MicroRNAs: Potential Biomarkers of Disease Severity in Chronic Rhinosinusitis with Nasal Polyps
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Setting
2.2. Participants
2.3. Variables and Measurements
2.4. MiRNAs’ Analysis
2.4.1. RNA Extraction
2.4.2. cDNA Synthesis and qRT-PCR
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fokkens, W.J.; Lund, V.J.; Hopkins, C.; Hellings, P.W.; Kern, R.; Reitsma, S.; Toppila-Salmi, S.; Bernal-Sprekelsen, M.; Mullol, J.; Alobid, I.; et al. European Position Paper on Rhinosinusitis and Nasal Polyps 2020. Rhinology 2020, 58 (Suppl. S29), 1–464. [Google Scholar] [CrossRef]
- Hastan, D.; Fokkens, W.J.; Bachert, C.; Newson, R.B.; Bislimovska, J.; Bockelbrink, A.; Burney, P. Chronic rhinosinusitis in Europe—An underestimated disease. A GA²LEN study. Allergy 2011, 66, 1216–1223. [Google Scholar] [CrossRef]
- Cao, P.-P.; Li, H.-B.; Wang, B.-F.; Wang, S.-B.; You, X.-J.; Cui, Y.-H.; Wang, D.-Y.; Desrosiers, M.; Liu, Z. Distinct immunopathologic characteristics of various types of chronic rhinosinusitis in adult Chinese. J. Allergy Clin. Immunol. 2009, 124, 478–484.e2. [Google Scholar] [CrossRef]
- Marcus, S.; DelGaudio, J.M.; Roland, L.T.; Wise, S.K. Chronic Rhinosinusitis: Does Allergy Play a Role? Med. Sci. 2019, 7, 30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomassen, P.; Vandeplas, G.; Van Zele, T.; Cardell, L.-O.; Arebro, J.; Olze, H.; Förster-Ruhrmann, U.; Kowalski, M.L.; Olszewska-Ziąber, A.; Holtappels, G.; et al. Inflammatory endotypes of chronic rhinosinusitis based on cluster analysis of biomarkers. J. Allergy Clin. Immunol. 2016, 137, 1449–1456.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tokunaga, T.; Sakashita, M.; Haruna, T.; Asaka, D.; Takeno, S.; Ikeda, H.; Nakayama, T.; Seki, N.; Ito, S.; Murata, J.; et al. Novel scoring system and algorithm for classifying chronic rhinosinusitis: The JESREC Study. Allergy 2015, 70, 995–1003. [Google Scholar] [CrossRef] [Green Version]
- Orlandi, R.R.; Kingdom, T.T.; Smith, T.L.; Bleier, B.; De Conde, A.; Luong, A.U.; Poetker, D.M.; Soler, Z.; Welch, K.C.; Wise, S.K.; et al. International consensus statement on allergy and rhinology: Rhinosinusitis 2021. Int. Forum Allergy Rhinol. 2020, 11, 213–739. [Google Scholar]
- Liu, T.; Sun, Y.; Bai, W. The Role of Epigenetics in the Chronic Sinusitis with Nasal Polyp. Curr. Allergy Asthma Rep. 2020, 21, 1. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Specjalski, K.; Jassem, E. MicroRNAs: Potential Biomarkers and Targets of Therapy in Allergic Diseases? Arch. Immunol. Ther. Exp. 2019, 67, 213–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sonkoly, E.; Pivarcsi, A. Advances in microRNAs: Implications for immunity and inflammatory diseases. J. Cell. Mol. Med. 2008, 13, 24–38. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Wang, X.; Qu, X.; Lv, C. Transcription Factor Specificity Protein 1 Regulates Inflammation and Fibrin Deposition in Nasal Polyps Via the Regulation of microRNA-125b and the Wnt/β-catenin Signaling Pathway. Inflammation 2022, 45, 1118–1132. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Kang, X.; Xiong, Y.; Luo, Q.; Dai, D.; Ye, J. Gene Expression Profiles of Circular RNAs and MicroRNAs in Chronic Rhinosinusitis With Nasal Polyps. Front. Mol. Biosci. 2021, 8, 643504. [Google Scholar] [CrossRef]
- Xia, G.; Bao, L.; Gao, W.; Liu, S.; Ji, K.; Li, J. Differentially Expressed miRNA in Inflammatory Mucosa of Chronic Rhinosinusitis. J. Nanosci. Nanotechnol. 2015, 15, 2132–2139. [Google Scholar] [CrossRef]
- Zhang, X.-H.; Zhang, Y.-N.; Li, H.-B.; Hu, C.-Y.; Wang, N.; Cao, P.-P.; Liao, B.; Lu, X.; Cui, Y.-H.; Liu, Z. Overexpression of miR-125b, a Novel Regulator of Innate Immunity, in Eosinophilic Chronic Rhinosinusitis with Nasal Polyps. Am. J. Respir. Crit. Care Med. 2012, 185, 140–151. [Google Scholar] [CrossRef]
- Fan, Q.; Jian, Y. MiR-203a-3p regulates TGF-β1-induced epithelial–mesenchymal transition (EMT) in asthma by regulating Smad3 pathway through SIX1. Biosci. Rep. 2020, 40, BSR20192645. [Google Scholar] [CrossRef] [Green Version]
- Fokkens, W.J.; Lund, V.J.; Mullol, J.; Bachert, C.; Alobid, I.; Baroody, F.; Wormald, P.J. EPOS 2012: European position paper on rhinosinusitis and nasal polyps 2012. A summary for otorhinolaryngologists. Rhinology 2012, 50, 1–12. [Google Scholar] [CrossRef]
- Lildholdt, T.; Rundcrantz, H.; Lindqvist, N. Efficacy of topical corticosteroid powder for nasal polyps: A double-blind, placebo-controlled study of budesonide. Clin. Otolaryngol. 1995, 20, 26–30. [Google Scholar] [CrossRef] [PubMed]
- Lund, V.J.; Mackay, I.S. Staging in rhinosinusitus. Rhinology 1993, 31, 183–184. [Google Scholar]
- Ba, V.E.D.; Rafaels, N.; Kim, J. Peripheral blood eosinophilia correlates with hyperplastic nasal polyp growth. Int. Forum Allergy Rhinol. 2016, 6, 926–934. [Google Scholar]
- Lou, H.; Zhang, N.; Bachert, C.; Zhang, L. Highlights of eosinophilic chronic rhinosinusitis with nasal polyps in definition, prognosis, and advancement. Int. Forum Allergy Rhinol. 2018, 8, 1218–1225. [Google Scholar] [CrossRef] [Green Version]
- Matsuwaki, Y.; Ookushi, T.; Asaka, D.; Mori, E.; Nakajima, T.; Yoshida, T.; Kojima, J.; Chiba, S.; Ootori, N.; Moriyama, H. Chronic Rhinosinusitis: Risk Factors for the Recurrence of Chronic Rhinosinusitis Based on 5-Year Follow-Up after Endoscopic Sinus Surgery. Int. Arch. Allergy Immunol. 2008, 146 (Suppl. 1), 77–81. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Cao, P.-P.; Liang, G.-T.; Cui, Y.-H.; Liu, Z. Diagnostic significance of blood eosinophil count in eosinophilic chronic rhinosinusitis with nasal polyps in Chinese adults. Laryngoscope 2012, 122, 498–503. [Google Scholar] [CrossRef]
- Hopkins, C.; Rudmik, L.; Lund, V.J. The predictive value of the preoperative Sinonasal Outcome Test-22 score in patients undergoing endoscopic sinus surgery for chronic rhinosinusitis. Laryngoscope 2015, 125, 1779–1784. [Google Scholar] [CrossRef] [PubMed]
- Gâta, A.; Valean, D.; Trombitás, V.E.; Albu, S. Impact of depression on the outcomes of endoscopic sinus surgery. Hum. Vet. Med. 2022, 14, 1–4. [Google Scholar]
- I Parikh, N.; Vasan, R.S. Assessing the clinical utility of biomarkers in medicine. Biomark. Med. 2007, 1, 419–436. [Google Scholar] [CrossRef]
- Panganiban, R.P.; Wang, Y.; Howrylak, J.; Chinchilli, V.M.; Craig, T.J.; August, A.; Ishmael, F.T. Circulating microRNAs as biomarkers in patients with allergic rhinitis and asthma. J. Allergy Clin. Immunol. 2016, 137, 1423–1432. [Google Scholar] [CrossRef] [Green Version]
- Roffel, M.P.; Boudewijn, I.M.; van Nijnatten, J.L.; Faiz, A.; Vermeulen, C.J.; van Oosterhout, A.J.; Affleck, K.; Timens, W.; Bracke, K.R.; Maes, T.; et al. Identification of asthma-associated microRNAs in bronchial biopsies. Eur. Respir. J. 2021, 59, 2101294. [Google Scholar] [CrossRef] [PubMed]
- Atashbasteh, M.; Mortaz, E.; Mahdaviani, S.A.; Jamaati, H.; Allameh, A. Expression levels of plasma exosomal miR-124, miR-125b, miR-133b, miR-130a and miR-125b-1-3p in severe asthma patients and normal individuals with emphasis on inflammatory factors. Allergy Asthma Clin. Immunol. 2021, 17, 51. [Google Scholar] [CrossRef]
- Kalluri, R.; Neilson, E.G. Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Investig. 2003, 112, 1776–1784. [Google Scholar] [CrossRef]
- Hackett, T.L.; Warner, S.M.; Stefanowicz, D.; Shaheen, F.; Pechkovsky, D.V.; Murray, L.A.; Knight, D.A. Induction of epithelial-mesenchymal transition in primary airway epithelial cells from patients with asthma by transforming growth factor-beta1. Am. J. Respir. Crit. Care Med. 2009, 180, 122–133. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Du, J.; Zhou, J.; Zhong, B.; Ba, L.; Zhang, J.; Liu, Y.; Liu, S. Elevated microRNA-21 Is a Brake of Inflammation Involved in the Development of Nasal Polyps. Front. Immunol. 2021, 12, 530488. [Google Scholar] [CrossRef] [PubMed]
- Tsai, M.J.; Tsai, Y.C.; Chang, W.A.; Lin, Y.S.; Tsai, P.H.; Sheu, C.C.; Hsu, Y.L. Deducting MicroRNA-Mediated Changes Common in Bronchial Epithelial Cells of Asthma and Chronic Obstructive Pulmonary Disease-A Next-Generation Sequencing-Guided Bioinformatic Approach. Int. J. Mol. Sci. 2019, 20, 553. [Google Scholar] [CrossRef] [Green Version]
- Marcus, S.; Roland, L.T.; DelGaudio, J.M.; Wise, S.K. The relationship between allergy and chronic rhinosinusitis. Laryngoscope Investig. Otolaryngol. 2018, 4, 13–17. [Google Scholar] [CrossRef] [Green Version]
- Morawska-Kochman, M.; Śmieszek, A.; Marcinkowska, K.; Marycz, K.M.; Nelke, K.; Zub, K.; Zatoński, T.; Bochnia, M. Expression of Apoptosis-Related Biomarkers in Inflamed Nasal Sinus Epithelium of Patients with Chronic Rhinosinusitis with Nasal Polyps (CRSwNP)-Evaluation at mRNA and miRNA Levels. Biomedicines 2022, 10, 1400. [Google Scholar] [CrossRef]
- Colina, R.; Costa-Mattioli, M.; Dowling, R.J.O.; Jaramillo, M.; Tai, L.-H.; Breitbach, C.J.; Martineau, Y.; Larsson, O.; Rong, L.; Svitkin, Y.V.; et al. Translational control of the innate immune response through IRF-7. Nature 2008, 452, 323–328. [Google Scholar] [CrossRef]
- Martín-Saavedra, F.M.; González-García, C.; Bravo, B.; Ballester, S. Beta interferon restricts the inflammatory potential of CD4+ cells through the boost of the Th2 phenotype, the inhibition of Th17 response and the prevalence of naturally occurring T regulatory cells. Mol. Immunol. 2008, 45, 4008–4019. [Google Scholar] [CrossRef] [PubMed]
- Sega, S.; Wraber, B.; Mesec, A.; Horvat, A.; Ihan, A. IFN-beta1a and IFN-beta1b have different patterns of influence on cytokines. Clin. Neurol. Neurosurg. 2004, 106, 255–258. [Google Scholar] [CrossRef] [PubMed]
- Takabayashi, T.; Kato, A.; Peters, A.T.; Hulse, K.E.; Suh, L.A.; Carter, R.; Norton, J.; Grammer, L.C.; Cho, S.H.; Tan, B.K.; et al. Excessive Fibrin Deposition in Nasal Polyps Caused by Fibrinolytic Impairment through Reduction of Tissue Plasminogen Activator Expression. Am. J. Respir. Crit. Care Med. 2013, 187, 49–57. [Google Scholar] [CrossRef] [Green Version]
- Katoh, M. Multi-layered prevention and treatment of chronic inflammation, organ fibrosis and cancer associated with canonical WNT/β-catenin signaling activation (Review). Int. J. Mol. Med. 2018, 42, 713–725. [Google Scholar] [CrossRef] [Green Version]
hsa-miR-203a-3p | 000507 | GUGAAAUGUUUAGGACCACU |
hsa-miR-125b | 000449 | UCCCUGAGACCCUAACUUGUGA |
U6 snRNA | 001973 | GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTT |
RNU48 | 001006 | GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCGCTCTGACC |
Group | Normal | Polyposis | Difference (95% CI) | p-Value |
---|---|---|---|---|
(n = 20) | (n = 86) | |||
Age (years), mean (SD) | 37.12 (12.8) | 49.57 (12.76) | <0.001 | |
Sex (F), n (%) | 8 (40) | 29 (33.72) | 0.596 | |
Smoking, n (%) | 3 (15) | 20 (23.25) | 0.554 | |
Asthma, n (%) | 0 (0) | 28 (32.55) | 0.010 | |
Allergy, n (%) | 0.09 | |||
Environmental | 3 (15) | 18 (20.93) | ||
NSAIDs | 0 (0) | 14 (16.28) | ||
No | 17 (85) | 54 (62.79) | ||
miR-125, median (IQR) | 0.4 (0.3–0.64) | 1.19 (0.88–1.85) | 0.74 (−1.08–−0.53) | <0.001 |
miR-203, median (IQR) | 1.42 (0.78–2.97) | 0.4 (0.26–0.62) | 1.02 (0.59–1.37) | <0.001 |
Environmental Allergy: | No (n = 82) | Yes (n = 21) | Difference (95% CI) | p |
---|---|---|---|---|
miR-125, median (IQR) | 0.96 (0.64–1.82) | 0.98 (0.71–1.39) | 0.03 (−0.24–0.41) | 0.658 |
miR-203, median (IQR) | 0.53 (0.34–0.77) | 0.3 (0.2–0.52) | 0–14 (0–0.31) | 0.047 |
miR-125b Overexpression: | No | Yes | p |
---|---|---|---|
(n = 41) | (n = 45) | ||
Age (years), median (IQR) | 50 (44–61) | 46 (36–55) | 0.073 |
Sex (F), nr (%) | 18 (43.9) | 11 (24.44) | 0.057 |
Smoking (Yes), nr (%) | 11 (26.83) | 9 (20) | 0.454 |
Allergy (Yes), nr (%) | 15 (36.59) | 17 (37.78) | 0.909 |
Allergy type, nr (%) | 0.187 | ||
NSAIDs | 4 (9.76) | 10 (22.22) | |
Environmental | 11 (26.83) | 7 (15.56) | |
No | 26 (63.41) | 28 (62.22) | |
Asthma (Yes), nr (%) | 12 (29.27) | 16 (35.56) | 0.534 |
Endoscopy score average score, median (IQR) | 2 (1.5–2.5) | 2.5 (2–3) | 0.021 |
Endoscopy score maxim score, median (IQR) | 2 (2–3) | 3 (2–3) | 0.027 |
Endoscopy score sum score, median (IQR) | 4 (3–5) | 5 (4–6) | 0.021 |
Eosinophiles (%), median (IQR) | 6.42 (5.62–7.29) | 8.37 (6.54–11.09) | 0.018 |
PHQ-9 preop, median (IQR) | 4 (2–6) | 5 (3–8) | 0.107 |
Lund Mackay sum score, median (IQR) | 15 (13–19) | 17 (14–20) | 0.063 |
SNOT initial, median (IQR) | 36 (26–54) | 49 (28–65) | 0.093 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gata, A.; Neagoe, I.B.; Leucuta, D.-C.; Budisan, L.; Raduly, L.; Trombitas, V.E.; Albu, S. MicroRNAs: Potential Biomarkers of Disease Severity in Chronic Rhinosinusitis with Nasal Polyps. Medicina 2023, 59, 550. https://doi.org/10.3390/medicina59030550
Gata A, Neagoe IB, Leucuta D-C, Budisan L, Raduly L, Trombitas VE, Albu S. MicroRNAs: Potential Biomarkers of Disease Severity in Chronic Rhinosinusitis with Nasal Polyps. Medicina. 2023; 59(3):550. https://doi.org/10.3390/medicina59030550
Chicago/Turabian StyleGata, Anda, Ioana Berindan Neagoe, Daniel-Corneliu Leucuta, Liviuta Budisan, Lajos Raduly, Veronica Elena Trombitas, and Silviu Albu. 2023. "MicroRNAs: Potential Biomarkers of Disease Severity in Chronic Rhinosinusitis with Nasal Polyps" Medicina 59, no. 3: 550. https://doi.org/10.3390/medicina59030550
APA StyleGata, A., Neagoe, I. B., Leucuta, D.-C., Budisan, L., Raduly, L., Trombitas, V. E., & Albu, S. (2023). MicroRNAs: Potential Biomarkers of Disease Severity in Chronic Rhinosinusitis with Nasal Polyps. Medicina, 59(3), 550. https://doi.org/10.3390/medicina59030550