A Marine Collagen-Based Biomimetic Hydrogel Recapitulates Cancer Stem Cell Niche and Enhances Progression and Chemoresistance in Human Ovarian Cancer
Abstract
1. Introduction
2. Results
2.1. Formation and Growth of OC Cell Spheroids Are Promoted in MC-B Hydrogels
2.2. Proliferation and Colony Formation of OC Cells Are Enhanced in MC-B Hydrogels
2.3. Anticancer Drug-Induced Apoptosis of OC Cells Is Suppressed in MC-B Hydrogels
2.4. Metastatic Potentials of OC Cells Are Elevated in MC-B Hydrogels
2.5. Chemoresistance of OC Cells Is Increased in MC-B Hydrogels
2.6. Ovarian CSC Biomarker Expression Is Augmented in MC-B Hydrogels
2.7. Stemness and Pluripotency Marker Expression of OC Cells Is Enhanced in MC-B Hydrogels
2.8. Aggressiveness of OC Cells Is Reinforced in MC-B Hydrogels
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Synthesis of Hydrogels for 3D Cell Culture
4.3. Spheroid Growth Assay
4.4. Cell Proliferation Assay
4.5. Colony-Forming Assay
4.6. Wound-Healing Assay
4.7. Hydrogel Invasion Assay
4.8. Extraction of RNA and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
4.9. Western Blot Analysis
4.10. Flow Cytometry
4.11. Chemotherapeutic Sensitivity Assay
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Siegel, R.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef]
- Torre, L.A.; Trabert, B.; DeSantis, C.E.; Miller, K.D.; Samimi, G.; Runowicz, C.D.; Gaudet, M.M.; Jemal, A.; Siegel, R.L. Ovarian cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Ghoneum, A.; Afify, H.; Salih, Z.; Kelly, M.; Said, N. Role of tumor microenvironment in the pathobiology of ovarian cancer: Insights and therapeutic opportunities. Cancer Med. 2018, 7, 5047–5056. [Google Scholar] [CrossRef] [PubMed]
- Reid, B.M.; Permuth, J.B.; Sellers, T.A. Epidemiology of ovarian cancer: A review. Cancer Biol. Med. 2017, 14, 9–32. [Google Scholar] [CrossRef] [PubMed]
- Pokhriyal, R.; Hariprasad, R.; Kumar, L.; Hariprasad, G. Chemotherapy Resistance in Advanced Ovarian Cancer Patients. Biomark. Cancer 2019, 11, 1179299X19860815. [Google Scholar] [CrossRef] [PubMed]
- Bapat, S.A.; Mali, A.M.; Koppikar, C.B.; Kurrey, N.K. Stem and progenitor-like cells contribute to the aggressive behavior of human epithelial ovarian cancer. Cancer Res. 2005, 65, 3025–3029. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741–4751. [Google Scholar] [CrossRef] [PubMed]
- Abdullah, L.N.; Chow, E.K. Mechanisms of chemoresistance in cancer stem cells. Clin. Transl. Med. 2013, 2, 3. [Google Scholar] [CrossRef]
- Bai, X.; Ni, J.; Beretov, J.; Graham, P.; Li, Y. Cancer stem cell in breast cancer therapeutic resistance. Cancer Treat. Rev. 2018, 69, 152–163. [Google Scholar] [CrossRef]
- Shibue, T.; Weinberg, R.A. EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat. Rev. Clin. Oncol. 2017, 14, 611–629. [Google Scholar] [CrossRef]
- Li, F.; Tiede, B.; Massagué, J.; Kang, Y. Beyond tumorigenesis: Cancer stem cells in metastasis. Cell Res. 2007, 17, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Dieter, S.M.; Ball, C.R.; Hoffmann, C.M.; Nowrouzi, A.; Herbst, F.; Zavidij, O.; Abel, U.; Arens, A.; Weichert, W.; Brand, K. Distinct types of tumor-initiating cells from human colon cancer tumors and metastases. Cell Stem Cell 2011, 9, 357–365. [Google Scholar] [CrossRef] [PubMed]
- Steffensen, K.D.; Alvero, A.B.; Yang, Y.; Waldstrom, M.; Hui, P.; Holmberg, J.C.; Silasi, D.A.; Jakobsen, A.; Rutherford, T.; Mor, G. Prevalence of epithelial ovarian cancer stem cells correlates with recurrence in early-stage ovarian cancer. J. Oncol. 2011. [Google Scholar] [CrossRef] [PubMed]
- Lawson, D.A.; Bhakta, N.R.; Kessenbrock, K.; Prummel, K.D.; Yu, Y.; Takai, K.; Zhou, A.; Eyob, H.; Balakrishnan, S.; Wang, C.-Y. Single-cell analysis reveals a stem-cell program in human metastatic breast cancer cells. Nature 2015, 526, 131–135. [Google Scholar] [CrossRef] [PubMed]
- Aponte, P.M.; Caicedo, A. Stemness in Cancer: Stem Cells, Cancer Stem Cells, and Their Microenvironment. Stem Cells Int. 2017. [Google Scholar] [CrossRef]
- Lathia, J.; Liu, H.; Matei, D. The Clinical Impact of Cancer Stem Cells. Oncologist 2020, 25, 123–131. [Google Scholar] [CrossRef]
- Keyvani, V.; Farshchian, M.; Esmaeili, S.A.; Yari, H.; Moghbeli, M.; Nezhad, S.K.; Abbaszadegan, M.R. Ovarian cancer stem cells and targeted therapy. J. Ovarian Res. 2019, 12, 120. [Google Scholar] [CrossRef]
- Zong, X.; Nephew, K.P. Ovarian Cancer Stem Cells: Role in Metastasis and Opportunity for Therapeutic Targeting. Cancers 2019, 11, 934. [Google Scholar] [CrossRef]
- Liang, Z.M.; Chen, Y.; Luo, M.L. Targeting Stemness: Implications for Precision Medicine in Breast Cancer. Adv. Exp. Med. Biol. 2017, 1026, 147–169. [Google Scholar] [CrossRef]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.G.; Lee, S.H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem Cells Int. 2018. [Google Scholar] [CrossRef]
- Al-Alem, L.F.; Pandya, U.M.; Baker, A.T.; Bellio, C.; Zarrella, B.D.; Clark, J.; DiGloria, C.M.; Rueda, B.R. Ovarian cancer stem cells: What progress have we made? Int. J. Biochem. Cell Biol. 2019, 107, 92–103. [Google Scholar] [CrossRef]
- Bhaskara, V.K.; Mohanam, I.; Rao, J.S.; Mohanam, S. Intermittent hypoxia regulates stem-like characteristics and differentiation of neuroblastoma cells. PLoS ONE 2012, 7, e30905. [Google Scholar] [CrossRef]
- Hu, X.; Ghisolfi, L.; Keates, A.C.; Zhang, J.; Xiang, S.; Lee, D.K.; Li, C.J. Induction of cancer cell stemness by chemotherapy. Cell Cycle 2012, 11, 2691–2698. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Lai, D. Ovarian cancer stem cells enrichment. Methods Mol. Biol. 2013, 1049, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Bielecka, Z.F.; Maliszewska-Olejniczak, K.; Safir, I.J.; Szczylik, C.; Czarnecka, A.M. Three-dimensional cell culture model utilization in cancer stem cell research. Biol. Rev. Camb. Philos. Soc. 2017, 92, 1505–1520. [Google Scholar] [CrossRef] [PubMed]
- Katt, M.E.; Placone, A.L.; Wong, A.D.; Xu, Z.S.; Searson, P.C. In Vitro Tumor Models: Advantages, Disadvantages, Variables, and Selecting the Right Platform. Front. Bioeng. Biotechnol. 2016, 4, 12. [Google Scholar] [CrossRef]
- Jensen, C.; Teng, Y. Is It Time to Start Transitioning from 2D to 3D Cell Culture? Front. Mol. Biosci. 2020, 7, 33. [Google Scholar] [CrossRef]
- Gorgieva, S.; Kokol, V. Biomaterials Applications for Nanomedicine; InTech: London, UK, 2011; Chapter 2; pp. 17–52. ISBN 978-953-307661-4. [Google Scholar]
- Kular, J.K.; Basu, S.; Sharma, R.I. The extracellular matrix: Structure, composition, age-related differences, tools for analysis and applications for tissue engineering. J. Tissue Eng. 2014, 5, 1–17. [Google Scholar] [CrossRef]
- Brinckmann, J. Collagens at a Glance. Top. Curr. Chem. 2005, 247, 1–6. [Google Scholar] [CrossRef]
- Lee, C.H.; Singla, A.; Lee, Y. Biomedical applications of collagen. Int. J. Pharm. 2001, 221, 1–22. [Google Scholar] [CrossRef]
- Colchester, A.C.; Colchester, N.T. The origin of bovine spongiform encephalopathy: The human prion disease hypothesis. Lancet 2005, 366, 856–861. [Google Scholar] [CrossRef]
- Easterbrook, C.; Maddern, G. Porcine and bovine surgical products: Jewish, Muslim, and Hindu perspectives. Arch. Surg. 2008, 143, 366–370. [Google Scholar] [CrossRef] [PubMed]
- Yamada, S.; Yamamoto, K.; Ikeda, T.; Yanagiguchi, K.; Hayashi, Y. Potency of fish collagen as a scaffold for regenerative medicine. Biomed. Res. Int. 2014, 2014. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, K.; Igawa, K.; Sugimoto, K.; Yoshizawa, Y.; Yanagiguchi, K.; Ikeda, T.; Yamada, S.; Hayashi, Y. Biological safety of fish (tilapia) collagen. Biomed. Res. Int. 2014, 2014. [Google Scholar] [CrossRef]
- Lim, Y.S.; Ok, Y.J.; Hwang, S.Y.; Kwak, J.Y.; Yoon, S. Marine Collagen as A Promising Biomaterial for Biomedical Applications. Mar. Drugs. 2019, 17, 467. [Google Scholar] [CrossRef]
- Shin, S.; Ikram, M.; Subhan, F.; Kang, H.Y.; Lim, Y.; Lee, R.; Jin, S.; Jeong, Y.H.; Kwak, J.Y.; Na, Y.J.; et al. Alginate–marine collagen–agarose composite hydrogels as matrices for biomimetic 3D cell spheroid formation. RSC Adv. 2016, 6, 46952–46965. [Google Scholar] [CrossRef]
- Ikram, M.; Lim, Y.; Baek, S.Y.; Jin, S.; Jeong, Y.H.; Kwak, J.Y.; Yoon, S. Co-targeting of Tiam1/Rac1 and Notch ameliorates chemoresistance against doxorubicin in a biomimetic 3D lymphoma model. Oncotarget 2017, 9, 2058–2075. [Google Scholar] [CrossRef]
- Dudas, J.; Ladanyi, A.; Ingruber, J.; Steinbichler, T.B.; Riechelmann, H. Epithelial to Mesenchymal Transition: A Mechanism that Fuels Cancer Radio/Chemoresistance. Cells 2020, 9, 428. [Google Scholar] [CrossRef]
- Ribatti, D.; Tamma, R.; Annese, T. Epithelial-Mesenchymal Transition in Cancer: A Historical Overview. Transl. Oncol. 2020, 13, 100773. [Google Scholar] [CrossRef]
- Artacho-Cordon, A.; Artacho-Cordon, F.; Rios-Arrabal, S.; Calvente, I.; Nunez, M.I. Tumor microenvironment and breast cancer progression: A complex scenario. Cancer Biol. Ther. 2012, 13, 14–24. [Google Scholar] [CrossRef]
- Arvelo, F.; Sojo, F.; Cotte, C. Tumour progression and metastasis. Ecancermedicalscience 2016, 10, 617. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.B.; Stein, R.; O’Hare, M.J. Three-dimensional in vitro tissue culture models of breast cancer—A review. Breast Cancer Res. Treat. 2004, 85, 281–291. [Google Scholar] [CrossRef] [PubMed]
- Ocana, A.; Pandiella, A.; Siu, L.L.; Tannock, I.F. Preclinical development of molecular-targeted agents for cancer. Nat. Rev. Clin. Oncol. 2010, 8, 200–209. [Google Scholar] [CrossRef] [PubMed]
- Hutchinson, L.; Kirk, R. High drug attrition rates—Where are we going wrong? Nat. Rev. Clin. Oncol. 2011, 8, 189–190. [Google Scholar] [CrossRef]
- Herter-Sprie, G.S.; Kung, A.L.; Wong, K.K. New cast for a new era: Preclinical cancer drug development revisited. J. Clin. Investig. 2013, 123, 3639–3645. [Google Scholar] [CrossRef]
- Fong, M.Y.; Kakar, S.S. Ovarian cancer mouse models: A summary of current models and their limitations. J. Ovarian Res. 2009, 2, 12. [Google Scholar] [CrossRef]
- Bobbs, A.S.; Cole, J.M.; Dahl, K.D.C. Emerging and Evolving Ovarian Cancer Animal Models. Cancer Growth Metastasis 2015, 8, 29–36. [Google Scholar] [CrossRef][Green Version]
- Hasan, N.; Ohman, A.W.; Dinulescu, D.M. The promise and challenge of ovarian cancer models. Transl. Cancer Res. 2015, 4, 14–28. [Google Scholar] [CrossRef]
- Decaup, E.; Jean, C.; Laurent, C.; Gravelle, P.; Fruchon, S.; Capilla, F.; Marrot, A.; Al Saati, T.; Frenois, F.X.; Laurent, G.; et al. Anti-tumor activity of obinutuzumab and rituximab in a follicular lymphoma 3D model. Blood Cancer J. 2013, 3, e131. [Google Scholar] [CrossRef]
- Szakács, G.; Paterson, J.K.; Ludwig, J.A.; Booth-Genthe, C.; Gottesman, M.M. Targeting multidrug resistance in cancer. Nat. Rev. Drug Discov. 2006, 5, 219–234. [Google Scholar] [CrossRef]
- Barker, H.E.; Paget, J.T.; Khan, A.A.; Harrington, K.J. The tumour microenvironment after radiotherapy: Mechanisms of resistance and recurrence. Nat. Rev. Cancer 2015, 15, 409–425. [Google Scholar] [CrossRef]
- Jo, Y.; Choi, N.; Kim, K.; Koo, H.J.; Choi, J.; Kim, H.N. Chemoresistance of Cancer Cells: Requirements of Tumor Microenvironment-mimicking in Vitro Models in Anti-Cancer Drug Development. Theranostics 2018, 8, 5259–5275. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.H.; Yu, A.M. ABC transporters in multidrug resistance and pharmacokinetics, and strategies for drug development. Curr. Pharm. Des. 2014, 20, 793–807. [Google Scholar] [CrossRef] [PubMed]
- Wind, N.S.; Holen, I. Multidrug resistance in breast cancer: From in vitro models to clinical studies. Int. J. Breast Cancer 2011, 2011. [Google Scholar] [CrossRef] [PubMed]
- Enmon, R.; Yang, W.H.; Ballangrud, A.M.; Solit, D.B.; Heller, G.; Rosen, N.; Scher, H.I.; Sgouros, G. Combination treatment with 17-N-allylamino-17-demethoxy geldanamycin and acute irradiation produces supra-additive growth suppression in human prostate carcinoma spheroids. Cancer Res. 2003, 63, 8393–8399. [Google Scholar]
- Lambert, B.; De Ridder, L.; Slegers, G.; De Gelder, V.; Dierckx, R.A.; Thierens, H. Screening for supra-additive effects of cytotoxic drugs and gamma irradiation in an in vitro model for hepatocellular carcinoma. Can. J. Physiol. Pharmacol. 2004, 82, 146–152. [Google Scholar] [CrossRef]
- Friedrich, J.; Seidel, C.; Ebner, R.; Kunz-Schughart, L.A. Spheroid-based drug screen: Considerations and practical approach. Nat. Protoc. 2009, 4, 309–324. [Google Scholar] [CrossRef] [PubMed]
- Vinci, M.; Gowan, S.; Boxall, F.; Patterson, L.; Zimmermann, M.; Court, W.; Lomas, C.; Mendiola, M.; Hardisson, D.; Eccles, S.A. Advances in establishment and analysis of three-dimensional tumor spheroid-based functional assays for target validation and drug evaluation. BMC Biol. 2012, 10, 29. [Google Scholar] [CrossRef]
- Zanoni, M.; Piccinini, F.; Arienti, C.; Zamagni, A.; Santi, S.; Polico, R.; Bevilacqua, A.; Tesei, A. 3D tumor spheroid models for in vitro therapeutic screening: A systematic approach to enhance the biological relevance of data obtained. Sci. Rep. 2016, 6, 19103. [Google Scholar] [CrossRef]
- Brown, J.M. Tumor hypoxia in cancer therapy. Methods Enzymol. 2007, 435, 297–321. [Google Scholar] [CrossRef]
- Milane, L.; Ganesh, S.; Shah, S.; Duan, Z.F.; Amiji, M. Multi-modal strategies for overcoming tumor drug resistance: Hypoxia, the Warburg effect, stem cells, and multifunctional nanotechnology. J. Control. Release 2011, 155, 237–247. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.; Galluzzo, P.; Sobol, A.; Skucha, S.; Rambo, B.; Bocchetta, M. Multimodality Approaches to Treat Hypoxic Non-Small Cell Lung Cancer (NSCLC) Microenvironment. Genes Cancer 2012, 3, 141–151. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Ding, Z.; Peng, Y.; Pan, F.; Li, J.; Zou, L.; Zhang, Y.; Liang, H. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein. PLoS ONE 2014, 9, e98882. [Google Scholar] [CrossRef] [PubMed]
- Arnold, C.R.; Mangesius, J.; Skvortsova, I.I.; Ganswindt, U. The Role of Cancer Stem Cells in Radiation Resistance. Front. Oncol. 2020, 10, 164. [Google Scholar] [CrossRef]
- Nguyen, L.V.; Vanner, R.; Dirks, P.; Eaves, C.J. Cancer stem cells: An evolving concept. Nat. Rev. Cancer 2012, 12, 133–143. [Google Scholar] [CrossRef]
- Chen, K.; Huang, Y.H.; Chen, J.L. Understanding and targeting cancer stem cells: Therapeutic implications and challenges. Acta Pharmacol. Sin. 2013, 34, 732–740. [Google Scholar] [CrossRef]
- Prieto-Vila, M.; Takahashi, R.U.; Usuba, W.; Kohama, I.; Ochiya, T. Drug Resistance Driven by Cancer Stem Cells and Their Niche. Int. J. Mol. Sci. 2017, 18, 2574. [Google Scholar] [CrossRef]
- Atashzar, M.R.; Baharlou, R.; Karami, J.; Abdollahi, H.; Rezaei, R.; Pourramezan, F.; Zoljalali Moghaddam, S.H. Cancer stem cells: A review from origin to therapeutic implications. J. Cell. Physiol. 2019, 235, 2. [Google Scholar] [CrossRef]
- Zhao, J. Cancer stem cells and chemoresistance: The smartest survives the raid. Pharmacol. Ther. 2016, 160, 145–158. [Google Scholar] [CrossRef]
- Nedeljkovic, M.; Damjanivic, A. Mechanisms of Chemotherapy Resistance in Triple-Negative Breast Cancer—How We Can Rise to the Challenge. Cells 2019, 8, 957. [Google Scholar] [CrossRef]
- Barbato, L.; Bocchetti, M.; Di Biase, A.; Regad, T. Cancer Stem Cells and Targeting Strategies. Cells 2019, 8, 926. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.H.; Wang, X.; You, N.; Tao, K.S.; Wang, T.; Tang, L.J.; Dou, K.F. Efficient enrichment of hepatic cancer stem-like cells from a primary rat HCC model via a density gradient centrifugation-centered method. PLoS ONE 2012, 7, e35720. [Google Scholar] [CrossRef] [PubMed]
- O’Reilly, D.; Johnson, P.; Buchanan, P.J. Hypoxia induced cancer stem cell enrichment promotes resistance to androgen deprivation therapy in prostate cancer. Steroids 2019, 152, 108497. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Chen, I.; Shimoda, L.A.; Park, Y.; Zhang, C.; Tran, L.; Zhang, H.; Semenza, G.L. Chemotherapy-Induced Ca2+ Release Stimulates Breast Cancer Stem Cell Enrichment. Cell Rep. 2017, 18, 1946–1957. [Google Scholar] [CrossRef] [PubMed]
- Jiang, P.; Xu, C.; Zhou, M.; Zhou, H.; Dong, W.; Wu, X.; Chen, A.; Feng, Q. RXRα-enriched cancer stem cell-like properties triggered by CDDP in head and neck squamous cell carcinoma (HNSCC). Carcinogenesis 2018, 39, 252–262. [Google Scholar] [CrossRef]
- Zhou, B.; Jin, Y.; Zhang, D.; Lin, D. 5-Fluorouracil may enrich cancer stem cells in canine mammary tumor cells in vitro. Oncol. Lett. 2018, 15, 7987–7992. [Google Scholar] [CrossRef]
- Chien, C.Y.; Chuang, H.C.; Chen, C.H. The side population of cancer stem-like cells in human oral cancer. Oral Oncol. 2012, 48, 913–914. [Google Scholar] [CrossRef]
- Yasuda, K.; Torigoe, T.; Morita, R.; Kuroda, T.; Takahashi, A.; Matsuzaki, J.; Kochin, V.; Asanuma, H.; Hasegawa, T.; Saito, T.; et al. Ovarian cancer stem cells are enriched in side population and aldehyde dehydrogenase bright overlapping population. PLoS ONE 2013, 8, e68187. [Google Scholar] [CrossRef]
- Jiménez, G.; Hackenberg, M.; Catalina, P.; Boulaiz, H.; Griñán-Lisón, C.; García, M.Á.; Perán, M.; López-Ruiz, E.; Ramírez, A.; Morata-Tarifa, C.; et al. Mesenchymal stem cell’s secretome promotes selective enrichment of cancer stem-like cells with specific cytogenetic profile. Cancer Lett. 2018, 429, 78–88. [Google Scholar] [CrossRef]
- Yaiza, J.M.; Gloria, R.A.; María Belén, G.O.; Elena, L.R.; Gema, J.; Juan Antonio, M.; María Ángel, G.C.; Houria, B. Melanoma cancer stem-like cells: Optimization method for culture, enrichment and maintenance. Tissue Cell 2019, 60, 48–59. [Google Scholar] [CrossRef]
- Watanabe, Y.; Yoshimura, K.; Yoshikawa, K.; Tsunedomi, R.; Shindo, Y.; Matsukuma, S.; Maeda, N.; Kanekiyo, S.; Suzuki, N.; Kuramasu, A.; et al. A stem cell medium containing neural stimulating factor induces a pancreatic cancer stem-like cell-enriched population. Int. J. Oncol. 2014, 45, 1857–1866. [Google Scholar] [CrossRef] [PubMed]
- Weitzenfeld, P.; Meshel, T.; Ben-Baruch, A. Microenvironmental networks promote tumor heterogeneity and enrich for metastatic cancer stem-like cells in Luminal-A breast tumor cells. Oncotarget 2016, 7, 81123–81143. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Goyette, S.; Liang, Y.; Mafuvadze, B.; Cook, M.T.; Munir, M.; Hyder, S.M. Natural and synthetic progestins enrich cancer stem cell-like cells in hormone-responsive human breast cancer cell populations in vitro. Breast Cancer 2017, 9, 347–357. [Google Scholar] [CrossRef]
- Lu, H.; Tran, L.; Park, Y.; Chen, I.; Lan, J.; Xie, Y.; Semenza, G.L. Reciprocal Regulation of DUSP9 and DUSP16 Expression by HIF1 Controls ERK and p38 MAP Kinase Activity and Mediates Chemotherapy-Induced Breast Cancer Stem Cell Enrichment. Cancer Res. 2018, 78, 4191–4202. [Google Scholar] [CrossRef]
- Saltanatpour, Z.; Johari, B.; Alizadeh, A.; Lotfinia, M.; Majidzadeh-A, K.; Nikbin, B.; Kadivar, M. Enrichment of cancer stem-like cells by the induction of epithelial-mesenchymal transition using lentiviral vector carrying E-cadherin shRNA in HT29 cell line. J. Cell. Physiol. 2019, 234, 22935–22946. [Google Scholar] [CrossRef] [PubMed]
- Abbasian, M.; Mousavi, E.; Khalili, M.; Arab-Bafrani, Z. Using of keratin substrate for enrichment of HT29 colorectal cancer stem-like cells. J. Biomed. Mater. Res. B Appl. Biomater. 2019, 107, 1264–1271. [Google Scholar] [CrossRef]
- Bellio, C.; DiGloria, C.; Foster, R.; James, K.; Konstantinopoulos, P.A.; Growdon, W.B.; Rueda, B.R. PARP Inhibition Induces Enrichment of DNA Repair-Proficient CD133 and CD117 Positive Ovarian Cancer Stem Cells. Mol. Cancer Res. 2019, 17, 431–445. [Google Scholar] [CrossRef]
- Yang, J.; Yang, L.; Li, S.; Hu, N. HGF/c-Met Promote Renal Carcinoma Cancer Stem Cells Enrichment through Upregulation of Cir-CCDC66. Technol. Cancer Res. Treat. 2020, 19. [Google Scholar] [CrossRef]
- McKee, C.; Chaudhry, G.R. Advances and challenges in stem cell culture. Colloids Surf. B Biointerfaces 2017, 159, 62–77. [Google Scholar] [CrossRef] [PubMed]
- Sart, S.; Tsai, A.C.; Li, Y.; Ma, T. Three-dimensional aggregates of mesenchymal stem cells: Cellular mechanisms, biological properties, and applications. Tissue Eng. Part B Rev. 2014, 365–380. [Google Scholar] [CrossRef] [PubMed]
- Boo, L.; Ho, W.Y.; Ali, N.M.; Yeap, S.K.; Ky, H.; Chan, K.G.; Yin, W.F.; Satharasinghe, D.A.; Liew, W.C.; Tan, S.W.; et al. MiRNA Transcriptome Profiling of Spheroid-Enriched Cells with Cancer Stem Cell Properties in Human Breast MCF-7 Cell Line. Int. J. Biol. Sci. 2016, 12, 427–445. [Google Scholar] [CrossRef] [PubMed]
- Van de Walle, A.; Wilhelm, C.; Luciani, N. 3D Magnetic Stem Cell Aggregation and Bioreactor Maturation for Cartilage Regeneration. J. Vis. Exp. 2017, 122, 55221. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Sung, J.S.; Park, Y.S.; Chung, S.; Kim, Y.H. Isolation of spheroid-forming single cells from gastric cancer cell lines: Enrichment of cancer stem-like cells. Biotechniques 2018, 65, 197–203. [Google Scholar] [CrossRef] [PubMed]
- Balla, M.M.S.; Yadav, H.D.; Pandey, B.N. Tumorsphere assay provides a better in vitro method for cancer stem-like cells enrichment in A549 lung adenocarcinoma cells. Tissue Cell 2019, 60, 21–24. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Wu, D.; Wang, Y.; Wang, Z.; Zou, C.; Dai, Y.; Ng, C.F.; Teoh, J.Y.; Chan, F.L. Development of a novel and economical agar-based non-adherent three-dimensional culture method for enrichment of cancer stem-like cells. Stem Cell Res. Ther. 2018, 9, 243. [Google Scholar] [CrossRef]
- Herheliuk, T.; Perepelytsina, O.; Ugnivenko, A.; Ostapchenko, L.; Sydorenko, M. Investigation of multicellular tumor spheroids enriched for a cancer stem cell phenotype. Stem Cell Investig. 2019, 6, 21. [Google Scholar] [CrossRef]
- Ma, X.L.; Sun, Y.F.; Wang, B.L.; Shen, M.N.; Zhou, Y.; Chen, J.W.; Hu, B.; Gong, Z.J.; Zhang, X.; Cao, Y.; et al. Sphere-forming culture enriches liver cancer stem cells and reveals Stearoyl-CoA desaturase 1 as a potential therapeutic target. BMC Cancer 2019, 19, 760. [Google Scholar] [CrossRef]
- Ward Rashidi, M.R.; Mehta, P.; Bregenzer, M.; Raghavan, S.; Fleck, E.M.; Horst, E.N.; Harissa, Z.; Ravikumar, V.; Brady, S.; Bild, A.; et al. Engineered 3D Model of Cancer Stem Cell Enrichment and Chemoresistance. Neoplasia 2019, 21, 822–836. [Google Scholar] [CrossRef]
- Zweigerdt, R.; Olmer, R.; Singh, H.; Haverich, A.; Martin, U. Scalable expansion of human pluripotent stem cells in suspension culture. Nat. Protoc. 2011, 6, 689–700. [Google Scholar] [CrossRef]
- Gong, X.; Lin, C.; Cheng, J.; Su, J.; Zhao, H.; Liu, T.; Wen, X.; Zhao, P. Generation of Multicellular Tumor Spheroids with Microwell-Based Agarose Scaffolds for Drug Testing. PLoS ONE 2015, 10, e0130348. [Google Scholar] [CrossRef]
- Abe-Fukasawa, N.; Otsuka, K.; Aihara, A.; Itasaki, N.; Nishino, T. Novel 3D Liquid Cell Culture Method for Anchorage-independent Cell Growth, Cell Imaging and Automated Drug Screening. Sci. Rep. 2018, 8, 3627. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.W.; Chen, L.; Liu, J.X.; Huang, J.W.; Wu, G.; Zheng, Y.F.; Yao, K.T. A novel three-dimensional tumorsphere culture system for the efficient and low-cost enrichment of cancer stem cells with natural polymers. Exp. Ther. Med. 2018, 15, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Kievit, F.M.; Florczyk, S.J.; Leung, M.C.; Wang, K.; Wu, J.D.; Silber, J.R.; Ellenbogen, R.G.; Lee, J.S.; Zhang, M. Proliferation and enrichment of CD133(+) glioblastoma cancer stem cells on 3D chitosan-alginate scaffolds. Biomaterials 2014, 35, 9137–9143. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.C.; Chang, J.F. Label-free selection and enrichment of liver cancer stem cells by surface niches build up with polyelectrolyte multilayer films. Colloids Surf. B Biointerfaces 2015, 125, 120–126. [Google Scholar] [CrossRef]
- Lee, I.C.; Chuang, C.C.; Wu, Y.C. Niche Mimicking for Selection and Enrichment of Liver Cancer Stem Cells by Hyaluronic Acid-Based Multilayer Films. ACS Appl. Mater. Interfaces 2015, 7, 22188–22195. [Google Scholar] [CrossRef]
- Florczyk, S.J.; Kievit, F.M.; Wang, K.; Erickson, A.E.; Ellenbogen, R.G.; Zhang, M. 3D Porous Chitosan-Alginate Scaffolds Promote Proliferation and Enrichment of Cancer Stem-Like Cells. J. Mater. Chem. B 2016, 4, 6326–6334. [Google Scholar] [CrossRef]
- Palomeras, S.; Rabionet, M.; Ferrer, I.; Sarrats, A.; Garcia-Romeu, M.L.; Puig, T.; Ciurana, J. Breast Cancer Stem Cell Culture and Enrichment Using Poly(ε-Caprolactone) Scaffolds. Molecules 2016, 21, 537. [Google Scholar] [CrossRef]
- Bahmad, H.F.; Cheaito, K.; Chalhoub, R.M.; Hadadeh, O.; Monzer, A.; Ballout, F.; El-Hajj, A.; Mukherji, D.; Liu, Y.N.; Daoud, G.; et al. Sphere-Formation Assay: Three-Dimensional in vitro Culturing of Prostate Cancer Stem/Progenitor Sphere-Forming Cells. Front. Oncol. 2018, 8, 347. [Google Scholar] [CrossRef]
- Guo, X.; Chen, Y.; Ji, W.; Chen, X.; Li, C.; Ge, R. Enrichment of cancer stem cells by agarose multi-well dishes and 3D spheroid culture. Cell Tissue Res. 2019, 375, 397–408. [Google Scholar] [CrossRef]
- Tan, S.; Yamashita, A.; Gao, S.J.; Kurisawa, M. Hyaluronic acid hydrogels with defined crosslink density for the efficient enrichment of breast cancer stem cells. Acta Biomater. 2019, 94, 320–329. [Google Scholar] [CrossRef]
- Tosello, V.; Ferrando, A.A. The NOTCH signaling pathway: Role in the pathogenesis of T-cell acute lymphoblastic leukemia and implication for therapy. Ther. Adv. Hematol. 2013, 4, 199–210. [Google Scholar] [CrossRef]
- Wang, Z.; Li, Y.; Ahmad, A.; Azmi, A.S.; Banerjee, S.; Kong, D.; Sarkar, F.H. Targeting Notch signaling pathway to overcome drug resistance for cancer therapy. Biochim. Biophys. Acta 2010, 1806, 258–267. [Google Scholar] [CrossRef] [PubMed]
- Cho, S.; Lu, M.; He, X.; Ee, P.L.R.; Bhat, U.; Schneider, E.; Miele, L.; Beck, W.T. Notch1 regulates the expression of the multidrug resistance gene ABCC1/MRP1 in cultured cancer cells. Proc. Natl. Acad. Sci. USA 2011, 108, 20778–20783. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Chen, Y.; Li, J.; Zhang, K.; Chen, J.; Chen, D.; Feng, B.; Song, H.; Feng, J.; Wang, R.; et al. Notch-1 Confers Chemoresistance in Lung Adenocarcinoma to Taxanes through AP-1/microRNA-451 Mediated Regulation of MDR-1. Mol. Ther. Nucleic Acids 2016, 5, e375. [Google Scholar] [CrossRef] [PubMed]










| Gene Name | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| KLF4 | GGCACTACCGTAAACACACG | CTGGCAGTGTGGGTCATATC |
| MDR1 | GAGCCTACTTGGTGGCACAT | TCCTTCCAATGTGTTCGGCA |
| MRP1 | AATGCGCCAAGACTAGGAAG | ACCGGAGGATGTTGAACAAG |
| Nanog | GTCTTCTGCTGAGATGCCTCACA | CTTCTGCGTCACACCATTGCTAT |
| Notch-1 | TACAAGTGCGACTGTGACCC | CACACGTAGCCACTGGTCAT |
| Notch-2 | CAACCGCAATGGAGGCTATG | GCGAAGGCACAATCATCAATGTT |
| Oct4 | ATCCTGGGGGTTCTATTTGG | TCTCCAGGTTGCCTCTCACT |
| Slug | GGTCAAGAAGCATTTCAAC | GGTAATGTGTGGGTCCGA |
| Snail | AGACCCACTCAGATGTCAA | CATAGTTAGTCACACCTCGT |
| Sox2 | AACCAGCGCATGGACAGTTA | GACTTGACCACCGAACCCAT |
| Twist | GTCCGCAGTCTTACGAGGAG | GCTTGAGGGTCTGAATCTTGCT |
| GAPDH | AAGTGGATATTGTTGCCATC | ACTGTGGTCATGAGTCCTTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moon, S.; Ok, Y.; Hwang, S.; Lim, Y.S.; Kim, H.-Y.; Na, Y.-J.; Yoon, S. A Marine Collagen-Based Biomimetic Hydrogel Recapitulates Cancer Stem Cell Niche and Enhances Progression and Chemoresistance in Human Ovarian Cancer. Mar. Drugs 2020, 18, 498. https://doi.org/10.3390/md18100498
Moon S, Ok Y, Hwang S, Lim YS, Kim H-Y, Na Y-J, Yoon S. A Marine Collagen-Based Biomimetic Hydrogel Recapitulates Cancer Stem Cell Niche and Enhances Progression and Chemoresistance in Human Ovarian Cancer. Marine Drugs. 2020; 18(10):498. https://doi.org/10.3390/md18100498
Chicago/Turabian StyleMoon, SooHyeon, YeJin Ok, SeonYeong Hwang, Ye Seon Lim, Hye-Yoon Kim, Yong-Jin Na, and Sik Yoon. 2020. "A Marine Collagen-Based Biomimetic Hydrogel Recapitulates Cancer Stem Cell Niche and Enhances Progression and Chemoresistance in Human Ovarian Cancer" Marine Drugs 18, no. 10: 498. https://doi.org/10.3390/md18100498
APA StyleMoon, S., Ok, Y., Hwang, S., Lim, Y. S., Kim, H.-Y., Na, Y.-J., & Yoon, S. (2020). A Marine Collagen-Based Biomimetic Hydrogel Recapitulates Cancer Stem Cell Niche and Enhances Progression and Chemoresistance in Human Ovarian Cancer. Marine Drugs, 18(10), 498. https://doi.org/10.3390/md18100498

