Next Article in Journal
Ubuntu Is a Critical Component in the Fight against Human Immunodeficiency Virus and Tuberculosis Stigma: Nursing Students’ Perceptions
Previous Article in Journal
Sibling Violence and Bullying Behaviors in Peers: The Mediational Role of Self-Esteem
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of the Performance of Rapid Diagnostic Tests for Malaria Diagnosis and Mapping of Different Plasmodium Species in Mali

1
Institut Hospitalo-Universitaire Méditerranée Infection (IHU), Aix Marseille Université, 13005 Marseille, France
2
Aix-Marseille University, IRD, AP-HM, SSA, VITROME, 13005 Marseille, France
3
Programme National de Lutte Contre le Paludisme (PNLP), Bamako BP 233, Mali
4
Malaria Research and Training Center (MRTC), FMOS-FAPH, Mali-NIAID-ICER, Université des Sciences, des Techniques et des Technologies de Bamako, Bamako BP 1805, Mali
5
Laboratoire de Biologie Moléculaire Appliquée (LBMA), Université des Sciences, des Techniques et des Technologies de Bamako, Badalabougou, Bamako BP 423, Mali
*
Author to whom correspondence should be addressed.
Int. J. Environ. Res. Public Health 2024, 21(2), 228; https://doi.org/10.3390/ijerph21020228
Submission received: 20 November 2023 / Revised: 9 February 2024 / Accepted: 11 February 2024 / Published: 15 February 2024

Abstract

:
Background: The first-line diagnosis of malaria in Mali is based on the use of rapid diagnostic tests (RDT) that detect the Histidin Rich Protein 2 (HRP2) antigen specific to Plasmodium falciparum. Our study, based on a real-time polymerase chain reaction (qPCR) gold standard, aimed to describe the distribution of the Plasmodium species in each administrative region of Mali and to assess the performance of RDTs. Methods: We randomly selected 150 malaria-negative and up to 30 malaria-positive RDTs in 41 sites distributed in 9 regions of Mali. DNA extracted from the RDT nitrocellulose strip was assayed with a pan-Plasmodium qPCR. Positive samples were then analyzed with P. falciparum-, P. malariae-, P. vivax-, or P. ovale-specific qPCRs. Results: Of the 1496 RDTs, 258 (18.6%) were positive for Plasmodium spp., of which 96.9% were P. falciparum. The P. vivax prevalence reached 21.1% in the north. RDT displayed acceptable diagnostic indices; the lower CI95% bounds of Youden indices were all ≥0.50, except in the north (Youden index 0.66 (95% CI [0.44–0.82]) and 0.63 (95% CI [0.33–0.83]. Conclusions: Overall, RDT diagnostic indices are adequate for the biological diagnosis of malaria in Mali. We recommend the use of RDTs detecting P. vivax-specific antigens in the north.

1. Introduction

Despite numerous efforts, malaria remains a major public health problem around the world [1]. According to the latest estimates of the World Health Organization published in December 2022, there were 247 million cases of malaria in 2021 versus 245 million in 2020 [2]. About 619,000 deaths were attributed to this disease in 2021 versus 625,000 deaths in 2020 [1].
The WHO African region alone will account for over 95% of all malaria cases and 96% of all deaths attributable to malaria in 2021. Four African countries account for almost half of all malaria cases worldwide: Nigeria (26.6%), the Democratic Republic of Congo (12.3%), Uganda (5.1%) and Mozambique (4.1%) [1]. Children under five years of age are the most vulnerable targets affected by malaria, constituting 80% of all malaria cases and 96% of all malaria deaths in 2021 [1]. Mali is one of the countries with the highest number of cases and associated deaths. The malaria case fatality was estimated to be 1.25‰ or 1498 deaths out of 1,197,864 confirmed severe cases. However, malaria remains a major public health concern as it represents one of the main reasons for medical visit in public health facilities with a morbidity rate of 34% and mortality rate of 22% [3].
Children under 5 and pregnant women are the most affected [3]. The main species encountered were Plasmodium falciparum (over 85%), Plasmodium malariae (10–15%) and Plasmodium ovale (1%) [4]. P. falciparum causes severe and complicated forms of malaria and has a high fatality rate [4]. Notably, cases of Plasmodium vivax have been documented in Mali [5,6].
In 2018, the prevalence of malaria in children aged 6–59 months was 19% according to RDT results. The highest prevalences were found in the regions of Sikasso, Segou, Mopti, and Koulikoro (30%, 26%, 25% and 22%, respectively). The prevalence was low, between 1 and 10% in the regions of Kidal, Taoudenit, and Timbuktu and <1% in the district of Bamako. In the north region, the malaria prevalence in Gao and Menaka was >10% [7]. The infant and child mortality was 101‰ [7]. In 2021, an RDT test-based Malaria Indicator Survey in Mali (MIS 2021) reported a stable 19.4% national prevalence among children aged 6–59 months [8]. Despite the great efforts made by the State and its partners, the 125‰ malaria incidence remains below the expected target of 81‰ in Mali following the DHIS2 2020 (District Health Information Software) [3].
The national malaria control policy in Mali is in line with several international initiatives [9] aiming to “Roll Back Malaria” [10]. Case management through early diagnosis and effective treatment remain the cornerstone of the fight against this disease.
To diagnose suspected cases of malaria, Mali uses microscopic examination of thick and thin blood smears and/or RDTs based on lateral flow immunochromatography [11]. The introduction of RDTs as a diagnostic tool for malaria between 2005 and 2009 has greatly improved the quality of malaria case management in Mali. The proportion of suspected cases who received a biological diagnosis by RDT was 87% and RDTs remain the most widely used tool in health facilities [12].
The RDT is based on the detection of the antigen Histidin Rich Protein 2 (HRP2) antigen in the blood, specific to Plasmodium falciparum, which is the most prevalent species in Mali [11]. It is most frequently used in primary healthcare facilities and at the community level by community health workers (CHWs) because of its easy handling [13,14]. It is advantageous in providing results within 15 min and discriminating malaria from non-malaria fevers through the detection of at least one specific antigen. The most used antibodies react to HRP2; other antigens, namely aldolase and plasmodial lactate dehydrogenase (pLDH), are less frequently used. Proper use of RDTs should optimize malaria diagnosis and avoid antimalarial drug resistance; however, the increase in false-negative RDT results poses a new challenge to malaria control [15,16]. Malaria RDT false-negative results can be explained by asymptomatic malaria with parasite densities below the RDTs’ limit of detection [17,18]. Another explanation is the increasingly reported deletion of the PfHRP2/3 genes encoding the HRP2 protein. Whatever the cause, false-negative RDT results in untreated patients who carry parasites, which maintain malaria transmission [19]. All of these issues are a serious threat to National Malaria Control Program (NMCP) [20]. PCR-based diagnostic tests display improved sensitivity, specificity for Plasmodium species detection and identification. PCRs detect mixed infections more accurately than traditional methods [21,22]. Although the PCR is not currently optimized for routine diagnosis, it is of major importance in epidemiological studies [23].
However, studies conducted in northern and central Mali have documented other species of Plasmodium such as P. malariae, P. vivax, and P. ovale with a prevalence ranging from 1 to 20% [5,6]. In the context of strengthened malaria control policies and the emergence of Plasmodium species other than Plasmodium falciparum, the present study aimed to provide useful information on (i) the distribution of different Plasmodium species in Mali and (ii) the performance of rapid diagnostic tests compared with qPCR.

2. Methods

2.1. Study Sites

Mali is a landlocked country in West Africa located between the 10- and 25-degree north latitudes and between the 4- and 12-degree west longitudes. It covers a 1,241,238 km2 area. Malaria is generally endemic in most parts of Mali, with a recrudescence during the rainy season [24]. The level of malaria endemicity in Mali varies from one eco-climatic region to the other. Factors responsible for variations in endemicity include rainfall, altitude, temperature, hydro-agricultural development and urbanization [24]. There are 3 climatic zones in Mali that extend from south to north: the Sudano-Guinean zone, which covers 25% of the territory and has a rainfall of approximately 1300 to 1500 mm per year; the Sahelian zone, which covers 50% of the territory and receives rainfall of 200 to 800 mm per year; and the Saharan desert zone, which represents 25% of the territory. This zone is marked by irregular rainfall, often less than 200 mm per year. For this study, we collected RDT cassettes from 41 sites in the following regions of Mali: Kayes, Koulikoro, Sikasso, Ségou, Mopti, Timbuktu, Gao, Kidal and Menaka, from June to December 2021. No sample was collected in the Taoudeni region or the capital city Bamako.

2.2. Study Design

2.2.1. Rapid Diagnostic Test (RDT)

In Mali, the purchase and distribution of rapid diagnostic tests is an essential part of the master plan for the supply and distribution of essential medicines (SDADME). To control consumption needs and guarantee their availability and quality, they are managed similarly to other medicines, by using the same management tools. Decision No. 2011-774/MS-SG of 11 July 2011 made their application mandatory. Its objective is to ensure the correct supply of health products to the population by the Popular Pharmacy of Mali (PPM), which is the State’s preferred tool for the supply, storage and distribution of health products through a State-PPM contract plan. This system is supplemented by the private sector through the Private Import and Wholesale Establishments (EPIWG) of approved private suppliers of pharmaceutical products. The RDTs used in our study sites were the SD Bioline Pf Ag (Standard Diagnostics, Inc, 05FK50), Adv Dx Malaria Pf Ag HRP2 (J. Mitra & Co. Pvt. Ltd, IR016025), which both detect the P. falciparum specific Histidin-rich Protein 2; and First Response Malaria Ag pLDH/HRP2 (Premier Medical Corporation Ltd, I16FRC25), which detects the protein Lactate Dehydrogenase (pLDH) of P. falciparum and screens for other Plasmodium species (Pan). RDTs were performed by health workers to reach a diagnosis of malaria in febrile outpatients presenting at health facilities (Figure 1). They were selected proportionally to the different collection sites in the region before including positive and negative RDTs.

2.2.2. Inclusion and Exclusion Criteria

Our study included RDT cassettes that were either negative for P. falciparum, with a single band visible in the control window “C” Test, or positive for P. falciparum, with a band both in the “C” control and in the “T” test windows. RDT cassettes with no band in the “C” control window were excluded.

2.2.3. DNA Extraction Technique

The selected RDT cassettes were opened under a Type 2 Microbiological Safety Station (MSS) using a dissecting needle (LANCEOLEE Models LT2304, Pakistan), dissecting forceps, and a pair of scissors. The nitrocellulose tape was removed from the plastic cassette and then cut into small 3 × 3 mm pieces using scissors for each sample. The scissors were decontaminated between each sample with 70° ethanol [25]. The cut nitrocellulose samples were then introduced into 1.5mL collection tubes for incubation at room temperature in 400 µL of Nuclisens EasyMag Lysis Buffer (bioMérieux, Craponne, France). The tubes were then centrifuged for 2 min at 13,000 rpm using Lyse&Spin basket tubes (Qiagen, Courtaboeuf, France) to retain the nitrocellulose pieces and carry out extraction of the filtrate. DNA was extracted from 200 µL of the filtrate following the DNA Blood EZI Advanced XL protocol (QIAGEN Instruments Hombrechtikon, Switzerland), with a final elution volume of 50 µL. Random samples were assayed using a Qubit fluorometer (QUBIT2.0, Life Technologies Villebon sur Yvette, France) to control the DNA extraction quality. The DNA was then stored at −20 °C.

2.2.4. Plasmodium Species Detection by qPCR

DNA extracted from the nitrocellulose strip of malaria-positive and malaria-negative RDT cassettes were first subjected to pan-Plasmodium qPCR. In a second step, only the samples that were positive were tested with qPCR systems specific for P. falciparum, P. malariae, P. vivax, or P. ovale to identify the Plasmodium species [26]. For the amplification reactions, we used 100 μL of Roche Mix (Roche diagnostics GmbH, Mannheim, Germany), 18 μL of each primer (forward and reverse), 12 μL of probe (Var ATS Probe) and 2 μL of distilled water. Then, 20 μL of this mix plus 2 μL of added DNA were distributed in the plate. For the first (pan-Plasmodium) qPCR, the samples were deposited in duplicate with three negative controls and one positive control. The PCR conditions are summarized in (Table 1). Real-time PCRs were performed on a CFX96 (BIO-RAD, Marnes-la-Coquette, France) or LightCycler480 II (384-well) (Roche Diagnostic International Ltd, Rotkreuz, Switzerland) thermocycler. The amplification reaction program for the identification of the plasmodial species was as follows: 2 min at 50 °C, 5 min at 95 °C, 45 cycles (10 s at 95 °C, 30 s at 54 °C, 1 min at 60 °C), and 30 s at 40 °C [27]. Several negative controls and a positive control for each species were included in each PCR plate. Samples with an amplification threshold (Ct) value less than 39 were considered positive.

2.2.5. Case Definition

We considered the Plasmodium-specific PCR assay as the malaria diagnosis gold standard. Irrespective of the result, a malaria case had to display a positive Plasmodium-specific PCR result. True positive = (positive RDT/positive qPCR), false positive = (positive RDT/negative qPCR); false negative = (negative test/positive qPCR), true negative = (negative RDT/negative qPCR). Sensitivity was the proportion of positive RDT among the positive qPCR malaria cases. Specificity was the proportion of negative RDT among the negative qPCR non-malaria cases.

2.3. Data Analyses

Data were processed in Excel (version 2013) and analyzed using JavaStat 2-way contingency table analysis [28]. The diagnostic performance of malaria RDTs was determined via sensitivity (Se), specificity (Sp), and Youden and Kappa indices, each with their 95% confidence intervals (CI95%). The agreement between the two diagnostic methods was estimated using Cohen’s Kappa index [29]. The Kappa index indicates strong agreement when greater than 0.8 and poor agreement when less than 0.53. The Youden index (Y = Se + Sp − 1) combines both sensitivity and specificity to assess the validity of a diagnostic test.

2.4. Ethical Considerations

Our study was authorized by the National Malaria Control Program (number 042/MSDS-SG/NMCP, 4 February 2023), in accordance with Malian regulations on ethics and medical research.

3. Results

During the study period, 3338 malaria RDT cassettes were collected from 41 Health facilities in the 9 regions of Mali, of which 1019 (30.5%) were positive (Table 2). In Table 2, the number of RDTs and the prevalence of positive RDTs for malaria is detailed in each study site. Overall, 3338 RDT cassettes were collected, of which 69.5 tested malaria negative Table S1.
We then randomly selected 30 positive and 150 negative RDTs in each administrative region for further qPCR analyses, except in two regions, namely Menaka and Kidal, where all positive tests (21 and 29 for Menaka and Kidal, respectively) and all negative tests (n = 36) in Menaka were included. Among the 1502 malaria RDT cassettes selected, 6 RDTs were excluded as invalid, 260 were positive and 1236 negative for malaria. All 1496 RDTs were further analyzed using Plasmodium spp. qPCR. Among them, 258 had a positive Plasmodium spp. qPCR. Among these 258 Plasmodium-positive samples, 251 (96.9%) were positive for P. falciparum, 5 (1.9%) for P. vivax and 2 (0.8%) for P. malariae (Figure 2). We detected two cases of mixed infections, where P. falciparum was combined either with P. vivax or P. malariae, in Kidal or Koulikoro, respectively (Table 3).
The P. falciparum distribution was ubiquitous with a prevalence ranging from 78.9% to 100% of the positive PCRs, depending on the region. P. vivax was identified in 21.1% (4/19) and 4.3% (1/23) of the positive PCRs in Menaka and Kidal, respectively. P. malariae was identified in 2.9% (1/34) and 3.4% (1/29) of the positive PCRs in Mopti and Koulikoro, respectively. P. ovale was detected in none of our samples. Remarkably, we identified two cases of P. vivax, for example, in Menaka (4) (Figure 3) and Kidal (1), on negative RDTs, which only detected the HPR2 antigen specific to P. falciparum.
We observed 77 discordant RDT results, namely 14.3% (37/258) false-positive and 3.0% (40/1236) false-negative results.
We observed both the high sensitivity (Se) (96.6%) and high specificity (Sp) (98.7%) of the RDTs in the Koulikoro region. In contrast, Se and Sp were lowest in the Kidal (73.9% and 92.4%, respectively) and Menaka (78.9% and 84.2%, respectively) regions. The Youden and Cohen’s Kappa indices of RDTs in each region are detailed in Table 4. Overall, RDTs displayed acceptable diagnostic indices. The lower bounds of the 95% confidence intervals (95%CI) of Cohen’s Youden and Kappa indices were all≥ 0.50, except in the Kidal and Menaka regions, where the Youden and Kappa indices were 0.66 (95% CI [0.44–0.82]) and 0.60 (95% CI [0.40–0.74], 0.63 (95% CI [0.33–0.83] and 0.62 (95% CI [0.32–0.80], respectively.

4. Discussion

Our findings confirm that P. falciparum is the most prevalent species overall in Mali. Yet, this study’s key finding is that non-Plasmodium species are also endemic, notably P. vivax in the northern region of Mali. Remarkably, we observed markedly lower diagnostic indices of malaria RDTs in these regions.
We report a P. falciparum prevalence ranging from 79% to 100% of the positive malaria RDTs according to the regions of Mali. Our results are consistent with those of Doumbo et al., who reported that P. falciparum accounted for 98.2% of the positive Plasmodium spp. tests since 1988 [4]. In 2011, an increase in the prevalence of P. falciparum from 74.13% during the dry season to 63.72% during the cold season was observed in a study by Koita et al. [6]. The 97% P. falciparum prevalence in the Mopti region is in line with Konate et al., who reported a 98% prevalence in Badiangara in 2020 [30]. This high, meso- to hyper-endemic, prevalence could be explained by the highly seasonal malaria transmission as well as the climate, which is characterized by 400 to 700 mm of rainfall per year, a short rainy season, from June/July to August/September, and a longer dry season. The region is irrigated by the Niger river and a tributary, the Yamé, which provides numerous breeding sites for Anopheles gambiae and Anopheles funestus during the 5 months of transmission each year [31].
Remarkably, we found a 21% and 4% prevalence of P. vivax in the Menaka and Kidal regions, respectively. Our results are in line with those of Bernabeu et al., who reported a 30% prevalence of P. vivax in five cities (Goundam, Timbuktu, Gao, Bourem, and Kidal) located in northern Mali [5]. Briefly, the P. vivax prevalence has been increasing in the northern part of the country, especially in Menaka, where we observed a higher prevalence than that observed by Koïta et al. in 2011.
In 2016, a study conducted in four West African countries, Burkina Faso, The Gambia, Ghana and Mali, verified that the prevalence of non-falciparum infections was higher in Mali (3.81%, 95% CI [2.22–5.68]) than in The Gambia (0.17%) [32]. To support this assertion, P. vivax and P. malariae have been found in black African women living in the Bamako area [32]. We also observed P. malariae infections in two regions of Southern Mali, namely 3.4% in Koulikoro and 2.9% in Mopti. Our findings are similar to those of a study carried out in the same Koulikoro region, which reported a 2.7% prevalence [33]. P. malariae infection is involved in nephrotic syndrome and chronic glomerulopathy, which can progress to end-stage renal failure [34,35] and has been associated with a high burden of anemia [36,37] and death [38]. It is therefore critical for the NMCP to control all non-P. falciparum human infections to achieve the malaria elimination goal.
We found no P. ovale in our samples. However, this parasite species, despite being less dangerous than P. falciparum, remains a public health burden that should be included in malaria elimination programs [39,40,41]. P. ovale has been reported to have a prevalence of around 2% in Mali. [42]. Conventional PCR followed by DNA sequence analysis is commonly used to differentiate the two subspecies P. ovale curtisi and P. ovale wallikeri, which have been documented in Mali and other West African countries [40,43,44].
The rapid detection and identification of Plasmodium parasite species with improved diagnostic tools are key for operative NMCPs [31]. In our study, the sensitivity of RDTs was higher than 80% in each region, except in Kidal and Segou, where it was moderate. The relatively lower performance of RDTs observed in these regions could be explained by the enhanced analytical sensitivity of the qPCR compared to RDTs. The majority of false-negative RDTs had either a fine band or weak staining, which could be related to low Plasmodium density in the blood, as already assumed in previous studies [45,46]. This condition could explain a decrease in both the sensitivity and specificity of RDTs. Another explanation could be the emergence of HRP-2/3 gene deletion [16,47]. The problem of false positives has been previously addressed; it could be due to the persistence of the HRP-2 protein in the patient’s blood up to several weeks after post-treatment parasite clearance [48]. In the Kidal and Menaka regions, the Youden and Kappa indices were lower than in the other regions. In Kidal, P. vivax was detected in a false-negative RDT that was designed to detect only the P. falciparum-specific HRP2 antigen. This relative emergence of non-P. falciparum Plasmodium species could be explained by the inability to detect other Plasmodium species of RDTs based solely on the detection of the Pf HRP-2 antigen, which is specific to P. falciparum. Therefore, adapting the diagnostic tools to the regional epidemiology should strengthen malaria control in Mali. In particular, the use of RDTs that are capable of detecting pan-Plasmodium antigens, such as lactate dehydrogenase (pLDH) or aldolase, should be advocated in regions where non-P. falciparum Plasmodium species are endemic [14,49].
The main strength of our study was its country-wide wide coverage, which allowed us to obtain a comprehensive picture of RDTs performance and Plasmodium species distribution in Mali. In contrast, our study also has some limitations, the main one being potential selection bias. Indeed, the samples were collected through a healthcare-facility-based epidemiological surveillance system, and only 40% of the population attends these healthcare facilities. Another limitation of our study was the deliberate selection of sites due to political insecurity constraints.

5. Conclusions

This study confirms that malaria rapid diagnostic tests (RDTs) contribute to significant improvement in the quality of malaria management in Mali. The results of this study suggest that the NMCP should recommend the use of RDTs with high analytical sensitivity that would be able to detect low parasitemia and set up a surveillance system for HRP2/3 deletion in patients, as it has already been documented in asymptomatic individuals in Mali. The NMCP should also recommend adapting RDTs’ specificity to the local Plasmodium species epidemiology to enhance malaria diagnosis in Mali.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijerph21020228/s1, Table S1: Detail of the total number and the prevalence of positive and negative Malaria Rapid Diagnostic Tests in each health center.

Author Contributions

P.D., M.C., M.A.T. and S.R. designed the study and wrote the first version of the manuscript. P.D., M.C., A.Z.D., L.D. and M.M. performed the analysis and interpretation of the results. M.H.M. and A.K. contributed to the collection and transport of samples. M.C., M.A.T. and S.R. contributed to the critical revision of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Our study was authorized by the National Malaria Control Program (number 064/MSDS-SG/NMCP, 8 February 2023), in accordance with Malian regulations on ethics and medical research.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

This study was made possible thanks to the academic and financial support of Mediterranee Infection foundation in Marseille, France, and the effective collaboration of the collection site supervisors. We thank each of you.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Global Messaging: World Malaria Report 2022. Available online: https://www.who.int/publications/m/item/WHO-UCN-GMP-2022.07 (accessed on 5 March 2023).
  2. OMS. World Health Organization World Malaria Report 2020; World Health Organization: Geneva, Switzerland, 2021; p. 322. ISBN 978-92-4-004049-6. [Google Scholar]
  3. DHIS 2, Https://Mali.Dhis2.Org/Dhis/Dhis-Web-Dashboard/#/. Available online: https://dhis2.org/?s=dashboard (accessed on 23 February 2022).
  4. Doumbo, O.; Koita, O.; Traore, S.F.; Sangare, O.; Coulibaly, A.; Robert, V.; Soula, G.; Quilici, M.; Toure, Y.T. Les Aspects Parasitologiques de l’épidémiologie du Paludisme dans le Sahara Malien|GHDx. Available online: https://ghdx.healthdata.org/record/les-aspects-parasitologiques-de-lépidémiologie-du-paludisme-dans-le-sahara-malien (accessed on 16 July 2023).
  5. Bernabeu, M.; Gomez-Perez, G.P.; Sissoko, S.; Niambélé, M.B.; Haibala, A.A.; Sanz, A.; Théra, M.A.; Fernandez-Becerra, C.; Traoré, K.; Alonso, P.L.; et al. Plasmodium Vivax Malaria in Mali: A Study from Three Different Regions. Malar. J. 2012, 11, 405. [Google Scholar] [CrossRef] [PubMed]
  6. Koita, O.A.; Sangaré, L.; Sango, H.A.; Dao, S.; Keita, N.; Maiga, M.; Mounkoro, M.; Fané, Z.; Maiga, A.S.; Traoré, K.; et al. Effect of Seasonality and Ecological Factors on the Prevalence of the Four Malaria Parasite Species in Northern Mali. J. Trop. Med. 2012, 2012, 367160. [Google Scholar] [CrossRef] [PubMed]
  7. Institut National de La Statistique (INSTAT) Enquête Demographique et de Santé. Available online: https://www.instat-mali.org/laravel-filemanager/files/shares/pub/eds6-18_pub.pdf (accessed on 15 November 2023).
  8. Enquête sur les Indicateurs du Paludisme au Mali en 2021. Available online: https://www.google.com.hk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwjLzob8xKSEAxWxoa8BHZR1BGkQFnoECBQQAQ&url=https%3A%2F%2Fwww.instat-mali.org%2Flaravel-filemanager%2Ffiles%2Fshares%2Feq%2Find-cle-eipm21_eq.pdf&usg=AOvVaw2PKEu18HcIp4HEJAIc3eAg&opi=89978449 (accessed on 22 September 2022).
  9. Conférence Ministérielle sur le Paludisme (1992; Amsterdam). Available online: https://www.google.com.hk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwiL-92gxaSEAxVrh68BHU0dChQQFnoECBkQAQ&url=https%3A%2F%2Fapps.who.int%2Firis%2Fbitstream%2Fhandle%2F10665%2F199385%2FWHA46_7_fre.pdf%3Fsequence%3D1&usg=AOvVaw3JeyAU0V6uzobwZthxE1N7&opi=89978449 (accessed on 14 September 2022).
  10. WHO_CDS_RBM_2000.25.pdf.https://iris.who.int/bitstream/hadle/10665/66745/WHO_CDS_RBM_2000.25.pdf;sequence=1 National Malaria Control Program Mali Annual Activity Report 2022; p 1–38. Available online: https://p2p.kemkes.go.id/wp-content/uploads/2023/12/FINAL_231123_Layout_Malaria_Bahasa-Inggris_compressed.pdf (accessed on 3 December 2023).
  11. Bell, D.; Wongsrichanalai, C.; Barnwell, J.W. Ensuring Quality and Access for Malaria Diagnosis: How Can It Be Achieved? Nat. Rev. Microbiol. 2006, 4, S7–S20. [Google Scholar] [CrossRef] [PubMed]
  12. Lohfeld, L.; Kangombe-Ngwenya, T.; Winters, A.M.; Chisha, Z.; Hamainza, B.; Kamuliwo, M.; Miller, J.M.; Burns, M.; Bridges, D.J. A Qualitative Review of Implementer Perceptions of the National Community-Level Malaria Surveillance System in Southern Province, Zambia. Malar. J. 2016, 15, 400. [Google Scholar] [CrossRef] [PubMed]
  13. Randriatsarafara, F.M.; Mandrosovololona, V.; Andrianirinarison, J.C.; Rakotondrandriana, A.N.; Randrianarivo-Solofoniaina, A.E.; Ratsimbasoa, A.; de Dieu Marie Rakotomanga, J. Adherence of private sector providers to uncomplicated malaria management policy in Madagascar. Pan Afr. Med. J. 2019, 32, 79. [Google Scholar] [CrossRef] [PubMed]
  14. Mouatcho, J.C.; Goldring, J.P.D. Malaria Rapid Diagnostic Tests: Challenges and Prospects. J. Med. Microbiol. 2013, 62, 1491–1505. [Google Scholar] [CrossRef] [PubMed]
  15. Kozycki, C.T.; Umulisa, N.; Rulisa, S.; Mwikarago, E.I.; Musabyimana, J.P.; Habimana, J.P.; Karema, C.; Krogstad, D.J. False-Negative Malaria Rapid Diagnostic Tests in Rwanda: Impact of Plasmodium falciparum Isolates Lacking Hrp2 and Declining Malaria Transmission. Malar. J. 2017, 16, 123. [Google Scholar] [CrossRef]
  16. McMorrow, M.L.; Aidoo, M.; Kachur, S.P. Malaria Rapid Diagnostic Tests in Elimination Settings—Can They Find the Last Parasite? Clin. Microbiol. Infect. 2011, 17, 1624–1631. [Google Scholar] [CrossRef]
  17. Motshoge, T.; Ababio, G.K.; Aleksenko, L.; Read, J.; Peloewetse, E.; Loeto, M.; Mosweunyane, T.; Moakofhi, K.; Ntebele, D.S.; Chihanga, S.; et al. Molecular Evidence of High Rates of Asymptomatic P. vivax Infection and Very Low P. falciparum Malaria in Botswana. BMC Infect. Dis. 2016, 16, 520. [Google Scholar] [CrossRef]
  18. Feleke, S.M.; Gidey, B.; Mohammed, H.; Nega, D.; Dillu, D.; Haile, M.; Solomon, H.; Parr, J.B.; Tollera, G.; Tasew, G.; et al. Field Performance of Plasmodium falciparum Lactate Dehydrogenase Rapid Diagnostic Tests during a Large Histidine-Rich Protein 2 Deletion Survey in Ethiopia. Malar. J. 2022, 21, 236. [Google Scholar] [CrossRef]
  19. Agarwal, R.; Choi, L.; Johnson, S.; Takwoingi, Y. Rapid Diagnostic Tests for Plasmodium vivax Malaria in Endemic Countries. Cochrane Database Syst. Rev. 2020, 11, CD013218. [Google Scholar] [CrossRef] [PubMed]
  20. Maltha, J.; Gillet, P.; Jacobs, J. Malaria Rapid Diagnostic Tests in Endemic Settings. Clin Microbiol Infect 2013, 19, 399–407. [Google Scholar] [CrossRef] [PubMed]
  21. Mens, P.F.; Schoone, G.J.; Kager, P.A.; Schallig, H.D. Detection and Identification of Human Plasmodium Species with Real-Time Quantitative Nucleic Acid Sequence-Based Amplification. Malar. J. 2006, 5, 80. [Google Scholar] [CrossRef] [PubMed]
  22. Snounou, G.; Viriyakosol, S.; Zhu, X.P.; Jarra, W.; Pinheiro, L.; do Rosario, V.E.; Thaithong, S.; Brown, K.N. High Sensitivity of Detection of Human Malaria Parasites by the Use of Nested Polymerase Chain Reaction. Mol. Biochem. Parasitol. 1993, 61, 315–320. [Google Scholar] [CrossRef] [PubMed]
  23. OMS. Stratégie Technique Mondiale de lutte contre le Paludisme 2016–2030. 2016. Available online: https://www.who.int/fr/publications-detail/9789240031357 (accessed on 13 April 2022).
  24. Mady, C.; Cissoko, M.; Sagara, I.; Landier, J.; Guindo, A.; Sanogo, V.; Coulibaly, O.; Dembélé, P.; Dieng, S.; Stephane, C.; et al. Optimising Malaria Control Interventions in Mali Based on Epidemiological Surveillance and Rainfall Data. 2022. Available online: https://www.researchsquare.com/article/rs-1235012/v1 (accessed on 16 May 2022).
  25. DNA Extraction: Preparing Rapid Diagnostic Tests. Available online: https://www.wwarn.org/tools-resources/procedures/dna-extraction-preparing-rapid-diagnostic-tests (accessed on 20 March 2022).
  26. Sazed, S.A.; Kibria, M.G.; Alam, M.S. An Optimized Real-Time qPCR Method for the Effective Detection of Human Malaria Infections. Diagnostics 2021, 11, 736. [Google Scholar] [CrossRef] [PubMed]
  27. Kodio, A. Interactions Entre les Communautés Bactériennes et Fongiques Intestinales et le Paludisme et des Pathogènes Entériques Eucaryotes Chez des Enfants au Pays Dogon (Mali). Ph.D. Thesis, Aix-Marseille, Marseille, France, 2020. [Google Scholar]
  28. JavaStat—2-Way Contingency Table Analysis. Available online: https://statpages.info/ctab2x2.html (accessed on 8 February 2023).
  29. Un Coefficient D’accord Pour les Échelles Nominales—Jacob Cohen. 1960. Available online: https://journals.sagepub.com/doi/abs/10.1177/001316446002000104?journalCode=epma (accessed on 19 February 2023).
  30. Dynamique de L’infection Palustre Dans Une Etude de Cohorte D’enfant à Bandiagara, Mali. Available online: https://www.bibliosante.ml/handle/123456789/4085 (accessed on 19 February 2022).
  31. Coulibaly, D.; Rebaudet, S.; Travassos, M.; Tolo, Y.; Laurens, M.; Kone, A.K.; Traore, K.; Guindo, A.; Diarra, I.; Niangaly, A.; et al. Spatio-Temporal Analysis of Malaria within a Transmission Season in Bandiagara, Mali. Malar. J. 2013, 12, 82. [Google Scholar] [CrossRef] [PubMed]
  32. Williams, J.; Njie, F.; Cairns, M.; Bojang, K.; Coulibaly, S.O.; Kayentao, K.; Abubakar, I.; Akor, F.; Mohammed, K.; Bationo, R.; et al. Non-Falciparum Malaria Infections in Pregnant Women in West Africa. Malar. J. 2016, 15, 53. [Google Scholar] [CrossRef]
  33. Dao, F.; Dembele, L.; Diarra, B.; Sogore, F.; Marin-Menendez, A.; Goita, S.; Haidara, A.S.; Barre, Y.N.; Sangare, C.P.O.; Kone, A.; et al. The Prevalence of Human Plasmodium Species during Peak Transmission Seasons from 2016 to 2021 in the Rural Commune of Ntjiba, Mali. Trop. Med. Infect. Dis. 2023, 8, 438. [Google Scholar] [CrossRef]
  34. Eiam-Ong, S. Malarial Nephropathy. Semin. Nephrol. 2003, 23, 21–33. [Google Scholar] [CrossRef]
  35. Hendrickse, R.G.; Adeniyi, A.; Edington, G.M.; Glasgow, E.F.; White, R.H.; Houba, V. Quartan Malarial Nephrotic Syndrome. Collaborative Clinicopathological Study in Nigerian Children. Lancet 1972, 1, 1143–1149. [Google Scholar] [CrossRef]
  36. Langford, S.; Douglas, N.M.; Lampah, D.A.; Simpson, J.A.; Kenangalem, E.; Sugiarto, P.; Anstey, N.M.; Poespoprodjo, J.R.; Price, R.N. Plasmodium malariae Infection Associated with a High Burden of Anemia: A Hospital-Based Surveillance Study. PLoS Negl. Trop. Dis. 2015, 9, e0004195. [Google Scholar] [CrossRef] [PubMed]
  37. Dao, F.; Djonor, S.K.; Ayin, C.T.-M.; Adu, G.A.; Sarfo, B.; Nortey, P.; Akuffo, K.O.; Danso-Appiah, A. Burden of Malaria in Children under Five and Caregivers’ Health-Seeking Behaviour for Malaria-Related Symptoms in Artisanal Mining Communities in Ghana. Parasites Vectors 2021, 14, 418. [Google Scholar] [CrossRef] [PubMed]
  38. Hwang, J.; Cullen, K.A.; Kachur, S.P.; Arguin, P.M.; Baird, J.K. Severe Morbidity and Mortality Risk from Malaria in the United States, 1985–2011. Open Forum Infect. Dis. 2014, 1, ofu034. [Google Scholar] [CrossRef] [PubMed]
  39. Collins, W.E.; Jeffery, G.M. Plasmodium Malariae: Parasite and Disease. Clin. Microbiol. Rev. 2007, 20, 579–592. [Google Scholar] [CrossRef] [PubMed]
  40. Milner, D.A. Malaria Pathogenesis. Cold Spring Harb. Perspect. Med. 2018, 8, a025569. [Google Scholar] [CrossRef] [PubMed]
  41. Rutledge, G.G.; Böhme, U.; Sanders, M.; Reid, A.J.; Cotton, J.A.; Maiga-Ascofare, O.; Djimdé, A.A.; Apinjoh, T.O.; Amenga-Etego, L.; Manske, M.; et al. Plasmodium Malariae and P. Ovale Genomes Provide Insights into Malaria Parasite Evolution. Nature 2017, 542, 101–104. [Google Scholar] [CrossRef] [PubMed]
  42. Tebben, K.; Yirampo, S.; Coulibaly, D.; Koné, A.K.; Laurens, M.B.; Stucke, E.M.; Dembélé, A.; Tolo, Y.; Traoré, K.; Niangaly, A.; et al. Malian Children Infected with Plasmodium Ovale and Plasmodium falciparum Display Very Similar Gene Expression Profiles. PLoS Negl. Trop. Dis. 2023, 17, e0010802. [Google Scholar] [CrossRef] [PubMed]
  43. Oguike, M.C.; Betson, M.; Burke, M.; Nolder, D.; Stothard, J.R.; Kleinschmidt, I.; Proietti, C.; Bousema, T.; Ndounga, M.; Tanabe, K.; et al. Plasmodium Ovale Curtisi and Plasmodium Ovale Wallikeri Circulate Simultaneously in African Communities. Int. J. Parasitol. 2011, 41, 677–683. [Google Scholar] [CrossRef]
  44. Phillips, M.A.; Burrows, J.N.; Manyando, C.; van Huijsduijnen, R.H.; Van Voorhis, W.C.; Wells, T.N.C. Malaria. Nat. Rev. Dis. Primers 2017, 3, 17050. [Google Scholar] [CrossRef]
  45. Forney, J.R.; Magill, A.J.; Wongsrichanalai, C.; Sirichaisinthop, J.; Bautista, C.T.; Heppner, D.G.; Miller, R.S.; Ockenhouse, C.F.; Gubanov, A.; Shafer, R.; et al. Malaria Rapid Diagnostic Devices: Performance Characteristics of the ParaSight F Device Determined in a Multisite Field Study. J. Clin. Microbiol. 2001, 39, 2884–2890. [Google Scholar] [CrossRef]
  46. Harris, I.; Sharrock, W.W.; Bain, L.M.; Gray, K.-A.; Bobogare, A.; Boaz, L.; Lilley, K.; Krause, D.; Vallely, A.; Johnson, M.-L.; et al. A Large Proportion of Asymptomatic Plasmodium Infections with Low and Sub-Microscopic Parasite Densities in the Low Transmission Setting of Temotu Province, Solomon Islands: Challenges for Malaria Diagnostics in an Elimination Setting. Malar. J. 2010, 9, 254. [Google Scholar] [CrossRef]
  47. Martiáñez-Vendrell, X.; Skjefte, M.; Sikka, R.; Gupta, H. Factors Affecting the Performance of HRP2-Based Malaria Rapid Diagnostic Tests. Trop. Med. Infect. Dis. 2022, 7, 265. [Google Scholar] [CrossRef] [PubMed]
  48. Maltha, J.; Gillet, P.; Cnops, L.; van den Ende, J.; van Esbroeck, M.; Jacobs, J. Malaria Rapid Diagnostic Tests: Plasmodium falciparum Infections with High Parasite Densities May Generate False Positive Plasmodium vivax pLDH Lines. Malar. J. 2010, 9, 198. [Google Scholar] [CrossRef]
  49. Briolant, S.; Pradines, B.; Basco, L.K. Place de la primaquine dans la lutte contre le paludisme en Afrique francophone. Bull. Soc. Pathol. Exot. 2017, 110, 198–206. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Location of the study sites in the nine administrative regions of Mali where malaria is endemic.
Figure 1. Location of the study sites in the nine administrative regions of Mali where malaria is endemic.
Ijerph 21 00228 g001
Figure 2. Plasmodium species distribution in the nine administrative regions of Mali where malaria is endemic.
Figure 2. Plasmodium species distribution in the nine administrative regions of Mali where malaria is endemic.
Ijerph 21 00228 g002
Figure 3. Amplification curves for real-time PCR targeting 18S rRNA of Plasmodium vivax species in Menaka (positive control in red and positive samples in green).
Figure 3. Amplification curves for real-time PCR targeting 18S rRNA of Plasmodium vivax species in Menaka (positive control in red and positive samples in green).
Ijerph 21 00228 g003
Table 1. List of the primers and probes, targeting the Plasmodium spp. 18s rRNA genes, used in our study.
Table 1. List of the primers and probes, targeting the Plasmodium spp. 18s rRNA genes, used in our study.
Target SpeciesPrimers and ProbesSequences
Plasmodium spp.VAR ATS-FCCCATACACAACCAAYTGGA
VAR ATS-RTTCGCACATATCTCTATGTCTATCT
Var ATS-ProbeFAM-TRTTCCATAAATGGT
Plasmodium falciparumPf-FTAGCATATATTAAAATTGTTGCAG
Pf-RGTTATTCCATGCTGTAGTATTCA
Pf-probe6FAM-CGGGTAGTCATGATTGAGTTCATTC
Plasmodium malariaePm-FTAGCATATATTAAAATTGTTGCAG
Pm-RGTTATTCCATGCTGTAGTATTCA
Pm-probe6FAM- TGCATGGGAATTTTGTTACTTTGAGT
Plasmodium ovalePo-FTAGCATATATTAAAATTGTTGCAG
Po-F RGTTATTCCATGCTGTAGTATTCA
Po-probe6VIC- TGCATTCCTTATGCAAAATGTGTTC
Plasmodium vivaxPv-FAGCATATATTAAAATTGTTGCAG
Pv-RGTTATTCCATGCTGTAGTATTCA
Pv-probe6VIC- CGACTTTGTGCGCATTTTGC
Hybridization temperature was 60 °C for each PCR, and we used TaqmanTM hydrolysis probes [27].
Table 2. Details of the total number collected and the proportions of positive and negative Malaria rapid diagnostic tests in each health center and administrative region.
Table 2. Details of the total number collected and the proportions of positive and negative Malaria rapid diagnostic tests in each health center and administrative region.
Area Health DistrictRDT Collection SiteResultTotal
Positive
N (%)
Negative
N (%)
KayesDiémaTorodo6 (2.2)272 (97.8)278
Lakamané3 (3.4)89 (96.7)92
Lattakaf0 (0.0)47 (100)47
Débomassassi0 (0.0)48 (100)48
Koungo3 (75.0)1 (25.0)4
Lambidou 0 (0.0)13 (100)13
Diancounté Camara3 (6.4)44 (93.6)47
YélimanéKodié12 (19.0)51 (81.0)63
Csréf6 (4,1)139 (95.9)145
Dogofry0 (0.0)23 (100.0)23
Bandiougoula0 (0.0)11 (100.0)11
sub total 33 (4.3)738 (95.7)771
KoulikoroNaraBagoini0 (0.0)50 (100.0)50
Mourdiah5 (7.4)68 (100.0)73
Kassakaré4 (12.1)29 (87.9)33
Alasso7 (20.0)28 (80.0)35
Tiapato3 (14.3)18 (85.7)21
Waourou(0.0)13 (100.0)13
KangabaNaréna2 (1.6)126 (98.4)128
Cscom Central14 (28.0)36 (72.0)50
Séléfougou0 (0.0)30 (100.0)30
sub total 35 (8.1)398 (91.9)433
SikassoKadioloCscom central110 (59.5)75 (40.5)185
Kebeni12 (16.4)69 (85.2)81
Zégoua28 (38.9)44 (61.1)72
sub total 150 (44.4)188 (55.6)338
SegouBarouéliCscom Central5 (41.7)7 (58.3)12
Dioforogo13 (65.0)7 (35.0)20
Tamani7 (35.0)13 (65.0)20
NGara16 (80.0)4 (20.0)20
Tigui20 (100.0)0 (0.0)20
Bananido7 (50.0)7 (50.0)14
N’Gossola5 (31.2)11(68.8)16
Nianzana20 (66.7)10 (33.3)30
Yerebougou16 (80.0)4 (20.0)20
C.S. Réf.8 (6.2)122 (93.8)130
Ndjila10 (50.0)10 (50.0)20
sub total 127 (39.4)195 (60.6)322
MoptiMoptiSoufouroulaye79 (34.3)151 (65.7)230
Fatoma0 (0.0)35 (100.0)35
Sévaré II136 (91.9)12 (8.1)148
sub total 215 (52.1)198 (47.9)413
Tombouctou Gourma Rharous400 (66.9)198 (33.1)598
GaoGaoC.S. Réf. d’Ansongo30 (13.4)194 (86.6)224
MenakaMenakaMenaka21 (36.8)36 (63.2)57
KidalKidalCscom d’Aliou9 (14.3)54 (85.7)63
C.S. Réf. de Kidal20 (14.3)120 (85.7)140
sub total 29 (14.3)174 (85.7)203
Total 1019 (30.5)2319 (69.5)3338
Table 3. Distribution of plasmodial species as identified using qPCR according to research sites.
Table 3. Distribution of plasmodial species as identified using qPCR according to research sites.
RegionsP. falciparumP. vivaxP. malariaeP. ovaleP. falciparum + P. malariaeP. falciparum + P. vivaxTotal
n%n%N%n%N%n%
Kayes33100000000000033
Koulikoro2896.60013.40013.40029
Sikasso30100000000000030
Ségou42100000000000042
Mopti3397.10012.900000034
Tombouctou30100000000000030
Gao18100000000000018
Kidal2191.314.300000014.323
Ménaka1578.9421.10000000019
Total25196.951.920.80010.410.4258
Table 4. Diagnostic indices (95% confidence intervals), when compared to the qPCR gold standard, of the rapid diagnostic tests (RDT), compared to the qPCR gold standard, used for the biological diagnosis of malaria in each administrative region of Mali.
Table 4. Diagnostic indices (95% confidence intervals), when compared to the qPCR gold standard, of the rapid diagnostic tests (RDT), compared to the qPCR gold standard, used for the biological diagnosis of malaria in each administrative region of Mali.
Regions SensitivitySpecificityYoudenKappa
Kayes87.9% [76.9–90.7]99.3% [96.9–100]0.87 [0.74–0.91]0.90 [0.77–0.94]
Koulikoro96.6% [84.9–99.8]98.7% [95.7–98.6]0.95 [0.81–0.99]0.94 [0.80–0.98]
Sikasso80.0% [65.3–90.0]96.0% [93.1–97.9]0.76 [0.58–0.87]0.76 [0.58–0.88]
Segou71.4% [62.7–71.4]100% [97.3–100]0.71 [0.60–0.71]0.79 [0.67–0.79]
Mopti88.2% [79–88.0]100% [98–100]0.88 [0.76–0.88]0.92 [0.80–0.92]
Tombouctou93.3% [80.6–98.7]97.3% [94.8–98.4]0.91 [0.75–0.97]0.88 [0.73–0.95]
Gao94.4% [73.4–99.7]92.6% [90.3–93.2]0.87 [0.64–0.93]0.68 [0.50–0.73]
Kidal73.9% [54.5–87.8]92.3% [89.4–94.4]0.66 [0.44–0.82]0.60 [0.40–0.74]
Ménaka78.9% [59.0–92.0]84.2% [74.2–90.7]0.63 [0.33–0.83]0.62 [0.32–0.80]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dembélé, P.; Cissoko, M.; Diarra, A.Z.; Doumbia, L.; Koné, A.; Magassa, M.H.; Mehadji, M.; Thera, M.A.; Ranque, S. Evaluation of the Performance of Rapid Diagnostic Tests for Malaria Diagnosis and Mapping of Different Plasmodium Species in Mali. Int. J. Environ. Res. Public Health 2024, 21, 228. https://doi.org/10.3390/ijerph21020228

AMA Style

Dembélé P, Cissoko M, Diarra AZ, Doumbia L, Koné A, Magassa MH, Mehadji M, Thera MA, Ranque S. Evaluation of the Performance of Rapid Diagnostic Tests for Malaria Diagnosis and Mapping of Different Plasmodium Species in Mali. International Journal of Environmental Research and Public Health. 2024; 21(2):228. https://doi.org/10.3390/ijerph21020228

Chicago/Turabian Style

Dembélé, Pascal, Mady Cissoko, Adama Zan Diarra, Lassana Doumbia, Aïssata Koné, Mahamadou H. Magassa, Maissane Mehadji, Mahamadou A. Thera, and Stéphane Ranque. 2024. "Evaluation of the Performance of Rapid Diagnostic Tests for Malaria Diagnosis and Mapping of Different Plasmodium Species in Mali" International Journal of Environmental Research and Public Health 21, no. 2: 228. https://doi.org/10.3390/ijerph21020228

APA Style

Dembélé, P., Cissoko, M., Diarra, A. Z., Doumbia, L., Koné, A., Magassa, M. H., Mehadji, M., Thera, M. A., & Ranque, S. (2024). Evaluation of the Performance of Rapid Diagnostic Tests for Malaria Diagnosis and Mapping of Different Plasmodium Species in Mali. International Journal of Environmental Research and Public Health, 21(2), 228. https://doi.org/10.3390/ijerph21020228

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop