Comparative Survival and the Cold-Induced Gene Expression of Pathogenic and Nonpathogenic Vibrio Parahaemolyticus from Tropical Eastern Oysters during Cold Storage
Abstract
1. Introduction
2. Materials and Methods
2.1. Area of Study and Sample Collection
2.2. Survival under Cold Shock Conditions in Live Shellstock Oysters
2.3. Isolation and Purification of V. Parahaemolyticus Strains from Oysters for an In Vitro Study
2.4. Survival under Cold Shock Conditions In Vitro
2.5. In Vitro Gene Expression
2.6. Data Analysis
3. Results and Discussion
3.1. Effect of Cold Shock on Growth Kinetics of Nonpathogenic (Vp-tlh) and Pathogenic (Vp-tdh) V. Parahaemolyticus in Live Oysters
3.2. Effect of Cold Shock on Growth Kinetics of Nonpathogenic (Vp-tlh) and Pathogenic (Vp-tdh) V. Parahaemolyticus In Vitro
3.3. Effect of Cold Shock on Gene Expression of Nonpathogenic (Vp-tlh) and Pathogenic (Vp-tdh) V. Parahaemolyticus In Vitro
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wang, R.; Zhong, Y.; Gu, X.; Yuan, J.; Saeed, A.; Wang, S. The pathogenesis, detection, and prevention of Vibrio parahaemolyticus. Front. Microbiol. 2015, 6, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Mala, W.; Alam, A.; Angkititrakul, S.; Wongwajana, S.; Lulitanond, V.; Huttayananont, S.; Chomvarin, C. Serogroup, virulence, and molecular traits of Vibrio parahaemolyticus isolated from clinical and cockle sources in northeastern Thailand. Infect. Genet. Evol. 2016, 39, 212–218. [Google Scholar] [CrossRef] [PubMed]
- Bej, A.K.; Patterson, D.P.; Brasher, C.; Vickery, M.C.L.; Jones, D.; Kaysner, C. Detection of total and hemolysin producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tlh, tdh and trh. J. Microbiol. Methods 1999, 36, 215–225. [Google Scholar] [CrossRef]
- Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front. Microbiol. 2015, 5, 1–4. [Google Scholar] [CrossRef]
- López, K.; Pardío, V.; Lizárraga, L.; Williams, J.; Martínez, D.; Flores, A.; Uscanga, R.; Rendón, K. Environmental parameters influence on the dynamics of total and pathogenic Vibrio parahaemolyticus densities in Crassostrea virginica harvested from Mexico’s Gulf coast. Mar. Pollut. Bull. 2015, 91, 317–329. [Google Scholar] [CrossRef]
- Hernández-Díaz, L.; León-Sicairos, N.; Velázquez-Román, J.; Flores-Villaseñor, H.; Guadrón-Lanos, A.; Martínez-García, J.; Vidal, J.; Canizalez-Román, A. A pandemic Vibrio parahaemolyticus O3:K6 clone causing most associated diarrhea cases in the Pacific Northwest coast of Mexico. Front. Microbiol. 2015, 6, 221. [Google Scholar] [CrossRef]
- Chao, G.; Jiao, X.; Zhou, X.; Yang, Z.; Huang, J.; Pan, Z.; Zhou, L.; Qian, X. Serodiversity, pandemic O3:K6 clone, molecular typing and antibiotic susceptibility of foodborne and clinical Vibrio parahaemolyticus isolates in Jiangsu, China. Foodborne Pathog. Dis. 2009, 6, 1021–1028. [Google Scholar] [CrossRef]
- Infomex Veracruz. Sistema de Solicitudes de Información del Estado de Veracruz de Ignacio de la Llave. Listado Nominal de Resultados. Available online: https://infomexveracruz.org.mx/infomexveracruz/default.aspx (accessed on 5 February 2019).
- Aung, M.M.; Chang, Y.S. Temperature management for the quality assurance of a perishable food supply chain. Food Control 2014, 40, 198–207. [Google Scholar] [CrossRef]
- Yoon, K.; Min, K.; Jung, Y.; Kwon, K.; Lee, J.; Oh, S. A model of the effect of temperature on the growth of pathogenic and nonpathogenic Vibrio parahaemolyticus isolated from oysters in Korea. Food Microbiol. 2008, 25, 635–641. [Google Scholar] [CrossRef]
- Flores, A.; Pardío, V.; López, K.; Lizárraga, L.; Uscanga, R. Growth and survival of total para pathogenic Vibrio parahaemolyticus in Americano oyster (Crassostrea virginica) under cold storage. Salud Púb. México 2015, 57, 211–218. [Google Scholar]
- Gooch, J.; Depaola, A.; Owers, J.; Marshall, D. Growth and survival of Vibrio paraaemolyticus in postharvest American oysters. J. Food Prot. 2002, 65, 970–974. [Google Scholar] [CrossRef] [PubMed]
- Horn, G.; Hofweber, R.; Kremer, W.; Kalbitzer, H. Structure and function of bacterial cold shock proteins. Cell. Mol. Life Sci. 2007, 64, 1457–1470. [Google Scholar] [CrossRef] [PubMed]
- Phadtare, S.; Alsina, J.; Inouye, M. Cold-shock response and cold-shock proteins. Curr. Opin. Microbiol. 1999, 2, 175–180. [Google Scholar] [CrossRef]
- Yang, L.; Zhou, D.; Liu, X.; Han, H.; Zhan, L.; Guo, Z.; Zhang, L.; Qin, C.; Wong, H.; Yang, R. Cold-induced gene expression profiles of Vibrio parahaemolyticus: A time-course analysis. FEMS Microbiol. Lett. 2009, 291, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Comisión Nacional de Acuacultura y Pesca (CONAPESCA). Anuario Estadístico de Acuacultura y Pesca 2017. Available online: http://www.gob.mx/conapesca/documentos/anuario-estadistico-de-acuacultura-y-pesca (accessed on 5 February 2019).
- Lara, A.; Contreras, F.; Barba, E.; Castañeda, O.; Pérez, M. Lagunas Costeras y Estuarios. In La Biodiversidad en Veracruz: Estudio del Estado; Cruz Angón, A., Ed.; CONABIO: Tlalpan, CDMX, Mexico, 2011; pp. 301–317. [Google Scholar]
- Ramírez Elvira, K.; López-Hernández, K.; Pardío Sedas, V.; Mendoza López, M.; Flores Primo, A.; Alarcón Elvira, F. Identificación de Vibrio parahaemolyticus en ostiones expendidos en la zona conurbada Veracruz-Boca del Río y Alvarado, Veracruz. In Proceedings of the Food Safety Congress 2017, Chihuahua, Mexico, 15–17 November 2017. [Google Scholar]
- Pardío, V.; Wong, I.; Lizárraga, L.; López, K.; Flores, A.; Barrera, G.; Alarcón, F.; Fernández, C. Survival differences of Vibrio vulnificus and Vibrio parahaemolyticus strains in shellstock oysters (Crassostrea virginica) from harvest to sale: A risk perspective. In Molluscs; Diarte-Plata, G., Ed.; InTechOpen: London, UK, 2018; pp. 1–19. [Google Scholar]
- Secretaría de Salud. Gobierno de México. NOM-242-SSA1-2009. Available online: http://portal.salud.gob.mx/ (accessed on 5 February 2019).
- Secretaría de Economía. Gobierno de México. NMX-FF-001-SCFI-2011. Available online: http://www.economia.gob.mx/ (accessed on 5 February 2019).
- Farrelly, V.; Rainey, F.; Stackebrandt, E. Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species. Infect. Immun. 1995, 61, 2798–2801. [Google Scholar] [CrossRef]
- Turner, S.; Pryer, K.; Miao, V.; Palmer, J. Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J. Eukaryot. Microbiol. 1999, 46, 327–338. [Google Scholar] [CrossRef]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Manchester, K.L. Use of UV methods for measurement of protein and nucleic acid concentrations. Biotechniques 1996, 20, 968–970. [Google Scholar] [CrossRef]
- Myers, M.; Panicker, G.; Bej, A. PCR detection of a newly emerged pandemic Vibrio parahaemolyticus O3: K6 pathogen in pure cultures and seeded waters from the Gulf of Mexico. Appl. Environ. Microbiol. 2003, 69, 2194–2200. [Google Scholar] [CrossRef]
- Ma, Y.; Sun, X.; Xu, X.; Zhao, Y.; Pan, Y.; Hwang, C.; Wu, V. Investigation of reference genes in Vibrio parahaemolyticus for gene expression analysis using quantitative RT-PCR. PLoS ONE 2015, 10, e0144362. [Google Scholar] [CrossRef]
- Meng, L.; Alter, T.; Aho, T.; Huehn, S. Gene expression profiles of Vibrio parahaemolyticus in viable but non-culturable state. FEMS Microbiol. Ecol. 2015, 91, 1–12. [Google Scholar] [CrossRef]
- Coutard, F.; Lozach, S.; Pommepuy, M.; Hervio-Heath, D. Real-time reverse transcription-PCR for transcriptional expression analysis of virulence and housekeeping genes in viable but nonculturable Vibrio parahaemolyticus after recovery of culturability. Appl. Environ. Microbiol. 2007, 73, 5183–5189. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.; Livak, K. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Piquer, J.; Bowman, J.; Tamplin, M. Predictive models for the effect of storage temperature on Vibrio parahaemolyticus viability and counts of total viable bacteria in Pacific oysters (Crassostrea gigas). Appl. Environ. Microbiol. 2011, 77, 8687–8695. [Google Scholar] [CrossRef] [PubMed]
- Cabello, A.; Espejo, R.; Romero, J. Tracing Vibrio parahaemolyticus in oysters (Tiostrea chilensis) using a Green Fluorescent Protein tag. J. Exp. Mar. Biol. Ecol. 2005, 327, 157–166. [Google Scholar] [CrossRef]
- Parveen, S.; Dasilva, L.; DePaola, A.; Bowers, J.; White, C.; Munasinghe, K.; Brohawn, K.; Mudoh, M.; Tamplin, M. Development and validation of a predictive model for the growth of Vibrio parahaemolyticus in post-harvest shellstock oysters. Int. J. Food Microbiol. 2013, 161, 1–6. [Google Scholar] [CrossRef]
- Mudoh, M.; Parveen, S.; Schwarz, J.; Rippen, T.; Chaudhuri, A. The effects of storage temperature on the growth of Vibrio parahaemolyticus and organoleptic properties in oysters. Front. Public Health 2014, 2, 1–7. [Google Scholar] [CrossRef]
- Tang, J.; Jia, J.; Chen, Y.; Huang, X.; Zhang, X.; Zhao, L.; Hu, W.; Wang, C.; Lin, C.; Wu, Z. Proteomic analysis of Vibrio parahaemolyticus under cold stress. Curr. Microbiol. 2018, 75, 20–26. [Google Scholar] [CrossRef]
- Burnham, V.; Janes, M.; Jakus, L.; Supan, J.; DePaola, A.; Bell, J. Growth and survival differences of Vibrio vulnificus and Vibrio parahaemolyticus strains during cold storage. J. Food Sci. 2009, 74, M314–M318. [Google Scholar] [CrossRef]
- Hara-Kudo, Y.; Nishina, T.; Nakagawa, H.; Konuma, H.; Hasegawa, J.; Kumagai, S. Improved method for detection of Vibrio parahaemolyticus in seafood. Appl. Environ. Microbiol. 2001, 67, 5819–5823. [Google Scholar] [CrossRef]
- Mahoney, J.; Gerding, M.; Jones, S.; Whistler, C.A. Comparison of the pathogenic potentials of environmental and clinical Vibrio parahaemolyticus strains indicates a role for temperature regulation in virulence. Appl. Environ. Microbiol. 2010, 76, 7459–7465. [Google Scholar] [CrossRef] [PubMed]
- Phadtare, S.; Inouye, M. Genome-wide transcriptional analysis of the cold shock response in wild-type and cold-sensitive, quadruple-csp-deletion strains of Escherichia coli. J. Bacteriol. 2004, 186, 7007–7014. [Google Scholar] [CrossRef] [PubMed]
- Phadtare, S.; Severinov, K. RNA remodeling and gene regulation by cold shock proteins. RNA Biol. 2010, 7, 788–795. [Google Scholar] [CrossRef] [PubMed]
- Trevors, J.; Bej, A.; Mojib, N.; van Elsas, J.; van Overbeek, L. Bacterial gene expression at low temperatures. Extremophiles 2012, 16, 167–176. [Google Scholar] [CrossRef] [PubMed]
- Limthammahisorn, S.; Brady, Y.; Arias, C. In vivo gene expression of cold shock and other stress-related genes in Vibrio vulnificus during shellstock temperature control conditions in oysters. J. Appl. Microbiol. 2009, 106, 642–650. [Google Scholar] [CrossRef] [PubMed]
- López Hernández, K.; Pardío Sedas, V.; Rodríguez Dehaibes, S.; Suárez Valencia, V.; Rivas Mozo, I.; Martínez Herrera, D.; Flores Primo, A.; Uscanga Serrano, R. Improved microbial safety of direct ozone-depurated shellstock Eastern oysters (Crassostrea virginica) by superchilled storage. Front. Microbiol. 2018, 9, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Hou, Y.; Inouye, M. CspA, the major cold-shock protein of Escherichia coli, is an RNA chaperone. J. Biol. Chem. 1997, 272, 196–202. [Google Scholar] [CrossRef]
- Michaux, C.; Holmqvis, E.; Vasicek, E.; Sharan, M.; Barquist, L.; Westermann, A.; Gunn, J.; Vogel, J. RNA target profiles direct the discovery of virulence functions for the cold-shock proteins CspC and CspE. Proc. Natl. Acad. Sci. USA 2017, 114, 6824–6829. [Google Scholar] [CrossRef]
- Dong, T.; Schellhorn, H. Role of RpoS in virulence of pathogens. Infect. Immun. 2010, 78, 887–897. [Google Scholar] [CrossRef] [PubMed]
- Urmersbach, S.; Aho, T.; Alter, T.; Hassan, S.; Autio, R.; Huehn, S. Changes in global gene expression of Vibrio parahaemolyticus induced by cold- and heat-stress. BMC Microbiol. 2015, 15, 229. [Google Scholar] [CrossRef] [PubMed]
- Zhao, A.; Liu, H.; Sun, W.; Li, Q.; Pan, Y.; Zhao, Y. Irregular virulence genes expression of Vibrio parahaemolyticus in shrimp or seawater matrix. J. Microbiol. Biotechnol. 2015, 4, 26–31. [Google Scholar]
- Eshwar, A.; Guldimann, C.; Oevermann, A.; Tasara, T. Cold-shock domain family proteins (Csps) are involved in regulation of virulence, cellular aggregation, and flagella-based motility in Listeria monocytogenes. Front. Cell Infect. Microbiol. 2017, 7, 453. [Google Scholar] [CrossRef] [PubMed]
- Sahukhal, G.S.; Elasri, M. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus. BMC Microbiol. 2014, 14, 154. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, S.; Wu, Q. Cold shock protein A plays an important role in the stress adaptation and virulence of Brucella melitensis. FEMS Microbiol. Lett. 2014, 354, 27–36. [Google Scholar] [CrossRef]
- U.S. Food and Drug Administration National Shellfish Sanitation Program. Guide for the Control of Molluscan Shellfish: 2017 Revision. Available online: http://www.fda.gov/Food/GuidanceRegulation/FederalStateFoodPrograms/ucm2006754.htm (accessed on 5 February 2019).
Gene (ID) | Sequence (5′-3′) | Tm (°C) | References | |
---|---|---|---|---|
tlh (VPA0226) | tl-f | AAA GCG GAT TAT GCA GAA GCA CTG | 58 a | [3] |
tl-r | GCT ACT TTC TAG CAT TTT CTC TGC | |||
tdh (GU971653) * | L-tdh | GTA AAG GTC TCT GAC TTT TGG AC | 58 a | [3] |
R-tdh | TGG AAT AGA ACC TTC ATC TTC ACC | |||
trh (GU971654) * | trh-f | TTG GCT TCG ATA TTT TCA GTA TCT | 58 a | [3] |
trh-r | CAT AAC AAA CAT ATG CCC ATT TCC G | |||
orf8 (AP00581) * | F-O3MM824 | AGG ACG CAG TTA CGC TTG ATG | 60 b | [26] |
R-O3MM1192 | CTA ACG CAT TGT CCC TTT GTA G | |||
16S rRNA | F-10-30: | GAGTTTGATCMTGGCTCAG | F | [22,23] |
R-1492: | GGTTACCTTGTTACGACTT | |||
rpoS (VP2553) | Fw- | GACAATGCGTCAGAGACG | F | [27] |
Rv- | GAGGTGAGAAGCCAATTTC | |||
cspA (VPA1289) | F- | TATCGTTGCTGACGGTTTCA | F | [28] |
R- | TCAGTCGCTTGAGGACCTTT | |||
pvuA VPA1656) | 156F-1 | CAAACTCACTCAGACTCCA | F | [29] |
56R- | CGAACCGATTCAACACG |
V. parahaemolyticus | μmax (h−1) | λ (h) | A | G (h) | R2 | Syx |
---|---|---|---|---|---|---|
In vivo (oyster) | ||||||
tlh | 8.68 | 0.39 (23.4 min) | 0.18 | 0.08 (4.8 min) | 0.8300 | 0.0001 |
tdh | 28.63 | 0.33 (19.8 min) | 0.62 | 0.02 (1.2 min) | 0.8100 | 0.0001 |
In vitro | ||||||
tlh | 2.32 | 37.65 (2,259.0 min) | 2.78 | 0.30 (18.0 min) | 0.9990 | 0.0422 |
tdh | 5.29 | 0.89 (53.4 min) | 2.50 | 0.13 (7.8 min) | 0.9244 | 0.2664 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alarcón Elvira, F.; Pardío Sedas, V.T.; Martínez Herrera, D.; Quintana Castro, R.; Oliart Ros, R.M.; López Hernández, K.; Flores Primo, A.; Ramírez Elvira, K. Comparative Survival and the Cold-Induced Gene Expression of Pathogenic and Nonpathogenic Vibrio Parahaemolyticus from Tropical Eastern Oysters during Cold Storage. Int. J. Environ. Res. Public Health 2020, 17, 1836. https://doi.org/10.3390/ijerph17061836
Alarcón Elvira F, Pardío Sedas VT, Martínez Herrera D, Quintana Castro R, Oliart Ros RM, López Hernández K, Flores Primo A, Ramírez Elvira K. Comparative Survival and the Cold-Induced Gene Expression of Pathogenic and Nonpathogenic Vibrio Parahaemolyticus from Tropical Eastern Oysters during Cold Storage. International Journal of Environmental Research and Public Health. 2020; 17(6):1836. https://doi.org/10.3390/ijerph17061836
Chicago/Turabian StyleAlarcón Elvira, Francisco, Violeta T. Pardío Sedas, David Martínez Herrera, Rodolfo Quintana Castro, Rosa María Oliart Ros, Karla López Hernández, Argel Flores Primo, and Karen Ramírez Elvira. 2020. "Comparative Survival and the Cold-Induced Gene Expression of Pathogenic and Nonpathogenic Vibrio Parahaemolyticus from Tropical Eastern Oysters during Cold Storage" International Journal of Environmental Research and Public Health 17, no. 6: 1836. https://doi.org/10.3390/ijerph17061836
APA StyleAlarcón Elvira, F., Pardío Sedas, V. T., Martínez Herrera, D., Quintana Castro, R., Oliart Ros, R. M., López Hernández, K., Flores Primo, A., & Ramírez Elvira, K. (2020). Comparative Survival and the Cold-Induced Gene Expression of Pathogenic and Nonpathogenic Vibrio Parahaemolyticus from Tropical Eastern Oysters during Cold Storage. International Journal of Environmental Research and Public Health, 17(6), 1836. https://doi.org/10.3390/ijerph17061836