Phlorofucofuroeckol-A: A Natural Compound with Potential to Attenuate Inflammatory Diseases Caused by Airborne Fine Dust
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Antibodies, and Materials
2.2. Purification of a Single Compound from Seaweed Extracts
2.3. Analytic Procedures for Purified Single Compounds
2.4. Cytotoxicity Assay
2.5. Immunoblotting
2.6. Quantitative RT-PCR (qRT-PCR)
2.7. RT2 Profiler PCR Array
2.8. Statistical Analysis
3. Results
3.1. Purification of Single Compounds from Seaweed Polysaccharides
3.2. Cytotoxicity Analysis of Fine Dust and Single Compounds
3.3. Single Compounds Inhibit FD-Induced Pro-Inflammatory Responses
3.4. PFF-A Modulates NF-κB/MAPK-Mediated Il-1β Production
3.5. PFF-A Plays an Anti-Inflammatory Role in FD-Induced Inflammatory Responses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Arias-Pérez, R.D.; Taborda, N.A.; Gómez, D.M.; Narvaez, J.F.; Porras, J.; Hernandez, J.C. Inflammatory effects of particulate matter air pollution. Environ. Sci. Pollut. Res. Int. 2020, 27, 42390–42404. [Google Scholar] [CrossRef] [PubMed]
- Aryal, A.; Harmon, A.C.; Dugas, T.R. Particulate matter air pollutants and cardiovascular disease: Strategies for intervention. Pharmacol. Ther. 2021, 223, 107890. [Google Scholar] [CrossRef] [PubMed]
- Raftery, A.L.; Tsantikos, E.; Harris, N.L.; Hibbs, M.L. Links Between Inflammatory Bowel Disease and Chronic Obstructive Pulmonary Disease. Front. Immunol. 2020, 11, 2144. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Levy, J.I. Factors influencing the spatial extent of mobile source air pollution impacts: A meta-analysis. BMC Public Health 2007, 7, 89. [Google Scholar] [CrossRef]
- Humbal, C.; Gautam, S.; Trivedi, U. A review on recent progress in observations, and health effects of bioaerosols. Environ. Int. 2018, 118, 189–193. [Google Scholar] [CrossRef]
- Jones, A.M.; Harrison, R.M. The effects of meteorological factors on atmospheric bioaerosol concentrations—A review. Sci. Total Environ. 2004, 326, 151–180. [Google Scholar] [CrossRef]
- Peden, D.; Reed, C.E. Environmental and occupational allergies. J. Allergy Clin. Immunol. 2010, 125 (Suppl. S2), S150–S160. [Google Scholar] [CrossRef]
- Guarnieri, M.; Balmes, J.R. Outdoor air pollution and asthma. Lancet 2014, 383, 1581–1592. [Google Scholar] [CrossRef]
- Anderson, J.O.; Thundiyil, J.G.; Stolbach, A. Clearing the air: A review of the effects of particulate matter air pollution on human health. J. Med. Toxicol. 2012, 8, 166–175. [Google Scholar] [CrossRef]
- Hamanaka, R.B.; Mutlu, G.M. Particulate Matter Air Pollution: Effects on the Cardiovascular System. Front. Endocrinol. 2018, 9, 680. [Google Scholar] [CrossRef]
- Sanjeewa, K.A.; Jayawardena, T.U.; Kim, S.Y.; Lee, H.G.; Je, J.G.; Jee, Y.; Jeon, Y.J. Sargassum horneri (Turner) inhibit urban particulate matter-induced inflammation in MH-S lung macrophages via blocking TLRs mediated NF-κB and MAPK activation. J. Ethnopharmacol. 2020, 249, 112363. [Google Scholar] [CrossRef] [PubMed]
- Tan, P.X.; Thiyagarasaiyar, K.; Tan, C.-Y.; Jeon, Y.-J.; Nadzir, M.S.M.; Wu, Y.-J.; Low, L.-E.; Atanasov, A.G.; Ming, L.C.; Bin Liew, K.; et al. Algae-Derived Anti-Inflammatory Compounds against Particulate Matters-Induced Respiratory Diseases: A Systematic Review. Mar. Drugs 2021, 19, 317. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Zhou, W.; Yang, J.; Ao, J.; Huang, Y.; Shen, D.; Jiang, Y.; Huang, Z.; Shen, H. Effect of seaweed extracts on the growth, physiological activity, cane yield and sucrose content of sugarcane in China. Front. Plant Sci. 2021, 12, 659130. [Google Scholar] [CrossRef] [PubMed]
- Biesalski, H.-K.; Dragsted, L.O.; Elmadfa, I.; Grossklaus, R.; Müller, M.; Schrenk, D.; Walter, P.; Weber, P. Bioactive compounds: Definition and assessment of activity. Nutrition 2009, 25, 1202–1205. [Google Scholar] [CrossRef]
- Cheung, R.C.F.; Ng, T.B.; Wong, J.H.; Chen, Y.; Chan, W.Y. Marine natural products with anti-inflammatory activity. Appl. Microbiol. Biotechnol. 2016, 100, 1645–1666. [Google Scholar] [CrossRef]
- Miyashita, K.; Nishikawa, S.; Beppu, F.; Tsukui, T.; Abe, M.; Hosokawa, M. The allenic carotenoid fucoxanthin, A novel marine nutraceutical from Brown seaweeds. J. Sci. Food Agric. 2011, 91, 1166–1174. [Google Scholar] [CrossRef]
- Maeda, H.; Tsukui, T.; Sashima, T.; Hosokawa, M.; Miyashita, K. Seaweed carotenoid, fucoxanthin, as A multi-functional nutrient. Asia Pac. J. Clin. Nutr. 2008, 17 (Suppl. S1), 196–199. [Google Scholar]
- Bertelli, A.; Biagi, M.; Corsini, M.; Baini, G.; Cappellucci, G.; Miraldi, E. Polyphenols: From theory to practice. Food 2021, 10, 2595. [Google Scholar] [CrossRef]
- Jung, W.-K.; Heo, S.-J.; Jeon, Y.-J.; Lee, C.-M.; Park, Y.-M.; Byun, H.-G.; Choi, Y.H.; Park, S.-G.; Choi, I.-W. Inhibitory effects and molecular mechanism of dieckol isolated from marine brown alga on COX-2 and iNOS in microglial cells. J. Agric. Food Chem. 2009, 57, 4439–4446. [Google Scholar] [CrossRef]
- Lee, S.S.; Bang, M.H.; Jeon, H.J.; Hwang, T.; Yang, S.A. Anti-inflammatory and Anti-allergic Effects of Phlorofucofuroeckol A and Dieckol Isolated from Ecklonia cava. J. Life Sci. 2018, 28, 1170–1178. [Google Scholar]
- Yim, S.-K.; Kim, K.; Chun, S.; Oh, T.; Jung, W.; Jung, K.; Yun, C.-H. Screening of human CYP1A2 and CYP3A4 inhibitors from seaweed in silico and in vitro. Mar. Drugs 2020, 18, 603. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.M.; Doan, T.P.; Ha, T.K.Q.; Kim, H.W.; Lee, B.W.; Pham, H.T.T.; Cho, T.O.; Oh, W.K. Dereplication by high-performance liquid chromatography (HPLC) with quadrupole-time-of-flight mass spectroscopy (qTOF-MS) and antiviral activities of phlorotannins from Ecklonia cava. Mar. Drugs 2019, 17, 149. [Google Scholar] [CrossRef] [PubMed]
- Hentati, F.; Tounsi, L.; Djomdi, D.; Pierre, G.; Delattre, C.; Ursu, A.V.; Fendri, I.; Abdelkafi, S.; Michaud, P. Bioactive polysaccharides from seaweeds. Molecules 2020, 25, 3152. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef]
- Lee, Y.G.; Ho, C.-H.; Kim, J.-H.; Kim, J. Quiescence of Asian dust events in South Korea and Japan during 2012 spring: Dust outbreaks and transports. Atmos. Environ. 2015, 114, 92–101. [Google Scholar] [CrossRef]
- Magnani, N.D.; Muresan, X.M.; Belmonte, G.; Cervellati, F.; Sticozzi, C.; Pecorelli, A.; Miracco, C.; Marchini, T.; Evelson, P.; Valacchi, G. Skin Damage Mechanisms Related to Airborne Particulate after Exposure. Toxicol. Sci. 2016, 149, 227–236. [Google Scholar] [CrossRef]
- Shah, A.S.V.; Langrish, J.P.; Nair, H.; McAllister, D.A.; Hunter, A.L.; Donaldson, K.; Newby, D.E.; Mills, N.L. Global association of air pollution and heart failure: A systematic review and meta-analysis. Lancet 2013, 382, 1039–1048. [Google Scholar] [CrossRef]
- Bekki, K.; Ito, T.; Yoshida, Y.; He, C.; Arashidani, K.; He, M.; Sun, G.; Zeng, Y.; Sone, H.; Kunugita, N.; et al. PM2.5 collected in China causes inflammatory and oxidative stress responses in macrophages through the multiple pathways. Environ. Toxicol. Pharmacol. 2016, 45, 362–369. [Google Scholar] [CrossRef]
- Zhang, M. Transboundary fine dust pollution in China and Korea: How has international politics impeded environmental negotiations? Asia Pac. Policy Stud. 2024, 11, e384. [Google Scholar] [CrossRef]
- Fernando, I.P.; Kim, H.S.; Sanjeewa, K.K.; Oh, J.Y.; Jeon, Y.J.; Lee, W.W.; Fernando, I.S.; Kim, H.S.; Sanjeewa, K.A.; Oh, J.Y.; et al. Inhibition of inflammatory responses elicited by urban fine dust particles in keratinocytes and macrophages by diphlorethohydroxycarmalol isolated from a brown alga Ishige okamurae. Algae 2017, 32, 261–273. [Google Scholar] [CrossRef]
- Jayawardena, T.U.; Sanjeewa, K.K.A.; Wang, L.; Kim, W.-S.; Lee, T.-K.; Kim, Y.-T.; Jeon, Y.-J. Alginic Acid from Padina boryana Abate Particulate Matter-Induced Inflammatory Responses in Keratinocytes and Dermal Fibroblasts. Molecules 2020, 25, 5746. [Google Scholar] [CrossRef] [PubMed]
- Schins, R.P.; Lightbody, J.H.; Borm, P.J.; Shi, T.; Donaldson, K.; Stone, V. Inflammatory effects of coarse and fine particulate matter in relation to chemical and biological constituents. Toxicol. Appl. Pharmacol. 2004, 195, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Raetz, C.R.H.; Whitfield, C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef] [PubMed]
- Montuori, E.; de Pascale, D.; Lauritano, C. Recent discoveries on marine organism immunomodulatory activities. Mar. Drugs 2002, 20, 422. [Google Scholar] [CrossRef]
- Khalifa, S.A.M.; Elias, N.; Farag, M.A.; Chen, L.; Saeed, A.; Hegazy, M.-E.F.; Moustafa, M.S.; El-Wahed, A.A.; Al-Mousawi, S.M.; Musharraf, S.G.; et al. Marine natural products: A source of novel anticancer drugs. Mar. Drugs 2019, 17, 491. [Google Scholar] [CrossRef]
- Lomatire, S.; Gonçalves, A.M.M. An overview of potential seaweed-derived bioactive compounds for pharmaceutical applications. Mar. Drugs 2022, 20, 141. [Google Scholar] [CrossRef]
- Khursheed, M.; Ghelani, H.; Jan, R.K.; Adrian, T.E. Anti-inflammatory effects of bioactive compounds from seaweeds, bryozoans, jellyfish, shellfish and peanut worms. Mar. Drugs 2023, 21, 524. [Google Scholar] [CrossRef]
- Nagahawatta, D.P.; Liyanage, N.M.; Jayawardhana, H.H.A.C.K.; Lee, H.G.; Jayawardena, T.U.; Jeon, Y.J. Anti-Fine Dust Effect of Fucoidan Extracted from Ecklonia maxima Laves in Macrophages via Inhibiting Inflammatory Signaling Pathways. Mar. Drugs 2022, 20, 413. [Google Scholar] [CrossRef]
- Shrestha, S.; Johnston, M.R.; Zhang, W.; Smid, S.D. A phlorotannin isolated from Ecklonia radiata, dibenzodioxin-fucodiphloroethol, inhibits neurotoxicity and aggregation of β-amyloid. Phytomed. Plus 2021, 1, 100125. [Google Scholar] [CrossRef]
- Jung, H.A.; Jin, S.E.; Ahn, B.R.; Lee, C.M.; Choi, J.S. Anti-inflammatory activity of edible brown alga Eisenia bicyclis and its constituents fucosterol and phlorotannins in LPS-stimulated RAW264.7 macrophages. Food Chem. Toxicol. 2013, 59, 199–206. [Google Scholar] [CrossRef]
- Kim, A.R.; Lee, M.S.; Shin, T.S.; Hua, H.; Jang, B.C.; Choi, J.S.; Byun, D.S.; Utsuki, T.; Ingram, D.; Kim, H.R. Phlorofucofuroeckol A inhibits the LPS-stimulated iNOS and COX-2 expressions in macrophages via inhibition of NF-κB, Akt, and p38 MAPK. Toxicol. In Vitro 2011, 25, 1789–1795. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.L.; Yuan, Y.; Zou, G.M.; Liu, G.; Tu, J.; Li, Q. LPS-stimulated inflammatory environment inhibits BMP-2-induced osteoblastic differentiation through crosstalk between TLR4/MyD88/NF-κB and BMP/Smad signaling. Stem Cells Dev. 2014, 23, 277–289. [Google Scholar] [CrossRef]
- Zhao, Y.; Usatyuk, P.V.; Gorshkova, I.A.; He, D.; Wang, T.; Moreno-Vinasco, L.; Geyh, A.S.; Breysse, P.N.; Samet, J.M.; Spannhake, E.W.; et al. Regulating of COX-2 expression and IL-6 release by particulate matter in airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 2009, 40, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, M.; Li, Z.; Yue, J.; Xu, M.; Zhang, Y.; Yung, K.K.L.; Li, R. Fine particulate matter induces mitochondrial dysfunction and oxidative stress in human SH-SY5Y cells. Chemosphere 2019, 218, 577–588. [Google Scholar] [CrossRef]
- Narasimhulu, C.A.; Singla, D.K. The role of bone morphogenetic protein 7 in inflammation in heart diseases. Cell 2020, 9, 280. [Google Scholar] [CrossRef] [PubMed]
- Maric, I.; Wensveen, T.T.; Smoljan, I.; Orlic, Z.C.; Bobinac, D. Bone morphogenetic proteins and signaling pathway in inflammatory bowel disease. AJP-Gastrointest. Liver Physiol. 2012, 15, G1151–G1162. [Google Scholar]
- Salazar, V.S.; Gamer, L.W.; Rosen, V. BMP signaling in skeletal development, disease and repair. Nat. Rev. Endocrinol. 2016, 12, 203–221. [Google Scholar] [CrossRef]
Genes | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
Tnf-α | CCCCAAAGGGATGAGAAGTT | CACTTGGTGGTTTGCTACGA |
Il-6 | CCGGAGAGGAGACTTCACAG | CAGAATTGCCATTGCACAAC |
Il-1β | GGATGAGGACATGAGCACCT | AGCTCATATGGGTCCGACAG |
Gapdh | CATCACTGCCACCCAGAAGACTG | ATGCCAGTGAGCTTCCCGTTCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Published by MDPI on behalf of the Lithuanian University of Health Sciences. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, E.-G.; Yim, S.-K.; Kang, S.-M.; Ahn, B.J.; Kim, C.-K.; Lee, M.; Tark, D.; Lee, G.-H. Phlorofucofuroeckol-A: A Natural Compound with Potential to Attenuate Inflammatory Diseases Caused by Airborne Fine Dust. Medicina 2025, 61, 165. https://doi.org/10.3390/medicina61010165
Lee E-G, Yim S-K, Kang S-M, Ahn BJ, Kim C-K, Lee M, Tark D, Lee G-H. Phlorofucofuroeckol-A: A Natural Compound with Potential to Attenuate Inflammatory Diseases Caused by Airborne Fine Dust. Medicina. 2025; 61(1):165. https://doi.org/10.3390/medicina61010165
Chicago/Turabian StyleLee, Eun-Gyeong, Sung-Kun Yim, Sang-Min Kang, Byung Jae Ahn, Chang-Kwon Kim, Mina Lee, Dongseob Tark, and Gun-Hee Lee. 2025. "Phlorofucofuroeckol-A: A Natural Compound with Potential to Attenuate Inflammatory Diseases Caused by Airborne Fine Dust" Medicina 61, no. 1: 165. https://doi.org/10.3390/medicina61010165
APA StyleLee, E.-G., Yim, S.-K., Kang, S.-M., Ahn, B. J., Kim, C.-K., Lee, M., Tark, D., & Lee, G.-H. (2025). Phlorofucofuroeckol-A: A Natural Compound with Potential to Attenuate Inflammatory Diseases Caused by Airborne Fine Dust. Medicina, 61(1), 165. https://doi.org/10.3390/medicina61010165