Protective Effect of Pyropia yezoensis Peptide on Dexamethasone-Induced Myotube Atrophy in C2C12 Myotubes
Abstract
1. Introduction
2. Results
2.1. Effects of DEX and PYP15 on C2C12 Myotube Viability
2.2. PYP15 Treatment Attenuates the DEX-Induced Reduction in Insulin-Like Growth Factor I Receptor (IGF-IR) and IRS-1 Phosphorylation in C2C12 Myotubes
2.3. PYP15 Treatment Attenuates the DEX-Induced Downregulation of the Akt-mTORC1 Signaling Pathway in C2C12 Myotubes
2.4. PYP15 Treatment Attenuates the DEX-Induced Decreases in p70S6K and 4E-BP1 Phosphorylation in C2C12 Myotubes
2.5. PYP15 Treatment Downregulates the DEX-Induced Increase in Nuclear Translocation of FoxO1 and FoxO3a in C2C12 Myotubes
2.6. PYP15 Treatment Inhibits DEX-Induced 20S Proteasome Activity in C2C12 Myotubes
2.7. PYP15 Treatment Downregulates the DEX-Induced Activation of the Autophagy-Lysosomal System in C2C12 Myotubes
2.8. Analysis of Myotube Atrophy Marker Genes after Akt siRNA Transfection
3. Discussion
4. Materials and Methods
4.1. Preparation of PYP15
4.2. Cell Culture and Differentiation
4.3. Treatment with DEX and PYP15
4.4. MTS Assay
4.5. Real-Time PCR
4.6. Preparation of Total Cell Lysates
4.7. Preparation of Cytosolic and Nuclear Extracts
4.8. Western Blot Analysis
4.9. Akt Small Interfering RNA (siRNA) Transfection
4.10. 20S Proteasome Activity Assay
4.11. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Qian, Z.-J.; Jung, W.K.; Kim, S.K. Free radical scavenging activity of a novel antioxidative peptide purified from hydrolysate of bullfrog skin, Rana catesbeiana Shaw. Bioresour. Technol. 2008, 99, 1690–1698. [Google Scholar] [CrossRef] [Scilit]
- Korhonen, H.; Pihlanto, A. Bioactive peptides: Production and functionality. Int. Dairy J. 2006, 16, 945–960. [Google Scholar] [CrossRef] [Scilit]
- Suetsuna, K.; Maekawa, K.; Chen, J. Antihypertensive effects of Undaria pinnatifida (wakame) peptide on blood pressure in spontaneously hypertensive rats. J. Nutr. Biochem. 2004, 15, 267–272. [Google Scholar] [CrossRef] [Scilit]
- Jung, W.K.; Rajapakse, N.; Kim, S.K. Antioxidative activity of low molecular peptide derived from the sauce of fermented blue mussel, Mytilus edulis. Eur. Food Res. Technol. 2005, 220, 535–539. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.K.; Kim, Y.T.; Byun, H.G.; Park, P.J.; Ito, H. Purification and characterization of antioxidative peptides from bovine skin. BMB Rep. 2001, 34, 219–224. [Google Scholar]
- Rajapakse, N.; Mendis, E.; Jung, W.K.; Je, J.Y.; Kim, S.K. Purification of radical scavenging peptide from fermented mussel sauce and its anti-oxidant properties. Food Res. Int. 2005, 38, 175–182. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Suetsuna, K.; Yamauchi, F. Isolation and characterization of immunostimulative peptides from soybean. J. Nutr. Biochem. 1995, 6, 310–313. [Google Scholar] [CrossRef] [Scilit]
- Tsuruki, T.; Kishi, K.; Takahashi, M.; Tanaka, M.; Matsukawa, T.; Yoshikawa, M. Soymetide, an immunostimulating peptide derived from soybean β-conglycinin, is an Fmlp agonist. FEBS Lett. 2003, 540, 206–210. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.K.; Kim, I.H.; Choi, Y.H.; Choi, J.W.; Kim, Y.M.; Nam, T.J. The proliferative effects of Pyropia yezoensis peptide on IEC-6 cells are mediated through the epidermal growth factor receptor signaling pathway. Int. J. Mol. Med. 2015, 35, 909–914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleurence, J.; Morancais, M.; Dumay, J. Seaweed proteins. In Protein in Food Processing; Yada, R.Y., Ed.; Woodhead Publishing Limited: Cambridge, UK, 2014; pp. 197–213. [Google Scholar]
- Kim, E.Y.; Choi, Y.H.; Nam, T.J. Identification and antioxidant activity of synthetic peptides from phycobiliproteins of Pyropia yezoensis. Int. J. Mol. Med. 2018, 42, 789–798. [Google Scholar] [CrossRef] [Scilit]
- Park, S.J.; Ryu, J.; Kim, I.H.; Choi, Y.H.; Nam, T.J. Activation of the mTOR signaling pathway in breast cancer MCF-7 cells by a peptide derived from Porphyra yezoensis. Oncol. Rep. 2015, 33, 19–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.A.; Kim, I.H.; Nam, T.J. Bioactive peptide from Pyropia yezoensis and its anti-inflammatory activities. Int. J. Mol. Med. 2015, 36, 1701–1706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, Y.H.; Kim, E.Y.; Mikami, K.; Nam, T.J. Chemoprotective effects of a recombinant protein from Pyropia yezoensis and synthetic peptide against acetaminophen-induced change liver cell death. Int. J. Mol. Med. 2015, 36, 369–376. [Google Scholar] [CrossRef] [Scilit]
- Oh, J.H.; Kim, E.Y.; Choi, Y.H.; Nam, T.J. Negative regulation of ERK1/2 by PI3K is required for the protective effects of Pyropia yezoensis peptide against perfluorooctane sulfonate-induced endoplasmic reticulum stress. Mol. Med. Rep. 2017, 15, 2583–2587. [Google Scholar] [CrossRef] [Scilit]
- Kim, C.R.; Kim, Y.M.; Lee, M.K.; Kim, I.H.; Choi, Y.H.; Nam, T.J. Pyropia yezoensis peptide promotes collagen synthesis by activating the TGF-β/Smad signaling pathway in the human dermal fibroblast cell line Hs27. Int. J. Mol. Med. 2017, 39, 31–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Chen, X.; Fan, M. Signaling mechanisms involved in disuse muscle atrophy. Med. Hypotheses 2007, 69, 310–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schakman, O.; Gilson, H.; Thissen, J.P. Mechanisms of glucocorticoid-induced myopathy. J. Endocrinol. 2008, 197, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Auclair, D.; Garrel, D.R.; Chaouki Zerouala, A.; Ferland, L.H. Activation of the ubiquitin pathway in rat skeletal muscle by catabolic doses of glucocorticoids. Am. J. Physiol. Cell Physiol. 1997, 272, C1007–C1016. [Google Scholar] [CrossRef] [Scilit]
- Shah, O.J.; Kimball, S.R.; Jefferson, L.S. Acute attenuation of translation initiation and protein synthesis by glucocorticoids in skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2000, 278, E76–E82. [Google Scholar] [CrossRef] [Scilit]
- Kostyo, J.L.; Redmond, A.F. Role of protein synthesis in the inhibitory action of adrenal steroid hormones on amino acid transport by muscle. Endocrinology 1966, 79, 531–540. [Google Scholar] [CrossRef] [Scilit]
- Shah, O.J.; Kimball, S.R.; Jefferson, L.S. Among translational effectors, p70S6K is uniquely sensitive to inhibition by glucocorticoids. Biochem. J. 2000, 347, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Te Pas, M.F.; de Jeong, P.R.; Verburg, F.J. Glucocorticoid inhibition of C2C12 proliferation rate and differentiation capacity in relation to mRNA levels of the MRF gene family. Mol. Biol. Rep. 2000, 27, 87–98. [Google Scholar] [CrossRef] [Scilit]
- Jellyman, J.K.; Martin-Gronert, M.S.; Cripps, R.L.; Giusseni, D.A.; Ozanne, S.E.; Shen, Q.W.; Du, M.; Fowden, A.L.; Forhead, A.J. Effects of cortisol and dexamethasone on insulin signaling pathways in skeletal muscle of the ovine fetus during late gestation. PLoS ONE 2012, 7, e52363. [Google Scholar] [CrossRef] [Scilit]
- Nakao, R.; Hirasaka, K.; Goto, J.; Ishidoh, K.; Yamada, C.; Ohno, A.; Okumura, Y.; Nonaka, I.; Yasuromo, K.; Baldwin, K.M.; et al. Ubiquitin ligase Cb1-b is a negative regulator for insulin-like growth factor 1 signaling during muscle atrophy caused by unloading. Mol. Cell. Biol. 2009, 29, 4798–4811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, B.; Ohkawa, S.; Li, H.; Roberts-Wilson, T.K.; Price, S.R. FoxO3a mediates signaling crosstalk that coordinates ubiquitin and atrogin-1/MAFbx expression during glucocorticoid-induced skeletal muscle atrophy. FASEB J. 2010, 24, 2660–2669. [Google Scholar] [CrossRef] [Scilit]
- Kukreti, H.; Amuthavalli, K.; Harikumar, A.; Sathiyamoorthy, S.; Feng, P.Z.; Anantharaj, R. Muscle-specific microRNA1 (miR1) targets heat shock protein 70 (HSP70) during dexamethasone mediated atrophy. J. Biol. Chem. 2013, 288, 6663–6678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stitt, T.N.; Drujan, D.; Clarke, B.A.; Panaro, F.; Timofeyva, Y.; Kline, W.O.; Gonzalez, M.; Yancopoulos, G.D.; Glass, D.J. The IGF-I/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol. Cell 2004, 14, 395–403. [Google Scholar] [CrossRef] [Scilit]
- Mammucari, C.; Milan, G.; Romanello, V.; Masiero, E.; Rudolf, R.; Del Piccolo, P.; Buren, S.J.; Di Lisi, R.; Sandri, C.; Zhao, J.; et al. FoxO3 controls autophagy in skeletal muscle in vivo. Cell Metab. 2007, 6, 458–471. [Google Scholar] [CrossRef] [Scilit]
- Hasselgren, P.O. Glucocorticoids and muscle catabolism. Curr. Opin. Clin. Nutr. Metab. Care 1999, 2, 201–205. [Google Scholar] [CrossRef] [Scilit]
- Leger, B.; Cartoni, R.; Praz, M.; Lamon, S.; Deriaz, O.; Crettenand, A.; Gobelet, C.; Rohmer, P.; Konzelmann, M.; Luthi, F.; et al. Akt signaling through GSK-3β, mTOR and FoxO1 is involved in human skeletal muscle hypertrophy and atrophy. J. Physiol. 2006, 576, 923–933. [Google Scholar] [CrossRef] [Scilit]
- Sandri, M.; Sandri, C.; Gilbert, A.; Skurk, C.; Calabria, E.; Picard, A.; Kenneth, W.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. FoxO transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117, 399–412. [Google Scholar] [CrossRef] [Scilit]
- Deval, C.; Mordier, S.; Obled, C.; Bechet, D.; Combaret, L.; Attaix, D.; Ferrara, M. Identification of cathepsin-L as a differentially expressed message associated with skeletal muscle wasting. Biochem. J. 2001, 360, 143–150. [Google Scholar] [CrossRef]
- Komamura, K.; Shirotani-Ikejima, H.; Tatsumi, R.; Tsujita-Kuroda, Y.; Kitakaze, M.; Miyatake, K.; Sunagawa, K.; Miyata, T. Differential gene expression in the rat skeletal and heart muscle in glucocorticoid-induced myopathy: Analysis by microarray. Cardiovasc. Drugs Ther. 2003, 17, 303–310. [Google Scholar] [CrossRef] [Scilit]
- Sacheck, J.M.; Ohtsuka, A.; Mclary, S.C.; Goldberg, A.L. IGF-I stimulates muscle growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. Am. J. Physiol. Endocrinol. Metab. 2004, 287, E591–E601. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, D.; Maki, T.; Herningtyas, E.H.; Ikeshita, N.; Shibahara, H.; Sugiyama, Y.; Nakanishi, S.; Iida, K.; Iguchi, G.; Takahashi, Y.; et al. Branched-chain amino acids protect against dexamethasone-induced soleus muscle atrophy in rats. Muscle Nerve 2010, 41, 819–827. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.K.; Kim, Y.M.; Kim, I.H.; Choi, Y.H.; Nam, T.J. Pyropia yezoensis peptide PYP15 protects against dexamethasone-induced muscle atrophy through the downregulation of atrogin1/MAFbx and MuRF1 in mouse C2C12 myotubes. Mol. Med. Rep. 2017, 15, 3507–3514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, Y.H.; Yamaguchi, K.; Oda, T.; Nam, T.J. Chemical and mass spectrometry characterization of the red alga Pyropia yezoensis chemoprotective protein (PYP): Protective activity of the N-terminal fragment of PYP1 against acetaminophen-induced cell death in Chang liver cells. Int. J. Mol. Med. 2015, 35, 271–276. [Google Scholar] [CrossRef] [Scilit]
- Desler, M.M.; Jones, S.J.; Smith, C.W.; Woods, T.L. Effects of dexamethasone and anabolic agents on proliferation and protein synthesis and degradation in C2C12 myogenic cells. J. Anim. Sci. 1996, 74, 1265–1273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schakman, O.; Kalista, S.; Barbe, C.; Loumaye, A.; Thissen, J.P. Glucocorticoid-induced skeletal muscle atrophy. Int. J. Biochem. Cell Biol. 2013, 45, 2163–2172. [Google Scholar] [CrossRef] [Scilit]
- Adams, G.R.; Mccue, S.A. Localized infusion of IGF-I results in skeletal muscle hypertrophy in rats. J. Appl. Physiol. 1998, 84, 1716–1722. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.H.; Barton, E.R.; Sweeney, H.L.; Farrar, R.P. Viral expression of insulin-like growth factor-I enhances muscle hypertrophy in resistance-trained rats. J. Appl. Physiol. 2004, 96, 1097–1104. [Google Scholar] [CrossRef] [Scilit]
- Glass, D.J. Skeletal muscle hypertrophy and atrophy signaling pathways. Int. J. Biochem. Cell Biol. 2005, 37, 1974–1984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clemmons, D.R. Role of IGF-I in skeletal muscle mass maintenance. Trends Endocrinol. Metab. 2009, 20, 349–356. [Google Scholar] [CrossRef] [Scilit]
- Latres, E.; Amini, A.R.; Amini, A.A.; Griffiths, J.; Martin, F.J.; Lin, H.C.; Yancopoulos, G.D.; Glass, D.J. Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-induced genes via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway. J. Biol. Chem. 2005, 280, 2737–2744. [Google Scholar] [CrossRef] [Scilit]
- Calnan, D.R.; Brunet, A. The FoxO code. Oncogene 2008, 27, 2276–2288. [Google Scholar] [CrossRef] [Scilit]
- Kamei, Y.; Miura, S.; Suzuki, M.; Kai, Y.; Mizukami, J.; Taniguchi, T.; Mochida, K.; Hata, T.; Matsuda, J.; Aburatani, H.; et al. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J. Biol. Chem. 2004, 279, 41114–41123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Southgate, R.J.; Neill, B.; Prelovsek, O.; El-Osta, A.; Kamei, Y.; Miura, S.; Exaki, O.; McLoughlin, T.J.; Zhang, W.; Unterman, T.G.; et al. FoxO1 regulates the expression of 4E-BP1 and inhibits mTOR signaling in mammalian skeletal muscle. J. Biol. Chem. 2007, 282, 21176–21186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naujokat, C.; Hoffmann, S. Role and function of the 26S proteasome in proliferation and apoptosis. Lab. Invest. 2002, 82, 965–980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolf, D.H.; Hilt, W. The proteasome: A proteolytic nanomachine of cell regulation and waste disposal. Biochim. Biophys. Acta 2004, 1695, 19–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lecker, S.H.; Goldberg, A.L.; Mitch, W.E. Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J. Am. Soc. Nephrol. 2006, 17, 1807–1819. [Google Scholar] [CrossRef] [Scilit]
- Jagoe, R.T.; Goldberg, A.L. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr. Opin. Clin. Nutr. Metab. Care 2001, 4, 183–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mammucari, C.; Schiaffino, S.; Sandri, M. Downstream of Akt: FoxO3 and mTOR in the regulation of autophagy in skeletal muscle. Autophagy 2008, 4, 524–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaho, J.; Brault, J.J.; Schild, A.; Cao, P.; Sandri, M.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. FoxO3 coordinately activates protein degradation by the autophagic/lysosomal and proteasomal pathways in atrophying muscle cells. Cell Metab. 2007, 6, 472–483. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Gene | Accession No. | Sequence (5′–3′) | Amplicon Size (bp) |
|---|---|---|---|
| Atrogin-1/MAFbx | NM_026346.3 | F: ATGCACACTGGTGCAGAGAG R: TGTAAGCACACAGGCAGGTC | 168 |
| Cathepsin-L | M20495.1 | F: GACCGGGACAACCACTGTG R: CCCATCAATTCACGACAGGAT | 61 |
| GAPDH | NM_008084.3 | F: ACTCCACTCACGGCAAATTCA R: CGCTCCTGGAAGATGGTGAT | 91 |
| KLF-15 | NM_001355668.1 | F: CGAGAAGCCCTTTGCCTGCA R: ATCGCCGGTGCCTTGACAAC | 70 |
| MuRF1 | DQ_229108.1 | F: CGAGAAGCCCTTTGCCTGCA R: GTGCCGGTCCATGATCACTT | 59 |
| REDD1 | NM_029083.2 | F: TGGTGCCCACCTTTCAGTTG R: GTCAGGGACTGGCTGTAACC | 121 |
| Antibody | Manufacturer and Catalog No. | Species of Origin | Dilution Rate |
|---|---|---|---|
| 4E-BP1 | Santa Cruz Biotechnology: sc-9977 | Mouse | 1:1000 |
| Akt | Santa Cruz Biotechnology: sc-8312 | Rabbit | 1:1000 |
| Atrogin-1/MAFbx | Santa Cruz Biotechnology: sc-27645 | Goat | 1:2000 |
| β-actin | Santa Cruz Biotechnology: sc-47778 | Mouse | 1:1000 |
| Cathepsin-L | Santa Cruz Biotechnology: sc-6498 | Goat | 1:1000 |
| eIF4E | Santa Cruz Biotechnology: sc-514875 | Mouse | 1:1000 |
| FoxO1 | Santa Cruz Biotechnology: sc-374427 | Mouse | 1:500 |
| FoxO3a | Santa Cruz Biotechnology: sc-9813 | Goat | 1:1000 |
| GAPDH | Santa Cruz Biotechnology: sc-25778 | Rabbit | 1:1000 |
| IGF-IR | Santa Cruz Biotechnology: sc-713 | Rabbit | 1:1000 |
| IRS-1 | Santa Cruz Biotechnology: sc-560 | Rabbit | 1:1000 |
| KLF-15 | Santa Cruz Biotechnology: sc-27165 | Mouse | 1:1000 |
| Lamin B | Santa Cruz Biotechnology: sc-377000 | Mouse | 1:1000 |
| LC3-I/II | Cell Signaling: #4108S | Rabbit | 1:1000 |
| mTOR | Santa Cruz Biotechnology: sc-8319 | Rabbit | 1:1000 |
| MuRF1 | Santa Cruz Biotechnology: sc-27642 | Goat | 1:2000 |
| p-4E-BP1 | Santa Cruz Biotechnology: sc-293124 | Mouse | 1:1000 |
| p70S6K | Santa Cruz Biotechnology: sc-8418 | Mouse | 1:1000 |
| p-Akt | Santa Cruz Biotechnology: sc-135650 | Mouse | 1:500 |
| p-FoxO1 | Cell Signaling: #9461S | Rabbit | 1:500 |
| p-FoxO3a | Cell Signaling: #9466S | Rabbit | 1:1000 |
| p-IGF-IR | Santa Cruz Biotechnology: sc-101703 | Rabbit | 1:1000 |
| p-IRS-1 | Santa Cruz Biotechnology: sc-17200 | Goat | 1:1000 |
| p-mTOR | Santa Cruz Biotechnology: sc-293132 | Mouse | 1:1000 |
| p-p70S6K | Santa Cruz Biotechnology: sc-8416 | Mouse | 1:1000 |
| p-S6 | Santa Cruz Biotechnology: sc-293144 | Mouse | 1:1000 |
| Raptor | Santa Cruz Biotechnology: sc-81537 | Mouse | 1:1000 |
| REDD1 | Santa Cruz Biotechnology: sc-376671 | Mouse | 1:1000 |
| Rheb | Santa Cruz Biotechnology: sc-271509 | Mouse | 1:1000 |
| Rictor | Santa Cruz Biotechnology: sc-81538 | Mouse | 1:1000 |
| S6 | Santa Cruz Biotechnology: sc-74459 | Mouse | 1:1000 |
| Gene | Accession No. | Sequence (5′–3′) |
|---|---|---|
| Akt siRNA1 | NM_009652.2 | F: CUCAAGUGAGGUUGACAGA R: UCUGUCAACCUCACUUGAG |
| Akt siRNA2 | NM_009652.2 | F: CCACGGAUACCAUGAACGA R: UCGUUCAUGGUAUCCGUGG |
| Akt siRNA3 | NM_009652.2 | F: GACGAUGGACUUCCGAUCA R: UGAUCGGAAGUCCAUCGUC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, M.-K.; Choi, J.-W.; Choi, Y.H.; Nam, T.-J. Protective Effect of Pyropia yezoensis Peptide on Dexamethasone-Induced Myotube Atrophy in C2C12 Myotubes. Mar. Drugs 2019, 17, 284. https://doi.org/10.3390/md17050284
Lee M-K, Choi J-W, Choi YH, Nam T-J. Protective Effect of Pyropia yezoensis Peptide on Dexamethasone-Induced Myotube Atrophy in C2C12 Myotubes. Marine Drugs. 2019; 17(5):284. https://doi.org/10.3390/md17050284
Chicago/Turabian StyleLee, Min-Kyeong, Jeong-Wook Choi, Youn Hee Choi, and Taek-Jeong Nam. 2019. "Protective Effect of Pyropia yezoensis Peptide on Dexamethasone-Induced Myotube Atrophy in C2C12 Myotubes" Marine Drugs 17, no. 5: 284. https://doi.org/10.3390/md17050284
APA StyleLee, M.-K., Choi, J.-W., Choi, Y. H., & Nam, T.-J. (2019). Protective Effect of Pyropia yezoensis Peptide on Dexamethasone-Induced Myotube Atrophy in C2C12 Myotubes. Marine Drugs, 17(5), 284. https://doi.org/10.3390/md17050284

