Effects of Casein Phosphopeptide-Selenium Complex on the Immune Functions in Beagle Dogs
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Snack
2.2. Animals and Study Design
2.3. Collection of Anticoagulated Blood and Serum
2.4. Isolation and Culture of Peripheral Blood Lymphocytes (PBL)
2.5. PBL Purity and Viability Assay
2.6. Lymphocyte Proliferation Test
2.7. Total RNA Extraction, cDNA Synthesis and RT-qPCR
2.8. ELISA Detection of Cytokines
2.9. Statistical Analysis
3. Results
3.1. The Effects of CPP-Se on the Body Weight, Liver and Kidney Functions in Dogs
3.2. The Effects of CPP-Se on the Number of Blood Immune Cells in Dogs
3.3. The Effects of CPP-Se on the Cytokine-Related mRNAs Expression of PBL in Dogs
3.4. The Effects of CPP-Se on the Content of Serum Cytokines and Immunoglobulins in Dogs
3.5. Identification of Lymphocytes
3.6. The Effects of CPP-Se on the Proliferation and Expression of Cytokine-Related mRNAs in Lymphocytes Cultured In Vitro
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hughes, M.J.; Verreynne, M.L.; Harpur, P.; Pachana, N.A. Companion animals and health in older populations: A systematic Review. Clin. Gerontol. 2020, 43, 365–377. [Google Scholar] [CrossRef] [PubMed]
- Sheikh, A.B.; Javed, N.; Leyba, K.; Khair, A.H.; Ijaz, Z.; Dar, A.A.; Hanif, H.; Farooq, A.; Shekhar, R. Pet-assisted therapy for delirium and agitation in hospitalized patients with neurocognitive impairment: A review of literature. Geriatrics 2021, 6, 96. [Google Scholar] [CrossRef] [PubMed]
- Jacob, J.; Lorber, B.; Schlossberg, D. Diseases transmitted by man’s best friend: The dog. Microbiol. Spectr. 2015, 3, 111–131. [Google Scholar] [CrossRef]
- Overgaauw, P.A.M.; Vinke, C.M.; Hagen, M.A.E.V.; Lipman, L.J.A. A one health perspective on the human-companion animal relationship with emphasis on zoonotic aspects. Int. J. Environ. Res. Public Health 2020, 17, 3789. [Google Scholar] [CrossRef] [PubMed]
- Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyorala, S.; Ruzauskas, M.; et al. Public health risk of antimicrobial resistance transfer from companion animals. J. Antimicrob. Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef]
- Mykkänen, H.M.; Wasserman, R.H. Enhanced absorption of calcium by casein phosphopeptides in rachitic and normal chicks. J. Nutr. 1980, 110, 2141–2148. [Google Scholar] [CrossRef]
- Otani, H.; Hata, I. Inhibition of proliferative responses of mouse spleen lymphocytes and rabbit Peyer’s patch cells by bovine milk caseins and their digests. J. Dairy Res. 1995, 62, 339. [Google Scholar] [CrossRef]
- Hata, I.; Higashiyama, S.; Otani, H. Identification of a phosphopeptide in bovine casein digest as a factor influencing proliferation and immunoglobulin production in lymphocyte cultures. J. Dairy Res. 1998, 65, 569–578. [Google Scholar] [CrossRef]
- Hata, I.; Ueda, J.; Otani, H. Immunostimulatory action of a commercially available casein phosphopeptide preparation, CPP-III, in cell cultures. Milchwissenschaft 1999, 54, 3–6. [Google Scholar]
- Otani, H.; Kitamura, H.; Park, M.; Kihara, Y.; Sawada, K. Enhancement of intestinal IgA levels in piglets by oral administration of a commercially available casein phosphopeptide preparation. Milchwissenshaft 2000, 55, 429–432. [Google Scholar]
- Kitamura, H.; Yamakawa, C.; Sakashita, M.; Oshida, T.; Kusuhara, S.; Otani, H.; Itoh, S. Effects of casein phosphopeptide (CPP-I) on immunity system of pregnancy sow and body weight gain of their piglets. Bull. Anim. Hyg. 2002, 28, 25–30. [Google Scholar]
- Kitamura, H.; Oshida, T.; Otani, H.; Wakaduki, S.; Kusuhara, S. Milk immunoglobulin levels in sows given a diet containing a commercially available casein phosphopeptide preparation (CPP-I) during pregnancy. Milchwissenschaft 2002, 57, 486–489. [Google Scholar]
- Tobita, K.; Kawahara, T.; Otani, H. Bovine beta-casein (1-28), a casein phosphopeptide, enhances proliferation and IL-6 expression of mouse CD19+ cells via Toll-like receptor 4. J. Agric. Food Chem. 2006, 54, 8013–8017. [Google Scholar] [CrossRef] [PubMed]
- Otani, H.; Nakano, K.; Kawahara, T. Stimulatory effect of a dietary casein phosphopeptide preparation on the mucosal IgA response of mice to orally ingested lipopolysaccharide from Salmonella typhimurium. Biosci. Biotechnol. Biochem. 2003, 67, 729–735. [Google Scholar] [CrossRef] [PubMed]
- Otani, H.; Watanabe, T.; Tashiro, Y. Effects of bovine beta-casein (1-28) and its chemically synthesized partial fragments on proliferative responses and immunoglobulin production in mouse spleen cell cultures. Biosci. Biotechnol. Biochem. 2001, 65, 2489–2495. [Google Scholar] [CrossRef][Green Version]
- Otani, H.; Kihara, Y.; Park, M. The immunoenhancing property of a dietary casein phosphopeptide preparation in mice. Food Agric. Immunol. 2010, 12, 165–173. [Google Scholar] [CrossRef]
- Kitts, D.D.; Nakamura, S. Calcium-enriched casein phosphopeptide stimulates release of IL-6 cytokine in human epithelial intestinal cell line. J. Dairy Res. 2006, 73, 44–48. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, R.; Meisel, H. Cytochemical assessment of phosphopeptides derived from casein as potential ingredients for functional food. Nahrung 2002, 46, 427. [Google Scholar] [CrossRef]
- Kitamura, H.; Otani, H. Fecal IgA levels in healthy persons who ingested cakes with or without bovine casein phosphopeptides. Milchwissenschaft 2002, 57, 611–614. [Google Scholar]
- Kawahara, T.; Otani, H. Stimulatory effects of casein phosphopeptide (CPP-III) on mRNA expression of cytokines in Caco-2 cells. Biosci. Biotechnol. Biochem. 2004, 68, 1779–1781. [Google Scholar] [CrossRef]
- Taylor, E.W. Selenium and cellular immunity. Evidence that selenoproteins may be encoded in the +1 reading frame overlapping the human CD4, CD8, and HLA-DR genes. Biol. Trace Elem. Res. 1995, 49, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Qian, F.; Misra, S.; Prabhu, K.S. Selenium and selenoproteins in prostanoid metabolism and immunity. Crit. Rev. Biochem. Mol. Biol. 2019, 54, 484–516. [Google Scholar] [CrossRef] [PubMed]
- Avery, J.C.; Hoffmann, P.R. Selenium, selenoproteins, and immunity. Nutrients 2018, 10, 1203. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.M.; Dong, Y.P.; Chen, S.R.; Jia, X.L.; Jiang, X.M.; Che, L.Q.; Lin, Y.; Li, J.; Feng, B.; Fang, Z.F.; et al. Organic selenium increased gilts antioxidant capacity, immune function, and changed intestinal microbiota. Front. Microbiol. 2021, 12, 723190. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Chen, D.W.; Yu, B.; Luo, Y.H.; Huang, Z.Q.; Zheng, P.; Mao, X.B.; Yu, J.; Luo, J.Q.; Yan, H.; et al. Influences of selenium-enriched yeast on growth performance, immune function, and antioxidant capacity in weaned pigs exposure to oxidative stress. Biomed. Res. Int. 2021, 2021, 5533210. [Google Scholar] [CrossRef]
- Song, K.D.; Dowd, S.E.; Lee, H.K.; Kim, S.W. Long-term dietary supplementation of organic selenium modulates gene expression profiles in leukocytes of adult pigs. Anim. Sci. J. 2013, 84, 238–246. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.Z.; Maddox, J.F.; Mastro, A.M.; Scholz, R.W.; Hildenbrandt, G.; Reddy, C.C. Selenium deficiency alters the lipoxygenase pathway and mitogenic response in bovine lymphocytes. J. Nutr. 1992, 122, 2121–2127. [Google Scholar] [CrossRef]
- Pollock, J.M.; McNair, J.; Kennedy, S.; Kennedy, D.G.; Walsh, D.M.; Goodall, E.A.; Mackie, D.P.; Crockard, A.D. Effects of dietary vitamin E and selenium on in vitro cellular immune responses in cattle. Res. Vet. Sci. 1994, 56, 100–107. [Google Scholar] [CrossRef]
- Blazejak-Grabowska, J.; Milewski, S.; Zabek, K.; Sobiech, P.; Wojcik, R.; Zarczynska, K.; Micinski, J. Effect of long-acting selenium preparation on health and productivity of sheep. Animals 2022, 12, 140. [Google Scholar] [CrossRef]
- Adegoke, E.O.; Wang, X.; Wang, H.; Wang, C.; Zhang, H.; Zhang, G.X. Selenium (Na2SeO3) upregulates expression of immune genes and blood-testis barrier constituent proteins of bovine sertoli cell in vitro. Biol. Trace Elem. Res. 2018, 185, 332–343. [Google Scholar] [CrossRef]
- Wang, Y.; Cui, X.M.; Yuan, L.J.; Maqbool, B.; Hu, S.S.; Guan, R.; Hu, S. A solution with Ginseng Saponins and selenium as vaccine diluent to increase Th1/Th2 immune responses in mice. J. Immunol. Res. 2020, 2020, 2714257. [Google Scholar] [CrossRef] [PubMed]
- Kandil, O.M.; Abou-Zeina, H.A. Effect of parenteral vitamin E and selenium supplementation on immune status of dogs vaccinated with subunit and somatic antigens against Taenia hydatigena. J. Egypt. Soc. Parasitol. 2005, 35, 537–550. [Google Scholar] [PubMed]
- Lessard, M.; Yang, W.C.; Elliott, G.S.; Deslauriers, N.; Brisson, G.J.; Van Vleet, J.F.; Schultz, R.D. Suppressive effect of serum from pigs and dogs fed a diet deficient in vitamin E and selenium on lymphocyte proliferation. Vet. Res. 1993, 24, 291–303. [Google Scholar]
- Zheng, W.B.; Zou, Y.; Elsheikha, H.M.; Liu, G.H.; Hu, M.H.; Wang, S.L.; Zhu, X.Q. Serum metabolomic alterations in Beagle dogs experimentally infected with Toxocara canis. Parasites Vectors 2019, 12, 447. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.H.; Hwang, K.A.; Kang, J.H.; Choi, K.C. Effect of Achyranthes japonica Nakai extract on immunity and anti-inflammation in dogs. Can. J. Vet. Res. 2020, 84, 294–301. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2013, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Swecker, W.S.; Thatcher, C.D.; Eversole, D.E.; Blodgett, D.J.; Schurig, G.G. Effect of selenium supplementation on colostral IgG concentration in cows grazing selenium-deficient pastures and on postsuckle serum IgG concentration in their calves. Am. J. Vet. Res. 1995, 56, 450. [Google Scholar] [PubMed]
- Steinbrenner, H.; Al-Quraishy, S.; Dkhil, M.A.; Wunderlich, F.; Sies, H. Dietary selenium in adjuvant therapy of viral and bacterial infections. Adv. Nutr. 2015, 6, 73–82. [Google Scholar] [CrossRef] [PubMed]
- Kiremidjian-Schumacher, L.; Roy, M. Selenium and immune function. Z. Ernahrungswiss. 1998, 37 (Suppl. S1), 50. [Google Scholar]
- Baum, M.K.; Miguez-Burbano, M.J.; Campa, A.; Shor-Posner, G. Selenium and interleukins in persons infected with human immunodeficiency virus type 1. J. Infect. Dis. 2000, 182 (Suppl. S1), S69–S73. [Google Scholar] [CrossRef] [PubMed]
- Barta, O.; Oyekan, P.P. Lymphocyte transformation test in veterinary clinical immunology. Comp. Immunol. Microbiol. Infect. Dis. 1981, 4, 209–221. [Google Scholar] [CrossRef]
- Caren, L.D.; Elgert, K.D. Immunology: Understanding the immune system. BioScience 1996, 46, 788. [Google Scholar] [CrossRef]
- Dinarello, C.A. Proinflammatory cytokines. Chest 2000, 118, 503–508. [Google Scholar] [CrossRef]
- Roomruangwong, C.; Kanchanatawan, B.; Sirivichayakul, S.; Anderson, G.; Carvalho, A.F.; Duleu, S.; Geffard, M.; Maes, M. IgA/IgM responses to gram-negative bacteria are not associated with perinatal depression, but with physio-somatic symptoms and activation of the tryptophan catabolite pathway at the end of term and postnatal anxiety. CNS Neurol. Disord. Drug Targets 2017, 16, 472–483. [Google Scholar] [CrossRef]
- Stabel, J.R.; Reinhardt, T.A.; Nonnecke, B.J. Effect of selenium and reducing agents on in vitro immunoglobulin M synthesis by bovine lymphocytes. J. Dairy Sci. 1991, 74, 2501–2506. [Google Scholar] [CrossRef]
- Van Kampen, C.; Gauldie, J.; Collins, S.M. Proinflammatory properties of IL-4 in the intestinal microenvironment. Am. J. Physiol. Gastrointest. Liver Physiol. 2005, 288, G111–G117. [Google Scholar] [CrossRef] [PubMed]
- Njoku, D.B. Suppressive and pro-inflammatory roles for IL-4 in the pathogenesis of experimental drug-induced liver injury: A review. Expert Opin. Drug Metab. Toxicol. 2010, 6, 519–531. [Google Scholar] [CrossRef]
- Brown, M.A.; Hural, J. Functions of IL-4 and control of its expression. Crit. Rev. Immunol. 2017, 37, 181–212. [Google Scholar] [CrossRef]
- Estes, D.M. Differentiation of B cells in the bovine. Role of cytokines in immunoglobulin isotype expression. Vet. Immunol. Immunopathol. 1996, 54, 61–67. [Google Scholar] [CrossRef]
- Aarden, L.A.; van Kooten, C. The action of interleukin 6 on lymphoid populations. Ciba Found. Symp. 1992, 167, 68–74. [Google Scholar]
- Parzmair, G.P.; Gereke, M.; Haberkorn, O.; Annemann, M.; Podlasly, L.; Kliche, S.; Reinhold, A.; Schraven, B.; Bruder, D. ADAP plays a pivotal role in CD4+ T cell activation but is only marginally involved in CD8+ T cell activation, differentiation, and immunity to pathogens. J. Leukoc. Biol. 2017, 101, 407–419. [Google Scholar] [CrossRef] [PubMed]
- Miceli, M.C.; von Hoegen, P.; Parnes, J.R. Adhesion versus coreceptor function of CD4 and CD8: Role of the cytoplasmic tail in coreceptor activity. Proc. Natl. Acad. Sci. USA 1991, 88, 2623–2627. [Google Scholar] [CrossRef] [PubMed]
- Allam, A.; Illges, H. Calyculin A inhibits expression of CD8alpha but not CD4 in human peripheral blood T cells. Immunobiology 2000, 202, 353–362. [Google Scholar] [CrossRef]
- Lyons, G.E.; Moore, T.; Brasic, N.; Li, M.; Roszkowski, J.J.; Nishimura, M.I. Influence of human CD8 on antigen recognition by T-cell receptor-transduced cells. Cancer Res. 2006, 66, 11455–11461. [Google Scholar] [CrossRef]
- Miceli, M.C.; Parnes, J.R. Role of CD4 and CD8 in T cell activation and differentiation. Adv. Immunol. 1993, 53, 59–122. [Google Scholar]
- Day, M.J. Ageing, immunosenescence and inflammageing in the dog and cat. J. Comp. Pathol. 2010, 142 (Suppl. S1), S60–S69. [Google Scholar] [CrossRef]
- Nicholls, P.K.; Stanley, M.A. The immunology of animal papillomaviruses. Vet. Immunol. Immunopathol. 2000, 73, 101–127. [Google Scholar] [CrossRef]
- Toepp, A.J.; Petersen, C.A. The balancing act: Immunology of leishmaniosis. Res. Vet. Sci. 2020, 130, 19–25. [Google Scholar] [CrossRef]
- Dimri, U.; Singh, S.K. The immuno-pathological conversions of canine demodicosis. Vet. Parasitol. 2014, 203, 1–5. [Google Scholar]
- Barbiéri, C.L. Immunology of canine leishmaniasis. Parasite Immunol. 2006, 28, 329–337. [Google Scholar] [CrossRef]
- Hauck, V.; Hugli, P.; Meli, M.L.; Rostaher, A.; Fischer, N.; Hofmann-Lehmann, R.; Favrot, C. Increased numbers of FoxP3-expressing CD4+ CD25+ regulatory T cells in peripheral blood from dogs with atopic dermatitis and its correlation with disease severity. Vet. Dermatol. 2016, 27, 26-e9. [Google Scholar] [CrossRef] [PubMed]
- Cortese, L.; Annunziatella, M.; Palatucci, A.T.; Rubino, V.; Piantedosi, D.; Di Loria, A.; Ruggiero, G.; Ciaramella, P.; Terrazzano, G. Regulatory T cells, Cytotoxic T lymphocytes and a T(H)1 cytokine profile in dogs naturally infected by Leishmania infantum. Res. Vet. Sci. 2013, 95, 942–949. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequences (5′→3′) | Tm (°C) | Size (bp) | Accession ID |
---|---|---|---|---|
GAPDH | F: GTCCCCACCCCCAATGTATC | 60.0 | 128 | NM_001003142 |
R: GTGTAGCCCAGGATGCCTTT | ||||
IL-4 | F: GCTCCAAAGAACACAAGCGA | 60.0 | 136 | NM_001003159 |
R: AGGTCTTGTTTGCCATGCTG | ||||
IL-6 | F: TCCTGGTGATGGCTACTGCTT | 60.0 | 78 | NM_001003301 |
R: GACTATTTGAAGTGGCATCATCCTT | ||||
IL-10 | F: ACCACGACCCAGACATCAAG | 60.0 | 127 | NM_001003077 |
R: TCCACCGCCTTGCTCTTATT | ||||
IL-1β | F: ATATGAGCTTCGGGCTCTCC | 60.0 | 174 | NM_001037971 |
R: TGTAGGGTGGGCTTTCCATC | ||||
TNF-α | F: ACCTACTCTCTGCCATCAAGAGC | 60.0 | 122 | NM_001003244 |
R: GAGTCGATCACCCTTCTCCAGT | ||||
IFN-γ | F: TCCAGCGCAAGGCGATAAAT | 60.0 | 106 | NM_001003174 |
R: CTGCGGCCTCGAAACAGATT | ||||
CD4 | F: CCAGAGCCAGAAGACAGTGG | 60.0 | 190 | NM_001003252 |
R: GATCCAGAGCAAGGACGAGG | ||||
CD8α | F: AAGTGGGTTAGACTTCGCCTG | 60.0 | 119 | NM_001002935 |
R: CACGTCTTCTGTTCCTGTGGT |
Number (×109/L) | Groups | Feeding Days | |||
---|---|---|---|---|---|
0 d | 10 d | 20 d | 30 d | ||
Lymphocytes | Control | 2.94 ± 0.15 | 2.87 ± 0.23 a | 2.41 ± 0.27 a | 2.38 ± 0.32 A |
CPP-Se | 3.13 ± 0.17 | 4.02 ± 0.27 b | 5.90 ± 0.81 b | 3.78 ± 0.27 B | |
Monocytes | Control | 0.46 ± 0.03 | 0.41 ± 0.05 | 0.46 ± 0.04 | 0.48 ± 0.04 |
CPP-Se | 0.43 ± 0.05 | 0.47 ± 0.04 | 0.54 ± 0.07 | 0.50 ± 0.05 | |
Neutrophils | Control | 7.71 ± 0.19 | 7.20 ± 0.41 | 7.37 ± 0.40 | 7.38 ± 0.46 |
CPP-Se | 7.83 ± 0.59 | 7.65 ± 0.67 | 8.02 ± 0.62 | 8.38 ± 0.80 |
Content | Groups | Feeding Days | |||
---|---|---|---|---|---|
0 d | 10 d | 20 d | 30 d | ||
IgM (μg/mL) | Control | 50.79 ± 6.06 | 51.30 ± 7.23 | 49.73 ± 3.66 A | 54.65 ± 4.07 A |
CPP-Se | 54.16 ± 6.09 | 53.14 ± 1.99 | 204.32 ± 29.14 B | 411.24 ± 55.35 B | |
IgG (μg/mL) | Control | 2.51 ± 0.17 | 2.40 ± 0.17 | 2.48 ± 0.11 | 2.19 ± 0.11 |
CPP-Se | 2.48 ± 0.20 | 2.08 ± 0.49 | 2.25 ± 0.18 | 2.15 ± 0.11 | |
IL-6 (pg/mL) | Control | 131.81 ± 2.71 | 126.59 ± 7.44 a | 133.28 ± 7.84 A | 132.62 ± 9.35 A |
CPP-Se | 139.18 ± 17.67 | 249.98 ± 38.16 b | 464.71 ± 40.88 B | 389.84 ± 52.81 B | |
IL-4 (pg/mL) | Control | 11.29 ± 0.73 | 12.99 ± 2.44 A | 15.41 ± 4.21 A | 12.97 ± 1.52 a |
CPP-Se | 11.61 ± 0.72 | 41.73 ± 3.76 B | 68.11 ± 6.77 B | 80.48 ± 17.56 b | |
IFN-γ (pg/mL) | Control | 23.35 ± 1.74 | 23.84 ± 1.40 | 23.68 ± 1.60 a | 24.13 ± 2.16 A |
CPP-Se | 23.17 ± 2.05 | 26.06 ± 2.25 | 38.34 ± 4.78 b | 78.88 ± 7.07 B |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, W.; Xu, L.; Cao, Y.; Liu, G.; Lin, Q.; Mao, X. Effects of Casein Phosphopeptide-Selenium Complex on the Immune Functions in Beagle Dogs. Animals 2022, 12, 2037. https://doi.org/10.3390/ani12162037
Wang W, Xu L, Cao Y, Liu G, Lin Q, Mao X. Effects of Casein Phosphopeptide-Selenium Complex on the Immune Functions in Beagle Dogs. Animals. 2022; 12(16):2037. https://doi.org/10.3390/ani12162037
Chicago/Turabian StyleWang, Wencan, Ling Xu, Yong Cao, Guo Liu, Qianru Lin, and Xin Mao. 2022. "Effects of Casein Phosphopeptide-Selenium Complex on the Immune Functions in Beagle Dogs" Animals 12, no. 16: 2037. https://doi.org/10.3390/ani12162037
APA StyleWang, W., Xu, L., Cao, Y., Liu, G., Lin, Q., & Mao, X. (2022). Effects of Casein Phosphopeptide-Selenium Complex on the Immune Functions in Beagle Dogs. Animals, 12(16), 2037. https://doi.org/10.3390/ani12162037