Transcriptional Analysis of Chlorella pyrenoidosa Exposed to Bisphenol A
Abstract
:1. Introduction
2. Materials and Methods
2.1. Algal Strains and Growth Conditions
2.2. Experimental Process
2.3. Growth and Chlorophyll Fluorescence Analysis
2.4. RNA Extraction and cDNA Library Construction
2.5. Analysis of Differentially Expressed Genes
2.6. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.7. Statistical Analysis
3. Results
3.1. Effects of Bisphenol A (BPA) on Growth and Photosynthetic Efficiency of Algae
3.2. Global Transcriptional Changes of C. pyrenoidosa
3.3. Differentially Expressed Genes (DEGs) Exposed to Low Concentration of BPA
3.4. DEGs Exposed to High Concentration of BPA
3.5. RT-qPCR for Analysis of Expression of Related Genes
4. Discussion
4.1. Effects of BPA on Growth Inhibition
4.2. Molecular Response to Low Concentration of BPA
4.3. Molecular Response to High Concentration of BPA
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Nomiri, S.; Hoshyar, R.; Ambrosino, C.; Tyler, C.R.; Mansouri, B. A mini review of bisphenol A (BPA) effects on cancer-related cellular signaling pathways. Environ. Sci. Pollut. Res. 2019. [Google Scholar] [CrossRef]
- Amaral Mendes, J.J. The endocrine disrupters: A major medical challenge. Food Chem. Toxicol. 2002, 40, 781–788. [Google Scholar] [CrossRef]
- Vandenberg, L.N.; Hauser, R.; Marcus, M.; Olea, N.; Welshons, W.V. Human exposure to bisphenol A (BPA). Reprod. Toxicol. 2007, 24, 139–177. [Google Scholar] [CrossRef] [PubMed]
- Eladak, S.; Grisin, T.; Moison, D.; Guerquin, M.-J.; N’Tumba-Byn, T.; Pozzi-Gaudin, S.; Benachi, A.; Livera, G.; Rouiller-Fabre, V.; Habert, R. A new chapter in the bisphenol A story: Bisphenol S and bisphenol F are not safe alternatives to this compound. Fertility Sterility 2015, 103, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Burridge, E. Bisphenol A: Product profile. Eur. Chem. News 2003, 17, 14–20. [Google Scholar]
- Jiao, F.R.; Sun, X.J.; Pang, Z.T. Production and Market Analysis of Bisphenol A. Chem. Ind. 2008, 26, 21–33. [Google Scholar]
- Kleywegt, S.; Pileggi, V.; Yang, P.; Hao, C.; Zhao, X.; Rocks, C.; Thach, S.; Cheung, P.; Whitehead, B. Pharmaceuticals, hormones and bisphenol A in untreated source and finished drinking water in Ontario, Canada—Occurrence and treatment efficiency. Sci. Total Environ. 2011, 409, 1481–1488. [Google Scholar] [CrossRef]
- Chapman, R.L. Algae: The world’s most important “plants”—An introduction. Mitig. Adapt. Strateg. Glob. Chang. 2013, 18, 5–12. [Google Scholar] [CrossRef]
- Nelson, Y.M.; Thampy, R.J.; Motelin, G.K.; Raini, J.A.; Disante, C.J.; Lion, L.W. Model for Trace Metal Exposure in Filter-Feeding Flamingos at Alkaline Rift Valley Lake, Kenya. Environ. Toxicol. Chem. 2010, 17, 2302–2309. [Google Scholar] [CrossRef]
- Xiang, K.; Wang, J.; Si, T.; Duan, S. Interference Effects of Bisphenol A on Platymonas helgolanidica. Asian J. Ecotoxicol. 2015, 10, 262–267. [Google Scholar] [CrossRef]
- Calabrese, E.J. Hormesis: Changing view of the dose-response, a personal account of the history and current status. Mutat. Res./Rev. Mutat. Res. 2002, 511, 181–189. [Google Scholar] [CrossRef]
- Dabney, B.L.; Patiño, R. Low-dose stimulation of growth of the harmful alga, Prymnesium parvum, by glyphosate and glyphosate-based herbicides. Harmful Algae 2018, 80, 130–139. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.; Cao, C.; Wang, C.; Zhang, H.; Deng, J.; Jiang, H. Response of bloom-forming cyanobacterium Microcystis aeruginosa to 17β-estradiol at different nitrogen levels. Chemosphere 2019, 219, 174–182. [Google Scholar] [CrossRef]
- Ji, M.K.; Kabra, A.N.; Choi, J.; Hwang, J.H.; Kim, J.R.; Abou-Shanab, R.A.I.; Oh, Y.K.; Jeon, B.H. Biodegradation of bisphenol A by the freshwater microalgae Chlamydomonas mexicana and Chlorella vulgaris. Ecol. Eng. 2014, 73, 260–269. [Google Scholar] [CrossRef]
- Wang, Z.; Hu, F.; Song, W.; Jing, G.; He, W.; Feng, D. Chronic toxic effect of three estrogens to algae (Scenedesmus obliquus). In Proceedings of the International Conference on Human Health & Biomedical Engineering, Jilin, China, 19–22 August 2011. [Google Scholar]
- Fan, J.; Xu, H.; Li, Y. Transcriptome-based global analysis of gene expression in response to carbon dioxide deprivation in the green algae Chlorella pyrenoidosa. Algal Res. 2016, 16, 12–19. [Google Scholar] [CrossRef]
- Qian, H.; Xu, J.; Lu, T.; Zhang, Q.; Qu, Q.; Yang, Z.; Pan, X. Responses of Unicellular Alga Chlorella pyrenoidosa to Allelochemical Linoleic Acid. Sci. Total Environ. 2018, 625, 1415–1422. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Li, K.; Zhu, Y.; Yang, W.; Zhou, J.; Cen, K. Transcriptome sequencing and metabolic pathways of astaxanthin accumulated in Haematococcus pluvialis mutant under 15% CO2. Bioresour. Technol. 2017, 228, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Diao, P.; Chen, Q.; Wu, H.; Xu, N.; Duan, S. Identification of novel pathways for biodegradation of bisphenol A by the green alga Desmodesmus sp.WR1, combined with mechanistic analysis at the transcriptome level. Chem. Eng. J. 2017, 321, 424–431. [Google Scholar] [CrossRef]
- Santabarbara, S.; Villafiorita Monteleone, F.; Remelli, W.; Rizzo, F.; Menin, B.; Casazza, A.P. Comparative excitation-emission dependence of the FV/FM ratio in model green algae and cyanobacterial strains. Physiol. Plant. 2019. [Google Scholar] [CrossRef]
- Zhang, W.; Xiong, B.; Sun, W.-F.; An, S.; Lin, K.-F.; Guo, M.-J.; Cui, X.-H. Acute and chronic toxic effects of bisphenol a on Chlorella pyrenoidosa and Scenedesmus obliquus. Environ. Toxicol. 2014, 29, 714–722. [Google Scholar] [CrossRef]
- Lu, T.; Zhu, Y.; Xu, J.; Ke, M.; Zhang, M.; Tan, C.; Fu, Z.; Qian, H. Evaluation of the toxic response induced by azoxystrobin in the non-target green alga Chlorella pyrenoidosa. Environ. Pollut. 2018, 234, 379–388. [Google Scholar] [CrossRef]
- Li, R.; Chen, G.-Z.; Tam, N.F.Y.; Luan, T.-G.; Shin, P.K.S.; Cheung, S.G.; Liu, Y. Toxicity of bisphenol A and its bioaccumulation and removal by a marine microalga Stephanodiscus hantzschii. Ecotoxicol. Environ. Saf. 2009, 72, 321–328. [Google Scholar] [CrossRef]
- Zhu, Z.-L.; Wang, S.-C.; Zhao, F.-F.; Wang, S.-G.; Liu, F.-F.; Liu, G.-Z. Joint toxicity of microplastics with triclosan to marine microalgae Skeletonema costatum. Environ. Pollut. 2019, 246, 509–517. [Google Scholar] [CrossRef]
- Zhang, Y.; Guo, J.; Yao, T.; Zhang, Y.; Zhou, X.; Chu, H. The influence of four pharmaceuticals on Chlorellapyrenoidosa culture. Sci. Rep. 2019, 9, 1624. [Google Scholar] [CrossRef] [PubMed]
- Chance, B.; Williams, G.R. The respiratory chain and oxidative phosphorylation. Adv. Enzymol. Relat. Areas Mol. Biol. 1956, 17, 65–134. [Google Scholar]
- Yao, C.-H.; Wang, R.; Wang, Y.; Kung, C.-P.; Weber, J.D.; Patti, G.J. Mitochondrial fusion supports increased oxidative phosphorylation during cell proliferation. eLife 2019, 8, e41351. [Google Scholar] [CrossRef] [PubMed]
- Márquez-Jurado, S.; Díaz-Colunga, J.; Neves, R.P.; Martinez-Lorente, A.; Almazán, F.; Guantes, R.; Iborra, F.J. Mitochondrial levels determine variability in cell death by modulating apoptotic gene expression. Nat. Commun. 2018, 9, 389. [Google Scholar] [CrossRef]
- Zuo, J.; Lei, M.; Wen, M.; Chen, Y.; Liu, Z. Overexpression of ATP5b promotes cell proliferation in asthma. Mol. Med. Rep. 2017, 16, 6946. [Google Scholar] [CrossRef]
- Crouch, S.P.M.; Kozlowski, R.; Slater, K.J.; Fletcher, J. The use of ATP bioluminescence as a measure of cell proliferation and cytotoxicity. J. Immunol. Methods 1993, 160, 81. [Google Scholar] [CrossRef]
- Jones, R.G.; Thompson, C.B. Tumor suppressors and cell metabolism: A recipe for cancer growth. Genes Dev. 2009, 23, 537–548. [Google Scholar] [CrossRef] [PubMed]
- Pillai, S.; Behra, R.; Nestler, H.; Suter, M.J.-F.; Sigg, L.; Schirmer, K. Linking toxicity and adaptive responses across the transcriptome, proteome, and phenotype of Chlamydomonas reinhardtii exposed to silver. Proc. Natl. Acad. Sci. USA 2014, 111, 3490–3495. [Google Scholar] [CrossRef]
- Weiss, H.; Friedrich, T.; Hofhaus, G.; Preis, D. The Respiratory-Chain NADH Dehydrogenase (Complex I) of Mitochondria. Eur. J. Biochem. 1991, 197, 563–576. [Google Scholar] [CrossRef]
- Nakagawa, Y.; Tayama, S. Metabolism and cytotoxicity of bisphenol A and other bisphenols in isolated rat hepatocytes. Arch. Toxicol. 2000, 74, 99–105. [Google Scholar] [CrossRef]
- Volarević, S.; Stewart, M.J.; Ledermann, B.; Zilberman, F.; Terracciano, L.; Montini, E.; Grompe, M.; Kozma, S.C.; Thomas, G. Proliferation, but not growth, blocked by conditional deletion of 40S ribosomal protein S6. Science 2000, 288, 2045–2047. [Google Scholar] [CrossRef] [PubMed]
- Fernie, A.R.; Carrari, F.; Sweetlove, L. Respiratory Metabolism: Glycolysis, the TCA Cycle and Mitochondrial Electron Transport. Curr. Opin. Plant Biol. 2004, 7, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Walsh, K.; Koshland, D.E., Jr. Characterization of rate-controlling steps in vivo by use of an adjustable expression vector. Proc. Natl. Acad. Sci. USA 1985, 82, 3577–3581. [Google Scholar] [CrossRef] [PubMed]
- Al-Khallaf, H. Isocitrate dehydrogenases in physiology and cancer: Biochemical and molecular insight. Cell Biosci. 2017, 7, 37. [Google Scholar] [CrossRef]
- Sweetlove, L.J.; Beard, K.F.M.; Nunes-Nesi, A.; Fernie, A.R.; Ratcliffe, R.G. Not just a circle: Flux modes in the plant TCA cycle. Trends Plant Sci. 2010, 15, 462–470. [Google Scholar] [CrossRef] [PubMed]
- Hansen, H.J.M.; Carey, E.M.; Dils, R. Fatty acid biosynthesis. VIII. The fate of malonyl-CoA in fatty acid biosynthesis by purified enzymes from lactating-rabbit mammary gland. Biochim. Biophys. Acta 1971, 248, 391–405. [Google Scholar] [CrossRef]
- Xiang, R.; Shi, J.; Zhang, H.; Dong, C.; Liu, L.; Fu, J.; He, X.; Yan, Y.; Wu, Z. Chlorophyll a Fluorescence and Transcriptome Reveal the Toxicological Effects of Bisphenol A on an Invasive Cyanobacterium, Cylindrospermopsis Raciborskii. Aquat. Toxicol. 2018, 200, 188–196. [Google Scholar] [CrossRef]
- Jiang, Y.; Liu, J.; Li, Y.; Chang, H.; Li, G.; Xu, B.; Chen, X.; Li, W.; Xia, W.; Xu, S. Prenatal exposure to bisphenol A at the reference dose impairs mitochondria in the heart of neonatal rats. J. Appl. Toxicol. 2014, 34, 1012–1022. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence (5′–3′) |
---|---|
18S (Control) | F:TGGTGCCCTTCCGTCAAT |
R:CGGCACCTTACGAGAAATCA | |
Adenosine triphosphate (ATP) Synthase | F:GAAGTCGGCAATGGTGTCC |
R:CTGGGAGATGAGCACTACGG | |
Nicotinamide adenine dinucleotide (NADH) dehydrogenase | F:ATCAAGGAAAAGCAGGGGCA |
R:TGTCCCAAAGCATGAAGGCA | |
PsbA (photosystem II D1 protein) | F:TGAACGAGAGTTGTTGAAAGAAGC |
R:TGCTTGGTGTTGCTGGTGTA |
GO ID | Description | p-Value |
---|---|---|
T1-UP | ||
GO:0044765 | single-organism transport | 0.0015563 |
GO:1902578 | single-organism localization | 0.0017646 |
GO:0006810 | transport | 0.0020785 |
GO:0005840 | ribosome | 0.0022349 |
GO:0016843 | amine-lyase activity | 0.0049691 |
GO:0015858 | nucleoside transport | 0.0052014 |
GO:0005198 | structural molecule activity | 0.0071512 |
GO:0045333 | cellular respiration | 0.007919 |
GO:0051234 | establishment of localization | 0.0081377 |
T2-UP | ||
GO:0042995 | cell projection | 3.81 × 10−6 |
GO:0033013 | tetrapyrrole metabolic process | 1.18 × 10−5 |
GO:0051186 | cofactor metabolic process | 2.35 × 10−5 |
GO:0098796 | membrane protein complex | 2.56 × 10−5 |
GO:0006778 | porphyrin-containing compound metabolic process | 3.79 × 10−5 |
GO:0044422 | organelle part | 9.72 × 10−5 |
T2-DOWN | ||
GO:0009081 | branched-chain amino acid metabolic process | 0.0059409 |
GO:0016301 | kinase activity | 9.19 × 10−6 |
GO:0036094 | small molecule binding | 0.0001015 |
GO:0016773 | phosphotransferase activity, alcohol group as acceptor | 0.0001521 |
GO:0016772 | transferase activity, transferring phosphorus-containing groups | 0.0003224 |
GO:0001883 | purine nucleoside binding | 0.000369 |
GO:0032549 | ribonucleoside binding | 0.000369 |
GO:0032550 | purine ribonucleoside binding | 0.000369 |
GO:0019899 | enzyme binding | 0.0004276 |
GO:0004672 | protein kinase activity | 0.0004357 |
GO:0017016 | Ras GTPase binding | 0.0004891 |
GO:0031267 | small GTPase binding | 0.0004891 |
GO:0051020 | GTPase binding | 0.0004891 |
GO:0001882 | nucleoside binding | 0.0005225 |
GO:0097367 | carbohydrate derivative binding | 0.0006553 |
GO:0031981 | nuclear lumen | 0.0092762 |
GO:0043233 | organelle lumen | 0.0092762 |
GO:0070013 | intracellular organelle lumen | 0.0092762 |
Pathway | Upregulated | Downregulated | p-Value |
---|---|---|---|
T1vsCK | |||
Ribosome | 11 | 2 | 0.000351118 |
Oxidative phosphorylation | 8 | / | 0.001435787 |
Sulfur metabolism | 4 | / | 0.002234359 |
Propanoate metabolism | 3 | 1 | 0.008392114 |
Carbon metabolism | 8 | 1 | 0.01697323 |
Sulfur relay system | 1 | 1 | 0.03425709 |
Cysteine and methionine metabolism | 4 | / | 0.03562303 |
Microbial metabolism in diverse environments | 9 | 1 | 0.03764153 |
Biosynthesis of antibiotics | 10 | 1 | 0.0470081 |
T2vsCK | |||
Amino sugar and nucleotide sugar metabolism | 3 | 59 | 9.38 × 10−5 |
Photosynthesis-antenna proteins | 21 | 22 | 0.000106969 |
Fatty acid degradation | 13 | 30 | 0.000759285 |
Galactose metabolism | 10 | 26 | 0.003986388 |
Microbial metabolism in diverse environments | 58 | 213 | 0.004257043 |
Biosynthesis of unsaturated fatty acids | 9 | 26 | 0.007765076 |
Valine, leucine and isoleucine degradation | 12 | 44 | 0.008513731 |
Ether lipid metabolism | 5 | 15 | 0.008521474 |
Fructose and mannose metabolism | 13 | 29 | 0.00854504 |
Biosynthesis of antibiotics | 55 | 259 | 0.009106183 |
Fatty acid metabolism | 21 | 47 | 0.01303567 |
Valine, leucine and isoleucine biosynthesis | 1 | 31 | 0.01553805 |
DNA replication | 5 | 52 | 0.0200779 |
Metabolic pathways | 204 | 919 | 0.02039731 |
alpha-Linolenic acid metabolism | 6 | 19 | 0.02238955 |
Sphingolipid metabolism | 7 | 25 | 0.0240593 |
Biosynthesis of secondary metabolites | 117 | 416 | 0.03031573 |
Peroxisome | 18 | 62 | 0.0312795 |
Carbon metabolism | 46 | 151 | 0.04453267 |
Nitrogen metabolism | 6 | 19 | 0.04458744 |
Pyruvate metabolism | 18 | 57 | 0.04607645 |
K-ID | Gene ID | Annotation | log2 Ratio | p-Value |
---|---|---|---|---|
Citrate Cycle (TCA Cycle) | ||||
K00030 | 0047088 | IDH3; isocitrate dehydrogenase (NAD+) | −1.33141 | 6.5 × 10−7 |
K00031 | 0059207 | IDH1, IDH2, icd; isocitrate dehydrogenase | −1.31562 | 4.1 × 10−14 |
K00161 | 0045616 | PDHA, pdhA; pyruvate dehydrogenase E1 component alpha subunit | −8.30485 | 0.00024 |
K00162 | 0053032 | PDHB, pdhB; pyruvate dehydrogenaseE1 component beta subunit | −1.17676 | 1.4 × 10−8 |
K01647 | 0010385 | CS, gltA; citrate synthase | −1.81821 | 5.8 × 10−11 |
Glycolysis | ||||
K00134 | 0018211 | GAPDH, gapA; glyceraldehyde 3-phosphate dehydrogenase | −2.95214 | 0.01767 |
K00850 | 0047002 | pfkA, PFK; 6-phosphofructokinase 1 | −1.51129 | 7.6 × 10−10 |
Oxidative phosphorylation | ||||
K00234 | 0003771 | SDHA, SDH1; succinate dehydrogenase (ubiquinone) flavoprotein subunit | −1.06437 | 1.1 × 10−11 |
K00235 | 0044774 | SDHB, SDH2; succinate dehydrogenase (ubiquinone) iron-sulfur subunit | −1.01169 | 2.3 × 10−8 |
K02256 | 0064509 | COX1; cytochrome c oxidase subunit 1 | −5.49004 | 1.2 × 10−10 |
K02261 | 0028443 | COX2; cytochrome c oxidase subunit 2 | −2.62114 | 0.01281 |
K09034 | 0047163 | NDUFB10; NADH dehydrogenase (ubiquinone) 1 beta subcomplex subunit 10 | −1.32268 | 4.45 × 10−15 |
K02132 | 0050561 | ATPF1B, atpD; F-type H+-transporting ATPase subunit beta | −1.32455 | 4.6 × 10−11 |
Fatty acid metabolism | ||||
K01962 | 0058323 | accA; acetyl-CoA carboxylase carboxyl transferase subunit alpha | −1.15419 | 4.2 × 10−8 |
K02160 | 0053179 | accB, bccP; acetyl-CoA carboxylase biotin carboxyl carrier protein | −1.16966 | 0.00244 |
K00645 | 0016765 | fabD; | −9.43886 | 4.2 × 10−45 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duan, L.; Chen, Q.; Duan, S. Transcriptional Analysis of Chlorella pyrenoidosa Exposed to Bisphenol A. Int. J. Environ. Res. Public Health 2019, 16, 1374. https://doi.org/10.3390/ijerph16081374
Duan L, Chen Q, Duan S. Transcriptional Analysis of Chlorella pyrenoidosa Exposed to Bisphenol A. International Journal of Environmental Research and Public Health. 2019; 16(8):1374. https://doi.org/10.3390/ijerph16081374
Chicago/Turabian StyleDuan, Leyi, Qi Chen, and Shunshan Duan. 2019. "Transcriptional Analysis of Chlorella pyrenoidosa Exposed to Bisphenol A" International Journal of Environmental Research and Public Health 16, no. 8: 1374. https://doi.org/10.3390/ijerph16081374