp. n.0.24 (0.00)0.18 (0.00)0.51 (0.00)0.33 (0.00)1.41 (0.00)0.77 (0.00)0.82 (0.00)-
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fajfer, M.; Karanth, P. New Morphological and Molecular Data Reveal an Underestimation of Species Diversity of Mites of the Genus Geckobia (Acariformes: Pterygosomatidae) in India. Diversity 2022, 14, 1064. https://doi.org/10.3390/d14121064

AMA Style

Fajfer M, Karanth P. New Morphological and Molecular Data Reveal an Underestimation of Species Diversity of Mites of the Genus Geckobia (Acariformes: Pterygosomatidae) in India. Diversity. 2022; 14(12):1064. https://doi.org/10.3390/d14121064

Chicago/Turabian Style

Fajfer, Monika, and Praveen Karanth. 2022. "New Morphological and Molecular Data Reveal an Underestimation of Species Diversity of Mites of the Genus Geckobia (Acariformes: Pterygosomatidae) in India" Diversity 14, no. 12: 1064. https://doi.org/10.3390/d14121064

APA Style

Fajfer, M., & Karanth, P. (2022). New Morphological and Molecular Data Reveal an Underestimation of Species Diversity of Mites of the Genus Geckobia (Acariformes: Pterygosomatidae) in India. Diversity, 14(12), 1064. https://doi.org/10.3390/d14121064

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop