Antiepileptic Effect of Neuroaid® on Strychnine-Induced Convulsions in Mice
Abstract
1. Introduction
2. Results
2.1. Effect of NeuroAid on SIC
2.2. Effect of NeuroAid Treatment on Gene Expression
2.3. Effect of NeuroAid on Histopathological Examination
3. Discussion
4. Materials and Study Design
4.1. Drugs and Chemicals
4.2. Experimental Animals
4.3. Preparation of NeuroAid Drinking Solution
4.4. Preparation of Topiramate Solution
4.5. Study Design
4.6. Induction of Epilepsy
4.7. Haematoxylin and Eosin (HE) Staining
4.8. Extraction of RNA
4.9. Real-Time PCR Analysis
4.10. Statistical Calculation and Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. “Epilepsy Fact Sheet”. Available online: https://aho.org/fact-sheets/epilepsy-fact-sheet/ (accessed on 11 March 2016).
- Chang, B.S.; Lowenstein, D.H. Epilepsy. N. Engl. J. Med. 2003, 349, 1257–1266. [Google Scholar] [CrossRef] [Scilit]
- Fisher, R.S.; Acevedo, C.; Arzimanoglou, A.; Bogacz, A.; Cross, J.H.; Elger, C.E.; Engel, J., Jr.; Forsgren, L.; French, J.A.; Glynn, M.; et al. ILAE Official Report: A practical clinical definition of epilepsy. Epilepsia 2014, 55, 475–482. [Google Scholar] [CrossRef] [Scilit]
- Wahab, A. Difficulties in Treatment and Management of Epilepsy and Challenges in New Drug Development. Pharmaceuticals 2010, 3, 2090–2110. [Google Scholar] [CrossRef] [Scilit]
- Abou-Khalil, B.; Schmidt, D. Chapter 42—Antiepileptic Drugs: Advantages and Disadvantages. In Handbook of Clinical Neurology; Stefan, H., Theodore, W.H., Eds.; Elsevier: Amsterdam, The Netherlands, 2012; Volume 108, pp. 723–739. [Google Scholar] [CrossRef] [Scilit]
- Zavvari, F.; Modarres Mousavi, S.M.; Ejlali, M.; Barfi, S.; Karimzadeh, F. Glutamate Signaling Pathway in Absence Epilepsy: Possible Role of Ionotropic AMPA Glutamate Receptor Type 1 Subunit. Iran J. Pharm. Res. 2020, 19, 410–418. [Google Scholar] [CrossRef] [Scilit]
- Hanada, T. Ionotropic Glutamate Receptors in Epilepsy: A Review Focusing on AMPA and NMDA Receptors. Biomolecules 2020, 10, 464. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.-J.; Zhang, Y.; Liang, X.-H.; Yang, G.; Zou, L.-P. Effects of adrenal dysfunction and high-dose adrenocorticotropic hormone on NMDA-induced spasm seizures in young Wistar rats. Epilepsy Res. 2012, 100, 125–131. [Google Scholar] [CrossRef] [Scilit]
- Young, S.H.; Zhao, Y.; Koh, A.; Singh, R.; Chan, B.P.; Chang, H.M.; Venketasubramanian, N.; Chen, C.; CHIMES Investigators. Safety Profile of MLC601 (Neuroaid®) in Acute Ischemic Stroke Patients: A Singaporean Substudy of the Chinese Medicine Neuroaid Efficacy on Stroke Recovery Study. Cerebrovasc. Dis. 2010, 30, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Heurteaux, C.; Gandin, C.; Borsotto, M.; Widmann, C.; Brau, F.; Lhuillier, M.; Onteniente, B.; Lazdunski, M. Neuroprotective and neuroproliferative activities of NeuroAid (MLC601, MLC901), a Chinese medicine, in vitro and in vivo. Neuropharmacology 2010, 58, 987–1001. [Google Scholar] [CrossRef] [Scilit]
- Roger, J.P.; Brian, S.M. Antiepileptic Drug. In Basic and Clinical Pharmacology; McGraw-Hill: New York City, NY, USA, 2015. [Google Scholar]
- Komali, E.; Venkataramaiah, C.; Rajendra, W. Anticonvulsant effect of Bacopa monnieri extracts on Catecholamine metabolism during PTZ-induced Epilepsy in different brain regions of Albino Rat. Res. J. Pharm. Technol. 2018, 11, 1592–1598. [Google Scholar] [CrossRef] [Scilit]
- Elvin-Lewis, M. Should we be concerned about herbal remedies. J. Ethnopharmacol. 2001, 75, 141–164. [Google Scholar] [CrossRef] [Scilit]
- Ramesh, C.G. Skeletal muscle toxicity biomarkers. In Biomarkers in Toxicology; Elsevier: Amsterdam, The Netherlands, 2014. [Google Scholar]
- Rashid, A.M.A.; Noh, M.S.F.; Khan, A.H.K.Y.; Loh, W.C.; Baharin, J.; Ibrahim, A.; Mat, L.N.I.; Sulaiman, W.A.W.; Hoo, F.K.; Hanapiah, F.A.; et al. NeuroAid II (MLC901) and polypharmacy in stroke and the risk of hepatotoxicity: A case report. Egypt. J. Neurol. Psychiatry Neurosurg. 2021, 57, 151–156. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Zhang, J.; Hong, Y.; Feng, Y.; Chen, M.; Wang, Y. Phytochemical and Pharmacological Review of Da Chuanxiong Formula: A Famous Herb Pair Composed ofChuanxiong RhizomaandGastrodiae Rhizomafor Headache. Evidence-Based Complement. Altern. Med. 2013, 2013, 425369. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.-L.; Tian, K.; Tang, Z.-H.; Chen, X.-J.; Bian, Z.-X.; Wang, Y.-T.; Lu, J.-J. Phytochemistry and Pharmacology of Carthamus tinctorius L. Am. J. Chin. Med. 2016, 44, 197–226. [Google Scholar] [CrossRef] [Scilit]
- Hussain, T.; Ahmad Baba, I.; Jain, S.M.; Bashir, A. Phytochemical Screening of Methanolic Extract of Prunus Persica. Int. J. Sci. Res. 2015, 4, 52–53. [Google Scholar] [CrossRef]
- Liao, W.-P.; Chen, L.; Yi, Y.-H.; Sun, W.-W.; Gao, M.-M.; Su, T.; Yang, S.-Q. Study of Antiepileptic Effect of Extracts from Acorus tatarinowii Schott. Epilepsia 2005, 46, 21–24. [Google Scholar] [CrossRef] [Scilit]
- Du, X.-M.; Sun, N.-Y.; Takizawa, N.; Guo, Y.-T.; Shoyama, Y. Sedative and anticonvulsant activities of goodyerin, a flavonol glycoside from Goodyera schlechtendaliana. Phytotherapy Res. 2002, 16, 261–263. [Google Scholar] [CrossRef] [Scilit]
- Choudhary, N.; Bijjem, K.R.V.; Kalia, A.N. Antiepileptic potential of flavonoids fraction from the leaves of Anisomeles malabarica. J. Ethnopharmacol. 2011, 135, 238–242. [Google Scholar] [CrossRef] [Scilit]
- Cardenas-Rodriguez, N.; Huerta-Gertrudis, B.; Rivera-Espinosa, L.; Montesinos-Correa, H.; Bandala, C.; Carmona-Aparicio, L.; Coballase-Urrutia, E. Role of Oxidative Stress in Refractory Epilepsy: Evidence in Patients and Experimental Models. Int. J. Mol. Sci. 2013, 14, 1455–1476. [Google Scholar] [CrossRef] [Scilit]
- Yadav, R.; Srivastava, P. Interaction Study of Antioxidants with Progressive Myoclonus Epilepsy by Molecular Docking Techniques. Res. J. Pharm. Technol. 2019, 12, 584–588. [Google Scholar] [CrossRef] [Scilit]
- Quintard, H.; Borsotto, M.; Veyssiere, J.; Gandin, C.; Labbal, F.; Widmann, C.; Lazdunski, M.; Heurteaux, C. MLC901, a Traditional Chinese Medicine protects the brain against global ischemia. Neuropharmacology 2011, 61, 622–631. [Google Scholar] [CrossRef] [Scilit]
- Balakrishnan, R.; Cho, D.Y.; Kim, I.S.; Seol, S.H.; Choi, D.K. Molecular Mechanisms and Therapeutic Potential of α-and β-Asarone in the Treatment of Neurological Disorders. Antioxidants 2022, 11, 281. [Google Scholar] [CrossRef] [Scilit]
- Guo, F.; Sun, F.; Yu, J.-L.; Wang, Q.-H.; Tu, D.-Y.; Mao, X.-Y.; Liu, R.; Wu, K.-C.; Xie, N.; Hao, L.-Y.; et al. Abnormal expressions of glutamate transporters and metabotropic glutamate receptor 1 in the spontaneously epileptic rat hippocampus. Brain Res. Bull. 2010, 81, 510–516. [Google Scholar] [CrossRef] [Scilit]
- Walker, M.K.; Boberg, J.R.; Walsh, M.T.; Wolf, V.; Trujillo, A.; Duke, M.S.; Palme, R.; Felton, L.A. A less stressful alternative to oral gavage for pharmacological and toxicological studies in mice. Toxicol. Appl. Pharmacol. 2012, 260, 65–69. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Venketasubramanian, N.; Gan, R.N.; Lambert, C.; Picard, D.; Chan, B.P.; Chan, E.; Bousser, M.G.; Xuemin, S. Danqi Piantang Jiaonang (DJ), a Traditional Chinese Medicine, in Poststroke Recovery. Stroke 2009, 40, 859–863. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, N.B.; Agarwal, N.K.; Mediratta, P.K.; Sharma, K.K. Effect of lamotrigine, oxcarbazepine and topiramate on cognitive functions and oxidative stress in PTZ-kindled mice. Seizure 2011, 20, 257–262. [Google Scholar] [CrossRef] [Scilit]
- Bachmanov, A.A.; Reed, D.R.; Beauchamp, G.K.; Tordoff, M.G. Food Intake, Water Intake, and Drinking Spout Side Preference of 28 Mouse Strains. Behav. Genet. 2002, 32, 435–443. [Google Scholar] [CrossRef] [Scilit]
- Olajide, A.S.; Annafi, O.S.; Umukoro, S.; Eduviere, A.T. Evaluation of the Anticonvulsant and Anxiolytic Potentials of Methyl Jasmonate in Mice. Sci. Pharm. 2014, 82, 643–654. [Google Scholar] [CrossRef] [Scilit]
- Miyakawa, N.; Uchino, S.; Yamashita, T.; Okada, H.; Nakamura, T.; Kaminogawa, S.; Miyamoto, Y.; Hisatsune, T. A glycine receptor antagonist, strychnine, blocked NMDA receptor activation in the neonatal mouse neocortex. NeuroReport 2002, 13, 1667–1673. [Google Scholar] [CrossRef] [Scilit]
- Onaka, M.; Minami, T.; Nishihara, I.; Ito, S. Involvement of Glutamate Receptors in Strychnine- and Bicuculline-induced Allodynia in Conscious Mice. Anesthesiology 1996, 84, 1215–1222. [Google Scholar] [CrossRef] [Scilit]


| Animals Group | Onset of Convulsion (min) | No. of Convulsions (per One h) | Duration of Convulsion (s) |
|---|---|---|---|
| Normal control group | 00 ± 00 | 00 ± 00 | 00 ± 00 |
| Positive control group | 4.28 ± 1.64 | 2.67 ± 1.03 | 25.00 ± 7.07 |
| NeuroAid group | 6.92 ± 2.99 | 1 ± 1.09 * | 8.16 ± 9.53 * |
| Topiramate group | 8.66 ± 5.24 | 1 ± 0.63 * | 6.68 ± 6.61 * |
| Animals Group | No. of Animals | Mortality Rate (%) | Protection Rate (%) | |
|---|---|---|---|---|
| Dead | Alive | |||
| Normal control group | 0 | 10 | 0% | 100% |
| Positive control group | 10 | 0 | 100% | 0% |
| Neuro Aid group | 4 | 6 | 40% * | 60% * |
| Topiramate group | 3 | 7 | 30% * | 70% * |
| Primers Type | 5′-3′ Gene Sequence | Length (bp) | Amplificated Fragment (bp) |
|---|---|---|---|
| GluR1 FP | CAGATCGATATTGTGAACATCA | 22 | 400 |
| GluR1 RP | CCTGAAAGAGCATCTGGTAT | 20 | |
| β-Actin FP | TACCAACCTCCTTGCAGCTCC | 20 | 800 |
| β-Actin RP | ACAATGCCGTGTTCAATGG | 19 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salim Mahmood, A.; Ammoo, A.M.; Ali, M.H.M.; Hameed, T.M.; Al-Hussaniy, H.A.; Aljumaili, A.A.A.; Al-Fallooji, M.H.A.; Kadhim, A.H. Antiepileptic Effect of Neuroaid® on Strychnine-Induced Convulsions in Mice. Pharmaceuticals 2022, 15, 1468. https://doi.org/10.3390/ph15121468
Salim Mahmood A, Ammoo AM, Ali MHM, Hameed TM, Al-Hussaniy HA, Aljumaili AAA, Al-Fallooji MHA, Kadhim AH. Antiepileptic Effect of Neuroaid® on Strychnine-Induced Convulsions in Mice. Pharmaceuticals. 2022; 15(12):1468. https://doi.org/10.3390/ph15121468
Chicago/Turabian StyleSalim Mahmood, Ahmed, Afaq M. Ammoo, Mayssam Hussein Mohammed Ali, Tiba M. Hameed, Hany A. Al-Hussaniy, Abdulla Amer Abbas Aljumaili, Mohammed Hussein Alaa Al-Fallooji, and Ali Hakim Kadhim. 2022. "Antiepileptic Effect of Neuroaid® on Strychnine-Induced Convulsions in Mice" Pharmaceuticals 15, no. 12: 1468. https://doi.org/10.3390/ph15121468
APA StyleSalim Mahmood, A., Ammoo, A. M., Ali, M. H. M., Hameed, T. M., Al-Hussaniy, H. A., Aljumaili, A. A. A., Al-Fallooji, M. H. A., & Kadhim, A. H. (2022). Antiepileptic Effect of Neuroaid® on Strychnine-Induced Convulsions in Mice. Pharmaceuticals, 15(12), 1468. https://doi.org/10.3390/ph15121468

