Next Article in Journal
Inhibitory Effects of 3-Deoxysappanchalcone on Particulate-Matter-Induced Pulmonary Injury
Previous Article in Journal
Genetic Risk of MASLD in Mongolians: Role of PNPLA3 and FTO SNPs
Previous Article in Special Issue
Functional Analysis of Malus halliana WRKY69 Transcription Factor (TF) Under Iron (Fe) Deficiency Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 47
Issue 8
10.3390/cimb47080606
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Heterologous Watermelon HSP17.4 Expression Confers Improved Heat Tolerance to Arabidopsis thaliana

by
Yajie Hong
1,2,
Yurui Li
1,
Jing Chen
1,
Nailin Xing
3,
Wona Ding
1,
Lili Chen
1,
Yunping Huang
3,
Qiuping Li
1,* and
Kaixing Lu
1,*
1
Ningbo Key Laboratory of Agricultural Germplasm Resources Mining and Environmental Regulation, College of Science & Technology, Ningbo University, Ningbo 315300, China
2
School of Marine Sciences, Ningbo University, Ningbo 315211, China
3
Institute of Vegetables, Ningbo Academy of Agricultural Sciences, Ningbo 315040, China
*
Authors to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2025, 47(8), 606; https://doi.org/10.3390/cimb47080606
Submission received: 20 June 2025 / Revised: 20 July 2025 / Accepted: 31 July 2025 / Published: 1 August 2025
(This article belongs to the Special Issue Advances in Multi-Omics for Functional Genomics Studies and Molecular Breeding)
Browse Figures
Review Reports Versions Notes

Abstract

Members of the heat shock protein 20 (HSP20) family of proteins play an important role in responding to various forms of stress. Here, the expression of ClaHSP17.4 was induced by heat stress in watermelon. Then, a floral dipping approach was used to introduce the pCAMBIA1391b-GFP overexpression vector encoding the heat tolerance-related gene ClaHSP17.4 from watermelon into Arabidopsis thaliana, and we obtained ClaHSP17.4-overexpressing Arabidopsis plants. Under normal conditions, the phenotypes of transgenic and wild-type (WT) Arabidopsis plants were largely similar. Following exposure to heat stress, however, the germination rates (96%) of transgenic Arabidopsis plants at the germination stages were significantly higher than those of wild-type idopsis (17%). Specifically, the malondialdehyde (MDA) content of transgenic Arabidopsis was half that of the control group, while the activities of peroxidase (POD) and superoxide dismutase (SOD) were 1.25 times those of the control group after exposure to high temperatures for 12 h at the seedling stages. The proline content in ClaHSP17.4-overexpressing transgenic Arabidopsis increased by 17% compared to WT plants (* p < 0.05), while the soluble sugar content rose by 37% (* p < 0.05). These results suggest that ClaHSP17.4 overexpression indirectly improves the antioxidant capacity and osmotic regulatory capacity of Arabidopsis seedlings, leading to improved survival and greater heat tolerance. Meanwhile, the results of this study provide a reference for further research on the function of the ClHSP17.4 gene and lay a foundation for breeding heat-tolerant watermelon varieties and advancing our understanding of plant adaptation to environmental stress.

1. Introduction

China is the world’s largest producer and consumer of watermelons, with an annual production of 300 million tons, accounting for 70.6% of global output (Food and Agriculture Organization; 2023). Watermelon plants are often exposed to various unfavorable environmental conditions such as drought, temperature variations, and salt stress. Drought can cause dehydration of plant cells, osmotic imbalance, and reduced photosynthetic activity [1]. High- and low-temperature stress disrupts the structure and function of plant cells, resulting in decreased chlorophyll levels and impaired photosynthesis [2,3]. Excessive salt accumulation can lead to premature aging and wilting of leaves [4]. These abiotic stresses ultimately lead to a significant reduction in watermelon yield. To counteract these challenges, plants have evolved a series of defensive responses, many of which are characterized by changes in gene expression that enhance stress resistance [5].
Heat shock proteins (HSPs) are a group of evolutionarily conserved proteins that are upregulated in plants exposed to abiotic stress conditions [6]. These HSPs primarily function as molecular chaperones that confer resistance to heat and salinity, stabilizing plant cellular structures [6]. HSPs also serve an important regulatory role during plant development [7]. HSP family members are classified into five subfamilies based on their molecular weights and sequence similarity, including the HSP100, HSP90, HSP70, HSP60, and small HSP (sHSP/HSP20) families [7]. HSP20s range in size from 12 to 43 kD [8] and contain a highly conserved C-terminal α-crystallin domain (ACD), whereas their N-terminus tends to be more variable [9]. The ACD consists of a series of β-strands in the N-terminal common region I (CRI; β2-β3-β4-β5), a C-terminal common region II (CRII; β7-β8-β9), and a hydrophobic ring (β6-ring) linking these CRI and CRII domains CRI with CRII [10]. HSP20s rapidly accumulate in response to heat stress and can bind to denatured proteins, protecting against permanent protein aggregation. When the stress conditions have abated, HSP20 can then separate from these denatured proteins, allowing them to interact with additional molecular chaperones [11]. Under normal physiological conditions, HSP20s are generally undetectable in plant cells, although they are induced by stresses including oxidative stress, cold, drought, salinity, and biotic stress conditions whereupon they serve to help improve tolerance through the preservation of cellular integrity and homeostasis [10]. Constitutive HSP20 expression in transgenic plants has been shown to enhance stress resistance and productivity under various stress conditions [10]. For example, constitutively expressing TaHSP17.6 in Arabidopsis thaliana improves salt tolerance and reduces sensitivity to exogenous ABA [12]. Heterologous LimHSP16.45 expression enhances Arabidopsis viability under conditions of oxidative stress, high salt levels, and high temperatures, with heat shock granules (HSGs) forming in response to heat or salt stress [13]. Overexpressing SIHSP17.7 has been reported to increase tolerance to cold stress in tomatoes by promoting sucrose accumulation within cells while mitigating reactive oxygen species (ROS) production [14]. In rice, HSP20 overexpression has similarly been reported to improve resistance to dehydration, drought, and ultraviolet-B radiation exposure [15]. Transgenic Arabidopsis plants expressing MsHSP16.9 and TaHSP23.9 also exhibit more robust growth and superior tolerance when exposed to high temperatures [16]. Overexpressing HSP20 in LimHSP16.45 in the Arabidopsis hsp17.6II mutant line has also been shown to increase abiotic stress tolerance [17]. However, research on HSP genes in watermelon (Citrullus lanatus) remains limited. To date, only one study has provided valuable insights into the classification and expression patterns of watermelon HSP genes [18], but it did not elucidate the specific functional roles of individual HSP genes under heat stress. This gap in knowledge highlights the limitations of current research on watermelon HSP genes, particularly the lack of functional characterization of specific HSP members. Given the economic importance of watermelon as a globally cultivated crop and its susceptibility to high-temperature stress, understanding the molecular mechanisms underlying its thermotolerance is of great significance.
In this context, our study focuses on the functional analysis of the watermelon HSP17.4 (ClCG04G005380) gene in response to high-temperature stress. ClaHSP17.4 (ClCG04G005380) is one of the three genes most significantly upregulated among the 44 HSP genes in watermelon under heat stress at 42 °C. Furthermore, the promoter region of ClaHSP17.4 contains cis-elements responsive to heat stress [18]. ClHSP17.4 may thus play an important role in watermelon heat stress responses. In this study, an effort was made to better understand the functions of the ClaHSP17.4 gene. To that end, ClaHSP17.4 was cloned from the watermelon variety 8424 and used to construct the pCAMBIA1391b-GFP overexpression vector, which was then introduced into Arabidopsis via an Agrobacterium-mediated transformation system. Using this approach, the impact of ClaHSP17.4 on heat tolerance was evaluated, providing an evidence-based foundation for further studies of watermelon HSPs while also establishing a resource for future efforts to breed stress-resistant watermelon varieties.

2. Materials and Methods

2.1. Watermelon Growth and Treatment

Gene expression analyses were performed with the ‘8424’ watermelon variety. Citrullus lanatus cv. 8424 is known to be particularly sensitive to abiotic stresses, including high temperature, which is also often used in investigating the molecular mechanisms underlying heat tolerance [19,20]. These plants were grown in nutrient substrate (https://e.tb.cn/h.hQzXpsTisAsBPdk?tk=fkIW4diPAoa CZ005 (accessed on 12 June 2022)) for watermelon cultivation (pH6.5) in a temperature-controlled greenhouse with daytime/nighttime temperatures of 28/22 ± 1 °C, a light intensity of 200 µmol·m−2·s−1, and a 16 h photoperiod. Three-week-old watermelon seedlings were exposed to exogenous heat stress (42 °C), collecting leaves after 0, 1, 4, and 12 h of treatment in a growth chamber (Yanghui Instrument Co. Ltd., Ningbo, China) [21]. Three biological replicates were performed for each treatment and contained 15 seedlings. All materials were immediately frozen in liquid nitrogen and stored at −80 °C until RNA isolation.

2.2. Bioinformatics Analysis

Conserved domain prediction was performed using the SMART online software (http://smart.embl-heidelberg.de/ (accessed on 12 February 2022)). Analysis of protein molecular weight and theoretical isoelectric point was completed using ProtParam-EXPASY (https://web.expasy.org/protparam/ (accessed on 12 February 2022)). Subcellular localization prediction analysis was conducted via the online tool WoLF-PSORT (https://wolfpsort.hgc.jp/ (accessed on 12 February 2022)). Signal peptide analysis was performed with SignalP4.1 (http://www.cbs.dtu.dk/services/SignalP/ (accessed on 12 February 2022)). Protein hydrophobicity analysis was carried out using the EXPASY tool. Transmembrane domain prediction of the protein was achieved via TMHMM SERVER (https://services.healthtech.dtu.dk/services/TMHMM-2.0/ (accessed on 12 February 2022)). The promoter elements of ClaHSP17.4 were analyzed using the Plantcare online promoter analysis software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 12 February 2022)).

2.3. ClaHSP17.4 Gene Collection and ClaHSP17.4: pCAMBIA1391b-GFP Overexpression Vector Construction

The ClaHSP17.4 gene sequence was downloaded from the Cucurbitaceae genome database (http://www.cucurbitgenomics.org/ (accessed on 4 February 2022)) and genome version (e.g., Charleston Gray) on 11 March 2022, and corresponding primers were developed with Primer Premier 5.0. Total RNA was then extracted from the developing leaves of ‘8424’ watermelons, followed by the synthesis of cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). qPCR was next used to amplify ClaHSP17.4 using specific primers qPCR-ClaHSP17.4 (Table 1), after which TA cloning, transformation, screening, enzyme digestion, and sequencing were used to confirm that the ClaHSP17.4: pMD-19-T cloning vector had been successfully established. The qPCR reaction mix (50 μL) consisted of 25 μL 2× Taq Master Mix, 4 μL cDNA (~50 ng), 19 μL ddH2O, and 2 μL primers. The qPCR thermocycler settings were as follows: 94 °C for 4 min; 30 cycles of 94 °C for 4 min, 58 °C for 30s, 72 °C for 1 min, final extension at 72 °C for 5 min, and storage at 16 °C. Double-enzyme digestion of the ClaHSP17.4: pMD19-T cloning vector and the pCAMBIA1391b-GFP vector was then performed with Kpn I and BamH I (with K buffer for 2 h in 37 °C), followed by recovery of the digestion products with the Universal DNA Purification Kit DP214 (TIANGEN, Beijing, China). The vectors were subjected to T4 ligation (T4 DNA Ligase, 16 °C overnight). The resultant ClaHSP17.4: pCAMBIA1391b-GFP constructs were sequenced by Wuhan Gene Create Bioengineering Co., Ltd. (Wuhan, China).

2.4. Transgenic ClaHSP17.4-Overexpressing Arabidopsis Plant Selection

An Agrobacterium-mediated floral soaking approach and antibiotic screening were generated using ClaHSP17.4: pCAMBIA1391b-GFP transgenic Arabidopsis plants. Arabidopsis plants were grown to the flowering stage in a growth chamber (Yanghui Instrument Co. Ltd., Ningbo, China) under controlled conditions: daytime/nighttime temperatures of 23/20 ± 1 °C, a light intensity of 135 µmol·m−2·s−1, and a 16 h light/8 h dark photoperiod.
All opened flower buds and developing siliques were removed before infiltration. The Agrobacterium culture containing the ClaHSP17.4: pCAMBIA1391b-GFP vector was collected and diluted with a 5% sucrose solution (containing 0.02% Silwet) to an OD600 of approximately 0.8–1.0. The Arabidopsis inflorescences were immersed in the suspension for 1–2 min, then covered with plastic wrap and incubated in darkness for 3 days before resuming normal cultivation. When a new batch of flower buds emerged (typically after one week), the infiltration process was repeated.
T0 seeds were collected and sown on MS medium supplemented with hygromycin (25 mg·L−1) to screen for hygromycin-resistant Arabidopsis plants. Robust seedlings were selected and transplanted into a growth substrate for further cultivation. Upon seed maturation, T1 seeds were collected individually from each plant. The hygromycin-resistant Arabidopsis lines were continuously cultivated to obtain homozygous T3 seeds, which were used for subsequent experiments and phenotypic analysis. DNA from these transgenic Arabidopsis plants was extracted, and positive lines were identified using gene-specific primers qPCR-ClaHSP17.4 (Table 1).
To detect the expression levels of ClaHSP17.4 genes in ClaHSP17.4-overexpressing Arabidopsis lines, a LightCycler® 96 instrument (Roche, Mannheim, Germany) and ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nangjing, China) were used for qRT-PCR analyses, with β-actin (gene ID: Cla007792) serving as a normalization control [22]. Three biological replicates and a minimum of three technical replicates were used for each experiment. The primers used for these analyses are presented in Table 1. The qRT-PCR thermocycler settings were as follows: 95 °C for 10 min; 40 cycles of 95 °C for 5 s and 60 °C for 34 s. The primers are shown in Table 1. Relative target gene expression was computed with the 2−ΔΔCt method and statistically analyzed via t-tests.

2.5. Heat Stress Treatment and Stress-Related Analyses

The experiment was conducted using a Completely Randomized Design (CRD) with three treatments and a control group. Each treatment was randomly assigned to experimental units to minimize bias. A total of 50 seeds from the T3 transgenic plants (OE1, OE2, and OE3, corresponding to different transgenic families) and wild-type (WT) plants were inoculated on 1/2 MS solid medium, establishing three replicates per group. Control seeds were cultivated at 22 °C, with a 16/8 (D/N) light cycle, a light intensity of 135 μmol·m−2·s−1, and relative humidity of 66%. Seeds on 1/2 MS solid medium in the high-temperature group were instead incubated for 24 h at 38 °C with a 16/8 (D/N) light cycle, a light intensity of 135 μmol·m−2·s−1, and relative humidity of 66%, before transfer to normal culture conditions. All seeds were then cultivated for an additional week, counting the numbers of germination events and cotyledons in each group while also recording phenotypes. The germination rate was assessed as follows: radicle emergence ≥1 mm, The survival rate was assessed as follows: green cotyledons post-recovery. Root length was assessed using ImageJ 1.48v analysis, according to n = 10 seedlings/replicate.
Seeds from the established Arabidopsis lines were surface-sterilized with 5% NaClO for 5 min, then washed 5 times with sterile distilled water. They were sown, and uniform seedlings with 5 ± 0.3 mm hypocotyl length and fully opened cotyledon expansion were selected on day 10 of growth for transfer to 1/2 MS solid medium and allowed to grow for 5 days before initiating stress experiments. Both control and high-temperature treatment groups were set up, with three replicate seedlings per group. Plants in the high-temperature stress group were treated for 24 h in a 38 °C incubator. Whole seedlings were sampled after 0 and 12 h of exposure to high-temperature conditions for analyses of malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, and peroxidase (POD) activity. POD activity was measured as described by Beers and Sizer [22], while SOD activity was determined according to the method of Giannopolitis [23], and the MDA content was measured as described by Buege and Aust [24]. Proline and soluble sugar content were determined using the respective Solarbio detection kits (Beijing). DPS v7.05 was used to compare different traits with analyses of variance (ANOVAs).

3. Results

3.1. ClaHSP17.4 Gene Characteristics

The ClaHSP17.4 (ClCG04G005380) open reading frame is 468 bp long and includes no intron, as shown in the watermelon genome database. The 468 bp ClaHSP17.4 coding sequence was found to encode a 156-amino-acid protein with a predicted molecular weight of 17.4 kDa, according to the ProtParam tool, leading to the naming of ClaHSP17.4 accordingly. The Pfam website predicted the presence of a C-terminal conserved Alpha crystallin/Hsp20 domain in ClaHSP17.4 identified with SMART. ClaHSP17.4 was predicted to include an Alpha crystallin/HSP20 domain spanning from amino acids 40 to 156, with no N-terminal signal peptide. This absence of a signal peptide was also confirmed using the online analysis tool SignalP4.1. The presence of a non_cytoplasmic_domain was indicative of a protein lacking a trans-membrane structural region, consistent with results from the TMHMM database. The predicted isoelectric point of ClaHSP17.4, as calculated with ProtScale, was 5.93, consistent with ClaHSP17.4 being an acidic protein. The measured instability index of 30.9 was suggestive of a stable protein, as the value was less than 40. Heat shock elements (HSEs) are cis-acting elements often found in HSP20 promoters, enabling the induction of gene expression in response to heat shock conditions. Additionally, predictions from the Wolf Psort database indicated that ClaHSP17.4 may be localized in the cytoplasm. The predicted ClaHSP17.4 promoter contained many different cis-regulatory elements, including common eukaryotic transcriptional elements, elements responsive to hormones including methyl jasmonate, elements related to anaerobic conditions, and auxin-responsive elements, which are related to stress and defense responses (Table 2). Together, these findings indicate that ClaHSP17.4 is an HSP20 family member that may be involved in watermelon stress and defense responses.

3.2. Analysis of ClaHSP17.4 Expression in Response to Heat Stress in Watermelon

Next, qPCR analyses were conducted, which revealed that ClaHSP17.4 was highly upregulated in response to high-temperature stress in watermelon. A marked increase in ClaHSP17.4 expression was evident at just 1 h after heat treatment, while after 4 h the expression levels of this gene were 20 times higher than those in control samples, although a decline in ClaHSP17.4 expression was noted by 12 h (Figure 1).

3.3. Transgenic ClaHSP17.4-Overexpressing Arabidopsis Preparation

After extracting total RNA from watermelon leaves and reverse transcribing it to prepare cDNA, BamH I and Kpn I restriction sites were introduced at the ends of ClaHSP17.4 gene primers and used to amplify a 468 bp fragment (Figure 2A), which was then ligated into the pMD19-T cloning vector. Enzymatic digestion results for the positive recombinant vector are shown in Figure 2B. The ClaHSP17.4 gene was inserted into the pCAMBIA1391b-GFP-overexpressing vector via enzymatic digestion, and recovery and enzymatic digestion were then used to confirm that the recombinant ClaHSP17.4: pCAMBIA1391b-GFP plasmid had been successfully constructed, yielding a ~468 bp band (Figure 2C). Plasmid sequencing confirmed the presence of the ClaHSP17.4 gene in the forward orientation within this ClaHSP17.4: pCAMBIA1391b-GFP vector. The resultant vector was then used to transform competent Agrobacterium cells, followed by their use to infect Arabidopsis using a floral dip method. Transgenic Arabidopsis plants overexpressing ClaHSP17.4 (ClaHSP17.4-OE) were selected with hygromycin, producing a limited number of T1 seeds with normal growth (Figure 3A). PCR analyses were used to confirm the presence of the ClaHSP17.4 gene in the resultant plants (Figure 3B), confirming successful ClaHSP17.4 integration into the Arabidopsis genome. ClaHSP17.4-OE lines OE1, OE2 and OE3 were the plant materials used for subsequent experiments. To confirm the successful overexpression of ClaHSP17.4 in the three transgenic Arabidopsis lines, quantitative reverse transcription PCR (qRT-PCR) was performed to measure the expression levels of ClaHSP17.4. The results, as illustrated in Figure 3C, indicate that the expression levels of ClaHSP17.4 were significantly elevated in the transgenic lines compared to the wild-type Arabidopsis. Specifically, the expression levels in ClaHSP17.4-OE-1, ClaHSP17.4-OE-2, and ClaHSP17.4-OE-3 were found to be approximately 56,656, 45,084, and 47,069 times higher, respectively, than in the control line. These findings confirm that ClaHSP17.4 was successfully overexpressed in these transgenic lines, validating the effectiveness of the genetic modification.

3.4. Heterologous ClaHSP17.4 Expression Enhances Arabidopsis Heat Tolerance at the Germination Stage

No significant differences in germination rates were noted when comparing T3 ClaHSP17.4-OE and WT Arabidopsis under normal conditions (Figure 4A), with both varieties exhibiting respective 95% germination rates after cultivation for 7 days (Figure 4B). Upon exposure to high-temperature stress, the germination rates for transgenic ClaHSP17.4-OE were significantly higher than those for WT controls (Figure 4C). Specifically, the transgenic germination rates were 96%, as compared to just 17% for WT Arabidopsis under heat stress (38 °C) (Figure 4D). The ClaHSP17.4 gene can thus enhance Arabidopsis heat tolerance during the germination stage.

3.5. ClaHSP17.4 Improves Arabidopsis Seedling Heat Tolerance

When comparing the WT and ClaHSP17.4-overexpressing transgenic Arabidopsis plants from the T3 generation, no significant differences in root length or cotyledon morphology were observed under normal conditions (Figure 5A). However, heat stress elicited less severe damage in the transgenic seedlings relative to WT Arabidopsis controls (Figure 5B). Moreover, the cotyledons of transgenic Arabidopsis seedlings were stronger and brighter colored as compared to those of WT plants. Transgenic plants also exhibited longer roots (0.5–1 cm) than WT controls under high-temperature stress, with a better-developed root system (Figure 5B,C). The ClaHSP17.4 gene thus appears to enhance Arabidopsis seedling heat tolerance.

3.6. Impact of Heat Stress on MDA Content, Soluble Sugar, Proline Content, SOD Activity, and POD Activity in Arabidopsis Seedlings Overexpressing ClaHSP17.4

Lastly, the impact of heat stress on MDA levels, SOD activity, and POD activity was analyzed in WT and ClaHSP17.4-overexpressing transgenic Arabidopsis (Figure 5). Heat stress exposure was associated with lower levels of SOD and POD activity in WT Arabidopsis relative to the levels in transgenic plants, with some time-dependent fluctuation. These activity levels were persistently lower in WT Arabidopsis relative to the transgenic plants (Figure 5D,E), whereas the opposite was true with respect to MDA levels (Figure 5F). Specifically, the MDA content of transgenic Arabidopsis was half that of the control group, while the activities of POD and SOD were 1.25 times those of the control group after exposed to high temperatures for 12 h at the seedling stages. These findings demonstrate the ability of ClaHSP17.4 to indirectly enhance antioxidant responses in Arabidopsis, ultimately contributing to improved heat stress. The changes in osmotic adjustment substances under heat stress are shown in Figure 5G,H. Under normal conditions, there was no significant difference in proline and soluble sugar content between the wild-type and overexpressed lines (p > 0.05). After 12 h of high-temperature stress, the content of both osmotic adjustment substances increased significantly, with the accumulation rate of proline and soluble sugars in the overexpressed lines being notably higher than in WT Arabidopsis. The proline content in ClaHSP17.4-overexpressing transgenic Arabidopsis increased by 17% compared to WT (* p < 0.05) (Figure 5G), while the soluble sugar content rose by 37% (* p < 0.05) (Figure 5H). These data indicate that overexpression of the ClaHSP17.4 gene can significantly promote the synthesis and accumulation of osmotic adjustment substances under high-temperature stress, thereby enhancing the plant’s heat tolerance.

4. Discussion

The increasingly common outbreaks of extreme weather in recent years have contributed to declining watermelon quality and yields, adversely affecting overall watermelon production efforts. It is thus vital that the tolerance of watermelon crops to heat stress be improved, with the use of heat-resistant watermelon germplasm resources for the molecular breeding of stress-resistant varieties representing a particularly promising approach. To that end, the identification and characterization of stress resistance-related genes is particularly important. Members of the HSP20 family of proteins are particularly important mediators of stress tolerance that are involved in cell structural maintenance, protein folding, and the preservation of homeostatic balance in response to a range of environmental challenges [25]. In this study, the temperature response-related ClaHSP17.4 gene encoding a 211-amino-acid protein was successfully cloned from the ‘8424’ watermelon variety. Sequence analysis revealed that ClaHSP17.4 contains a conserved C-terminal ACD_sHs-like domain, a hallmark of the HSP20 family. This domain functions by binding misfolded proteins to prevent irreversible aggregation rather than refolding them. The N-terminus of ClaHSP17.4 is involved in binding denatured proteins, while its C-terminus facilitates homo-oligomerization and the formation of heat stress particles, which are crucial for thermotolerance. These features suggest that ClaHSP17.4 acts as a molecular chaperone, participating in oligomerization processes to protect cells under heat stress [26]. Whole-genome identification results led to the assignment of ClaHSP17.4 to the CII subgroup of HSP20s [18], which primarily localize to the cytosol and nucleus [18]. The assignment of ClaHSP17.4 to this CII subgroup is supported by the presence of a conserved ACD domain and its nucleus localization. Members of this CII subfamily are evolutionarily conserved and responsive to heat stress in plants [25], that is correlates with the role of the chaperone αB-crystallin polydispersity in maintaining lens transparency while avoiding crystallization [27]. Together with HSP101, CII HSP20s have been reported to be essential for recovery following exposure to severe heat stress (10 h, 45 °C) while also exhibiting independent functions in Arabidopsis [28]. These findings suggest that ClaHSP17.4 likely contributes to thermotolerance under high-temperature conditions. To further explore its regulatory mechanisms, we analyzed the promoter region of ClaHSP17.4 and its expression patterns under heat stress. The promoter was found to contain multiple stress- and defense-related cis-acting elements (Table 2 and Figure 1), and transcript levels of ClaHSP17.4 were significantly upregulated in response to heat stress. This is consistent with previous studies, such as the induction of LrHSP17.2 expression under heat stress and the enhanced thermotolerance observed in LrHSP17.2-overexpressing plants [29]. These findings suggest that ClaHSP17.4 may be involved in plant heat resistance regulation, which is consistent with the stress-responsive mechanisms of HSP gene family members in various plant species.
HSP20 expression is observed as a component of the developmental program engaged during seed maturation [30]. Class II HSP20s may have endowed early land plants with desiccation tolerance, while also conferring similar benefits to seeds. Additionally, HSPs are implicated in translational reactivation during seed imbibition, as evidenced by their interactions with specific translation factors under heat stress conditions [28,30,31]. This suggests that HSPs not only protect cellular structures but also facilitate the resumption of metabolic activities essential for germination. Supporting this notion, seeds overexpressing PpHSP20-32 exhibit enhanced thermotolerance when exposed to high temperatures [32], highlighting the functional importance of HSP20s in stress adaptation. In this study, we investigated the physiological role of ClaHSP17.4 in plant heat stress responses by overexpressing this gene in Arabidopsis. Our results demonstrate that plants overexpressing ClaHSP17.4 exhibit significantly improved heat stress tolerance during the bud stage compared to wild-type plants (Figure 4). This enhanced thermotolerance likely stems from the ability of ClaHSP17.4 to stabilize cellular proteins and maintain cellular homeostasis under high-temperature conditions. Furthermore, the overexpression of ClaHSP17.4 may improve Arabidopsis germination rates under high temperatures, suggesting its potential role in safeguarding reproductive success in heat-stressed environments. These findings underscore the physiological significance of ClaHSP17.4 as a key player in heat stress responses, with implications for improving crop resilience to climate change.
In response to environmental stress conditions, HSP20s can alter their structural features to limit harmful compound formation, exert antioxidant effects, promote cellular homeostasis, improve plant survival, and confer better resistance under a range of noxious conditions [10]. Specifically, cytosolic HSP20s are closely associated with plant heat resistance [33]. Similarly, the pepper CaHSP16.4 gene has been shown to be associated with improved heat tolerance and survival in transgenic plants, attributable to a reduction in electrical leakage [34]. PtHSP17.8 overexpression in Arabidopsis has been reported to be associated with improved health and salt stress tolerance [35]. Overexpression of CaHsp25.9 enhances thermotolerance in pepper [36]. In this study, ClaHSP17.4 overexpression similarly enhanced Arabidopsis seedling tolerance to heat stress such that these transgenic seedlings grew better than WT controls under high-temperature conditions, with corresponding improvements in the number of lateral roots and root length. This suggests that root characteristics are shaped by ClaHSP17.4 under high-temperature stress in a manner that allows plants to more effectively adapt to these conditions. This aligns with previous findings that robust lateral root development and root hair proliferation are key adaptive responses to drought and heat [37].
Under abiotic stress conditions, plants can eliminate ROS under these conditions through the enhancement in SOD, POD, and CAT activity. ROS biogenesis can also trigger unsaturated membrane fatty acid peroxidation, leading to MDA production [38]. When MDA accumulates at high levels, this can cause cell membrane damage such that MDA content is often analyzed as a measure of membrane damage in stress-exposed plants. For example, CmHSF30 transgenic Arabidopsis showed marked thermotolerance enhancement under heat stress, attributed to enhanced SOD activity, and reduced accumulation of MDA [39]. Similarly, LrHSP17.2 transgenic plants significantly increased the activities of CAT, SOD, and POD under stress and decreased the content of MDA to enhance tolerance under heat stress [29]. In this study, ClaHSP17.4 overexpression in transgenic Arabidopsis was associated with significant increases in SOD and POD activity under heat stress conditions relative to those in WT plants, while also reducing MDA accumulation (Figure 5D–F). These findings suggest that ClaHSP17.4 enhances antioxidant capacity, protecting cellular membranes from oxidative damage and improving seedling survival under high-temperature stress. Transgenic Arabidopsis seedlings thus appear to improve antioxidant and osmoregulatory activity under high-temperature stress conditions, leading to better survival and stress tolerance at the seedling stage.
Under abiotic stress conditions, the accumulation of a large number of harmful chemicals will lead to an imbalance in the osmotic pressure of plant cells, and the structure and function of the cell membrane will be impaired; in this case, plants will use their metabolic pathways to accumulate a large number of osmotic regulatory substances (such as proline, soluble sugar, betaine, etc.), which will help maintain the osmotic pressure of the cell and protect the system components of the cell membrane to minimize the harmful effects of stress [40,41]. Overexpression of Nicotiana tabacum Hsp17.6 enhances abiotic stress tolerance in Brassica napus by regulating the content of osmoregulatory substances, such as proline and soluble sugars, thereby improving the plant’s osmotic adjustment capacity [41]. Similarly, our study demonstrates that ClaHSP17.4 overexpression in transgenic Arabidopsis significantly enhances heat tolerance through a similar mechanism. Under normal growth conditions, there was no significant difference in the levels of soluble sugars and proline between the wild-type and overexpressed lines. However, after 12 h of high-temperature stress, the proline content in ClaHSP17.4-overexpressing transgenic Arabidopsis increased by 17% compared to WT (* p < 0.05) (Figure 5G), while the soluble sugar content rose by 37% (* p < 0.05) (Figure 5H). The increased accumulation of proline and soluble sugars likely stabilizes cellular structures, protects enzymes and membranes, and maintains osmotic balance under heat stress, thereby mitigating cellular damage and improving plant survival [41]. These findings suggest that ClaHSP17.4-overexpressing transgenic Arabidopsis may enhance its heat tolerance by modulating the levels of osmoregulatory substances, such as proline and soluble sugars, thereby improving the osmotic adjustment capacity of the overexpressing line.
The current study primarily focused on the physiological and molecular responses of ClaHSP17.4-overexpressing plants under high-temperature stress. However, the underlying regulatory mechanisms, particularly the interactions between ClaHSP17.4 and other stress-responsive genes or pathways, remain to be fully elucidated. This study was limited to Arabidopsis thaliana as a model organism, and further validation in crop species is necessary to assess the translational potential of ClaHSP17.4 for agricultural applications. We will focus on performing transgenic experiments in watermelon to directly investigate ClaHSP17.4’s effect on fruit formation under heat stress. We will analyze the morphological, physiological, and molecular changes in fruit development caused by ClaHSP17.4 overexpression or knockout under heat stress, and compare the results with those obtained in the current model system to provide a comprehensive understanding of the gene’s function. Meanwhile, field trials should be conducted to evaluate the performance of ClaHSP17.4-overexpressing watermelon under natural environmental conditions, including combined stresses such as drought and heat. Functional validation of ClaHSP17.4 in economically important crop species, such as rice, wheat, and maize, will be essential to determine its potential for enhancing crop resilience to climate change.

5. Conclusions

ClaHSP17.4 plays a role in high-temperature stress responses and is capable of promoting the accumulation of osmoregulatory substances and antioxidant activity in leaves (Figure 6), which was manifested in the increase in proline content of 17%, the increase in soluble sugar content of 37%, and the increase in POD and SOD activities of 25%. Meanwhile, ClaHSP17.4 reduces membrane lipid peroxidation and cell membrane permeability. Therefore, ClaHSP17.4-overexpressing transgenic Arabidopsis is resistant to heat at the germination and seedling stages, and the germination rate of ClaHSP17.4-overexpressing transgenic Arabidopsis under heat stress is not affected by high temperature.

Author Contributions

Conceptualization, Q.L. and K.L.; methodology, N.X. and Y.L.; formal analysis, Y.H. (Yajie Hong); writing—original draft preparation, Y.H. (Yajie Hong), J.C. and Q.L.; writing—review and editing, Y.L., Q.L. and N.X.; supervision, N.X., L.C., Y.H. (Yunping Huang), W.D. and J.C.; funding acquisition, Q.L., L.C., Y.H. (Yunping Huang) and W.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Ningbo 2025 Key Technology Project of Yongjiang Science and Technology Innovation (Grant No. 2021Z132), the Zhejiang Provincial Natural Science Foundation (Grant No. LY23C050001), the Youth Science and Technology Innovation Leading Talent Project of Ningbo, China (Grant No. 2024QL061), the Natural Science Foundation of Ningbo City (Grant No. 2024J177), and the Young Doctor Innovative Research Project of Ningbo Natural Science Foundation (Grant No. 2022J137).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All datasets generated for this study are included in the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Jia, X.; Mao, K.; Wang, P.; Wang, Y.; Jia, X.; Huo, L.; Sun, X.; Che, R.; Gong, X.; Ma, F. Overexpression of mdatg8i improves water use efficiency in transgenic apple by modulating photosynthesis, osmotic balance, and autophagic activity under moderate water deficit. Hortic. Res. 2021, 8, 81. [Google Scholar] [CrossRef] [PubMed]
  2. Garstka, M.; Venema, J.H.; Rumak, I.; Gieczewska, K.; Rosiak, M.; Koziol-Lipinska, J.; Kierdaszuk, B.; Vredenberg, W.J.; Mostowska, A. Contrasting effect of dark-chilling on chloroplast structure and arrangement of chlorophyll–protein complexes in pea and tomato: Plants with a different susceptibility to non-freezing temperature. Planta 2007, 226, 1165–1181. [Google Scholar] [CrossRef] [PubMed]
  3. Mattila, H.; Mishra, K.B.; Kuusisto, I.; Mishra, A.; Novotná, K.; Šebela, D.; Tyystjärvi, E. Effects of low temperature on photoinhibition and singlet oxygen production in four natural accessions of Arabidopsis. Planta 2020, 252, 19. [Google Scholar] [CrossRef]
  4. Garg, A.; Bordoloi, S.; Ganesan, S.P.; Sekharan, S.; Sahoo, L. A relook into plant wilting: Observational evidence based on unsaturated soil–plant-photosynthesis interaction. Sci. Rep. 2020, 10, 1–15. [Google Scholar] [CrossRef]
  5. Yang, K.Y.; Dong, Q.L.; Wu, J.H.; Li, H.; Luan, H.A.; Jia, P.; Zhang, X.M.; Guo, S.P.; Yang, M.S.; Qi, G.H. Genome-wide analysis of the R2R3-MYB transcription factor gene family expressed in Juglans regia under abiotic and biotic stresses. Ind. Crops Prod. 2023, 198, 279–289. [Google Scholar] [CrossRef]
  6. Neto, V.G.; Barbosa, R.R.; Carosio, M.G.; Ferreira, A.G.; Fernandez, L.G.; Castro, R.D.; Ligterink, W.; Hilhorst, H.; Ribeiro, P.R. Sequence analysis of Ricinus communis small heat-shock protein (sHSP) subfamily and its role in abiotic stress responses. Ind. Crops Prod. 2020, 152, 112541. [Google Scholar] [CrossRef]
  7. Kiang, J.G.; Tsokos, G.C. Heat shock protein 70 kDa: Molecular biology, biochemistry and physiology. Pharmacol Ther. 1998, 80, 183–201. [Google Scholar] [CrossRef]
  8. Panasenko, O.O.; Kim, M.V.; Gusev, N.B. Structure and properties of small heat shock protein (sHSP). Biochemistry 2002, 67, 511–519. [Google Scholar]
  9. Gao, T.; Mo, Z.; Tang, L.; Yu, X.Z.; Du, G.Y.; Mao, Y.X. Heat shock protein 20 gene superfamilies in red algae: Evolutionary and functional diversities. Front. Plant Sci. 2022, 13, 125–130. [Google Scholar] [CrossRef]
  10. Wu, J.T.; Gao, T.; Hu, J.N.; Zhao, L.; Yu, C.; Ma, F. Research advances in function and regulation mechanisms of plant small heat shock proteins (sHSPs) under environmental stresses. Sci. Total Environ. 2022, 825, 154054. [Google Scholar] [CrossRef]
  11. Peng, L.N.; Huang, L.B.; Gui, T.Y.; Gao, D.H.; Yan, X.H. Identification and expression profiling of HSP20 genes in Neoporphyra haitanensis. J. Appl. Phycol. 2022, 34, 1089–1097. [Google Scholar] [CrossRef]
  12. Qin, Y.; Liu, X.Z.; Quan, X.Y.; Chen, J.F.; Wang, Z.X. Heterologously expressing a wheat CI small heat shock protein gene enhances the salinity tolerance of Arabidopsis thaliana. J. Plant Growth Regul. 2022, 41, 236–243. [Google Scholar] [CrossRef]
  13. Mu, C.J.; Zhang, S.J.; Yu, G.Z.; Chen, N.; Li, X.F.; Liu, H. Overexpression of small heat shock protein LimHSP16.45 in Arabidopsis enhances tolerance to abiotic stresses. PLoS ONE. 2013, 8, e82264. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, N.; Zhao, H.Y.; Shi, J.W.; Wu, Y.Y.; Jiang, J. Functional characterization of class I SlHSP17.7 gene responsible for tomato cold-stress tolerance. Plant Sci. 2020, 298, 110568. [Google Scholar] [CrossRef]
  15. Waadt, R.; Seller, C.A.; Hsu, P.; Takahashi, Y.; Munemasa, S.; Schroeder, J. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694, Correction in Nat. Rev. Mol. Cell Biol. 2022, 23, 516. [Google Scholar] [CrossRef]
  16. Wang, J.; Gao, X.; Dong, J.; Tian, X.Y.; Wang, J.Z.; Palta, J.A.; Xu, S.B.; Fang, Y.; Wang, Z.H. Over-expression of the heat-responsive wheat gene TaHSP23.9 in transgenic Arabidopsis conferred tolerance to heat and salt stress. Front. Plant Sci. 2020, 11, 243. [Google Scholar] [CrossRef]
  17. Yang, R.; Yu, G.; Li, H.; Li, X.; Mu, C. Overexpression of small heat shock protein LimHSP16.45 in Arabidopsis hsp17.6II mutant enhances tolerance to abiotic stresses. Russ. J. Plant Physiol. 2020, 67, 98–105. [Google Scholar] [CrossRef]
  18. He, Y.J.; Fan, M.; Sun, Y.Y.; Li, L.L. Genome-wide analysis of watermelon HSP20s and their expression profiles and subcellular locations under stresses. Int. J. Mol. Sci. 2019, 20, 12. [Google Scholar] [CrossRef]
  19. Shireen, F.; Nawaz, M.A.; Xiong, M.; Ahmad, A.; Sohail, H.; Chen, Z.; Abouseif, Y.; Huang, Y.; Bie, Z. Pumpkin rootstock improves the growth and development of watermelon by enhancing uptake and transport of boron and regulating the gene expression. Plant Physiol. Biochem. 2020, 154, 204–218. [Google Scholar] [CrossRef]
  20. Nawaz, M.A.; Chen, C.; Shireen, F.; Zheng, Z.; Sohail, H.; Afzal, M.; Ali, M.A.; Bie, Z.; Huang, Y. Genome-wide expression profiling of leaves and roots of watermelon in response to low nitrogen. BMC Genom. 2018, 19, 456. [Google Scholar] [CrossRef]
  21. Liu, T.; Zheng, Y.; Yang, J.; Li, R.; Chang, H.; Li, N.; Suna, W.; Wang, L.; Wang, X. Identification of MYC genes in four Cucurbitaceae species and their roles in the response to temperature stress. BMC Genom. 2024, 25, 867. [Google Scholar] [CrossRef]
  22. Li, Q.P.; Yan, W.H.; Chen, H.X.; Tan, C.; Han, Z.M.; Yao, W.; Li, G.W.; Yuan, M.Q.; Xing, Y.Z. Duplication of OsHAP family genes and their association with heading date in rice. J. Exp. Bot. 2016, 67, 1759–1768. [Google Scholar] [CrossRef] [PubMed]
  23. Beers, R.F.; Sizer, I.W. A spectrophotometric method for measuring the breakdown of hydrogen peroxide by catalase. J. Biol. Chem. 1952, 195, 133–140. [Google Scholar] [CrossRef] [PubMed]
  24. Giannopolitis, N.; Ries, K. Superoxide dismutase I: Occurrence in higher plants. Plant Physiol. 1977, 59, 309–315. [Google Scholar] [CrossRef] [PubMed]
  25. Baldwin, A.J.; Lioe, H.; Robinson, C.V.; Kay, L.E.; Benesch, J.L.P. α B-crystallin polydispersity is a consequence of unbiased quaternary dynamics. J. Mol. Biol. 2011, 413, 297–309. [Google Scholar] [CrossRef]
  26. Waters, E.R. The evolution, function, structure, and expression of the plant sHSPs. J. Exp. Bot. 2013, 64, 391–403. [Google Scholar] [CrossRef]
  27. Tardieu, A.; Delaye, M. Eye lens proteins and transparency: From light transmission theory to solution X-ray structural analysis. J. Annu. Rev. Biophys. 1988, 17, 47–70. [Google Scholar] [CrossRef]
  28. McLoughlin, F.; Basha, E.; Fowler, M.E.; Kim, M.; Bordowitz, J.; Katiyar-Agarwal, B.; Vierling, E. Class I and II small heat shock proteins together with HSP101 protect protein translation factors during heat stress. Plant Physiol. 2016, 172, 1221–1236. [Google Scholar]
  29. Tang, S.; Ling, Q.; Ma, Q.; Cheng, Y.; Mei, P.; Miao, Y.; Pan, Y.; Jia, Y.; Wu, M.; Yong, X.; et al. LrHSP17.2 plays an important role in abiotic stress responses by regulating ROS scavenging and stress-related genes in Lilium regale. Plants 2024, 13, 2416. [Google Scholar] [CrossRef]
  30. Wehmeyer, N.; Vierling, E. The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. Plant Physiol. 2000, 122, 1099–1108. [Google Scholar] [CrossRef]
  31. Dirk, L.M.A.; Downie, A.B. An examination of Job’s rule: Protection and repair of the proteins of the translational apparatus in seeds. Seed Sci. Res. 2018, 28, 168–181. [Google Scholar] [CrossRef]
  32. Waters, E.R.; Vierling, E. Plant small heat shock proteins-evolutionary and functional diversity. New Phytol. 2020, 227, 24–37. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, J.; Chen, H.Y.; Wang, H.H.; Li, B.; Yi, Y.J.; Kong, F.J.; Liu, J.Y.; Zhang, H.X. Constitutive expression of a tomato small heat shock protein gene LeHSP21 improves tolerance to high-temperature stress by enhancing antioxidation capacity in tobacco. Plant Mol. Biol. Report. 2015, 34, 399–409. [Google Scholar] [CrossRef]
  34. Huang, L.J.; Cheng, G.X.; Khan, A.; Wei, A.M.; Yu, Q.H.; Yang, S.B.; Luo, D.X.; Gong, Z.H. CaHSP16.4, a small heat shock gene in pepper, is involved in heat and drought tolerance. Protoplasma. 2018, 256, 39–51. [Google Scholar] [CrossRef]
  35. Li, J.B.; Zhang, J.; Jia, H.X.; Li, Y.; Xu, X.D.; Wang, L.J.; Lu, M.Z. The Populus trichocarpa PtHSP17.8 involved in heat and salt stress tolerances. Plant Cell Rep. 2016, 35, 1587–1599. [Google Scholar] [CrossRef]
  36. Feng, X.H.; Zhang, H.X.; Ali, M.; Gai, W.X.; Cheng, G.X.; Yu, Q.H.; Yang, S.B.; Li, X.X.; Gong, Z.H. A small heat shock protein CaHsp25.9 positively regulates heat, salt, and drought stress tolerance in pepper (Capsicum annuum L.). Plant Physiol. Biochem. 2019, 142, 151–162. [Google Scholar] [CrossRef]
  37. Wasson, A.P.; Richards, R.; Chatrath, R.; Misra, S.; Prasad, S.S.; Rebetzke, G.; Kirkegaard, J.; Christopher, J.; Watt, M. Traits and selection strategies to improve root systems and water uptake in water-limited wheat crops. J. Exp. Bot. 2012, 63, 3485–3498. [Google Scholar] [CrossRef]
  38. Kar, M.; Mishra, D. Catalase, peroxidase, and polyphenol oxidase activities during rice leaf senescence. Plant Physiol. 1976, 57, 315–319. [Google Scholar] [CrossRef]
  39. Liu, B.; Li, L.; Cheng, G.; Li, F.; Zhang, S. A pumpkin heat shock factor CmHSF30 positively regulates thermotolerance in transgenic plants. Plant Physiol. Biochem. 2025, 223, 109834. [Google Scholar] [CrossRef]
  40. Cheng, J.; Zhang, X.; Miao, Z.; Wang, H.; Pang, L.; Pan, Y. Hot air treatment alleviates chilling injury of sweet potato tuberous roots by regulating osmoregulatory substances and inducing antioxidant defense system. Food Chem. 2024, 459, 140393. [Google Scholar] [CrossRef]
  41. Zafar, S.; Yu, Y.K.; Zhu, K.M.; Wang, W.J.; Tan, X.L. Overexpression of Nicotiana tabacum Hsp17.6 enhances abiotic stress tolerance in Brassica napus. Int. J. Agric. Biol. 2020, 23, 164–170. [Google Scholar]
Cimb 47 00606 g001
Figure 1. Relative expression level of ClaHSP17.4 gene under heat stress. Note: **: very significant difference, p ≤ 0.01.
Figure 1. Relative expression level of ClaHSP17.4 gene under heat stress. Note: **: very significant difference, p ≤ 0.01.
Cimb 47 00606 g001
Cimb 47 00606 g002
Figure 2. Construction of ClaHSP17.4 gene overexpression vector. (A) PCR amplification of ClaHSP17.4; (B) double digestion of ClaHSP17.4-pMD19-T; (C) double digestion of ClaHSP17.4-pCAMBIA1391b-GFP. M: DL2000 DNA Marker.
Figure 2. Construction of ClaHSP17.4 gene overexpression vector. (A) PCR amplification of ClaHSP17.4; (B) double digestion of ClaHSP17.4-pMD19-T; (C) double digestion of ClaHSP17.4-pCAMBIA1391b-GFP. M: DL2000 DNA Marker.
Cimb 47 00606 g002
Cimb 47 00606 g003
Figure 3. Confirmation of ClaHSP17.4-overexpressing Arabidopsis lines. (A) Part of results of hygromycin screening of ClaHSP17.4-overexpressing Arabidopsis lines; (B) PCR confirmation of ClaHSP17.4-overexpressing Arabidopsis lines using genomic DNA as template; (C) Gene expression levels in ClaHSP17.4-overexpressing Arabidopsis lines. M: DL2000 DNA Marker. WT1, WT2: wild-type lines. OE1, OE2, OE3: ClaHSP17.4-overexpressing Arabidopsis lines. Note: **: significant difference, p ≤ 0.01.
Figure 3. Confirmation of ClaHSP17.4-overexpressing Arabidopsis lines. (A) Part of results of hygromycin screening of ClaHSP17.4-overexpressing Arabidopsis lines; (B) PCR confirmation of ClaHSP17.4-overexpressing Arabidopsis lines using genomic DNA as template; (C) Gene expression levels in ClaHSP17.4-overexpressing Arabidopsis lines. M: DL2000 DNA Marker. WT1, WT2: wild-type lines. OE1, OE2, OE3: ClaHSP17.4-overexpressing Arabidopsis lines. Note: **: significant difference, p ≤ 0.01.
Cimb 47 00606 g003
Cimb 47 00606 g004
Figure 4. ClaHSP17.4-OE lines enhance tolerance to heat stress during the germination stage in Arabidopsis. (A,B) Phenotype and survival rates of wild-type and ClaHSP17.4-OE lines under normal conditions; (C,D) Phenotype and survival rates of wild-type and ClaHSP17.4-OE lines under heat stress (38 °C). Note: **: significant difference, p ≤ 0.01.
Figure 4. ClaHSP17.4-OE lines enhance tolerance to heat stress during the germination stage in Arabidopsis. (A,B) Phenotype and survival rates of wild-type and ClaHSP17.4-OE lines under normal conditions; (C,D) Phenotype and survival rates of wild-type and ClaHSP17.4-OE lines under heat stress (38 °C). Note: **: significant difference, p ≤ 0.01.
Cimb 47 00606 g004
Cimb 47 00606 g005
Figure 5. ClaHSP17.4-OE lines enhance tolerance to heat stress during seedling stage in Arabidopsis. (A,B) Phenotype under normal/under heat stress conditions of wild-type and ClaHSP17.4-OE seedlings; (C–H) Root length, SOD activity, POD activity, MDA content, soluble sugar, and proline content in wild-type and ClaHSP17.4-OE seedlings treated with heat stress at 38 °C for 12 h. Plants continually grown at 22 °C were used as controls. Bars show standard deviation of three biological replicates. Note: *: significant difference, p ≤ 0.05.
Figure 5. ClaHSP17.4-OE lines enhance tolerance to heat stress during seedling stage in Arabidopsis. (A,B) Phenotype under normal/under heat stress conditions of wild-type and ClaHSP17.4-OE seedlings; (C–H) Root length, SOD activity, POD activity, MDA content, soluble sugar, and proline content in wild-type and ClaHSP17.4-OE seedlings treated with heat stress at 38 °C for 12 h. Plants continually grown at 22 °C were used as controls. Bars show standard deviation of three biological replicates. Note: *: significant difference, p ≤ 0.05.
Cimb 47 00606 g005
Cimb 47 00606 g006
Figure 6. The regulation mechanisms of ClaHSP17.4. SOD: superoxide dismutase; POD: peroxidase; MDH: mitochondrial malate dehydrogenase.
Figure 6. The regulation mechanisms of ClaHSP17.4. SOD: superoxide dismutase; POD: peroxidase; MDH: mitochondrial malate dehydrogenase.
Cimb 47 00606 g006
Table 1. Primer sequences used for quantitative real-time PCR analysis and identification of positive plants.
Table 1. Primer sequences used for quantitative real-time PCR analysis and identification of positive plants.
NameForward Primer (5′→3′)Reverse Primer (5′→3′)
qPCR-ClaHSP17.4CGGGGTACCATGGATCTCAGAATCATGGCGCGGATCCTTGACCTTGACCTCAACG
qRT-PCR-ClaHSP17.4GAGGGAGGAGGAGAAAGAGCCTGACAAACCGCTGATAT
β-actin (Cla007792)CCATGTATGTTGCCATCCAGGGATAGCATGGGGTAGAGCA
Table 2. Prediction of cis-acting elements in promoter region of ClaHSP17.4 gene.
Table 2. Prediction of cis-acting elements in promoter region of ClaHSP17.4 gene.
Component NameFunctionQuantity
Box 4, TCT-motif, AE-boxpart of light responsiveness3
AREanaerobic induction4
O2-sitezein metabolism regulation1
MYB, Myb-binding site, MybMYB7
TGACG-motif, CGTCA-motifMeJA responsiveness2
WRE3WRE31
TGA-elementauxin-responsive element1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hong, Y.; Li, Y.; Chen, J.; Xing, N.; Ding, W.; Chen, L.; Huang, Y.; Li, Q.; Lu, K. Heterologous Watermelon HSP17.4 Expression Confers Improved Heat Tolerance to Arabidopsis thaliana. Curr. Issues Mol. Biol. 2025, 47, 606. https://doi.org/10.3390/cimb47080606

AMA Style

Hong Y, Li Y, Chen J, Xing N, Ding W, Chen L, Huang Y, Li Q, Lu K. Heterologous Watermelon HSP17.4 Expression Confers Improved Heat Tolerance to Arabidopsis thaliana. Current Issues in Molecular Biology. 2025; 47(8):606. https://doi.org/10.3390/cimb47080606

Chicago/Turabian Style

Hong, Yajie, Yurui Li, Jing Chen, Nailin Xing, Wona Ding, Lili Chen, Yunping Huang, Qiuping Li, and Kaixing Lu. 2025. "Heterologous Watermelon HSP17.4 Expression Confers Improved Heat Tolerance to Arabidopsis thaliana" Current Issues in Molecular Biology 47, no. 8: 606. https://doi.org/10.3390/cimb47080606

APA Style

Hong, Y., Li, Y., Chen, J., Xing, N., Ding, W., Chen, L., Huang, Y., Li, Q., & Lu, K. (2025). Heterologous Watermelon HSP17.4 Expression Confers Improved Heat Tolerance to Arabidopsis thaliana. Current Issues in Molecular Biology, 47(8), 606. https://doi.org/10.3390/cimb47080606

Article Metrics

Back to TopTop