Potential Mechanisms and Effects of Dai Bai Jie Ethanol Extract in Preventing Acute Alcoholic Liver Injury
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Preparation of Extract from DBJ
2.3. Determination of Total Saponin Content in the Extract of DBJ
2.3.1. The Vanillin–Perchloric Acid Colorimetric Method
2.3.2. Standard Curve Generation
2.3.3. Sample Testing
- C: The concentration of total saponins in the extract of DBJ (mg/mL);V: Extract volume of DBJ (in mL);m: The quality of the extract from DBJ (in mg).
2.4. Qualitative Analysis of DBJ-3 by UPLC-MS
2.4.1. Dry Sample Extraction
2.4.2. UPLC Conditions
2.4.3. Mass Spectrometry Conditions
2.5. Cells and Experimental Design
2.5.1. Cell Culture
2.5.2. Cytotoxicity of the DBJ Extract
2.5.3. Ethanol-Induced Cytotoxicity Assay in AML-12 Cells
2.5.4. Effect of 100 mmol/L DBJ Extract on the Viability of AML-12 Cells
2.6. Animals and Experimental Design
2.6.1. Animals
2.6.2. Establishment of an AALI Mouse Model
2.7. Regulation of Serum Biochemical Indices in AALI Mice by DBJ-3
2.8. Determination of Alcohol-Metabolizing Enzymes in the Mouse Liver
2.9. Histopathological Analyses of Liver Tissue
2.10. Liver Oxidative Stress Analysis
2.11. Inflammation Analysis
2.12. Gene Levels
- The centrifuge column approach was used to extract total RNA from 20 mg of liver tissue.
- The purity of the isolated RNA was assessed using a Nanodrop 2000 spectrophotometer, with an OD 260/280 ratio of approximately 2.0, suggesting high purity.
- The RNA was treated with the kit reagents by incubation for 2 min at 42 °C and then for 1 min at 60 °C to remove residual genomic DNA. The mixture was subsequently incubated for 15 min at 50 °C and for 5 s at 85 °C to synthesize DNA.
- An ABI Quantstudio 6 Flex real-time PCR system and an ArtiCanTM SYBR qPCR kit were used for quantitative polymerase chain reaction (qPCR). Specific primers were used for qPCR analysis. The cycling procedure included 1 min of initial denaturation at 95 °C; 40 cycles of 10 s of denaturation at 95 °C, 20 s of annealing at 60 °C, and 1 min of extension at 72 °C. Gapdh served as an internal reference. The 2−ΔΔCt method was used to determine relative gene expression according to cycle threshold (Ct) values [50].
2.13. Immunohistochemical Analysis
2.14. Statistical Analysis
3. Results
3.1. Determination of Total Saponin Contents in Different Extracts of DBJ
3.2. Phytochemical Analysis of DBJ-3
3.3. Establishment of an Ethanol-Mediated AML-12 Cell Injury Model and Screening of the Effective Fractions of DBJ
3.3.1. Cytotoxicity Evaluation of DBJ Extract on Cells
3.3.2. Effect of Alcohol Concentration on the Viability of AML-12 Cells
3.3.3. Effect of DBJ Extract on the Viability of AML-12 Cells in the Presence of 100 mmol/L Ethanol
3.4. Effect of DBJ-3 on Serum Biochemical Factors in Mice with Alcohol-Induced Liver Injury
3.5. Expression Levels of Alcohol Metabolism-Related Enzymes
3.6. Histopathological Changes
3.7. Regulatory Effects of DBJ-3 on ROS and Antioxidant Parameters in Liver Tissue
3.8. Inflammatory Cytokine Levels in Liver Tissues
3.9. Regulation of the ADH1B/ALDH2 Signaling Pathway by DBJ-3
3.10. Role of the NF-κB Pathway in Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ramirez, T.; Li, Y.M.; Yin, S.; Xu, M.J.; Feng, D.C.; Zhou, Z.; Zang, M.W.; Mukhopadhyay, P.; Varga, Z.V.; Pacher, P. Aging aggravates alcoholic liver injury and fibrosis in mice by downregulating sirtuin 1 expression. J. Hepatol. 2017, 66, 601–609. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.W.; Jiang, Y.; Zhang, D.Y.; Wang, M.; Chen, W.S.; Su, H.; Wang, Y.T.; Wan, J.B. Protective effects of Penthorum chinense Pursh against chronic ethanol-induced liver injury in mice. J. Ethnopharmacol. 2015, 161, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Wong, M.C.S.; Huang, J.L.W.; George, J.; Huang, J.J.; Leung, C.; Eslam, M.; Chan, H.L.Y.; Ng, S.C. The changing epidemiology of liver diseases in the Asia–Pacific region. Nat. Rev. Gastro. Hepat. 2019, 16, 57–73. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.C.; Zhang, T.; Kusumanchi, P.; Han, S.; Yang, Z.H.; Liangpunsakul, S. Alcohol metabolizing enzymes, microsomal ethanol oxidizing system, cytochrome P450 2E1, catalase, and aldehyde dehydrogenase in alcohol-associated liver disease. Biomedicines 2020, 8, 50. [Google Scholar] [CrossRef]
- Go, M.J.; Kim, J.M.; Lee, H.L.; Kim, T.Y.; Kim, J.H.; Lee, H.S.; Kim, I.Y.; Sim, S.J.; Heo, H.J. Hepatoprotective Effect of Allium ochotense Extracts on Chronic Alcohol-Induced Fatty Liver and Hepatic Inflammation in C57BL/6 Mice. Int. J. Mol. Sci. 2024, 25, 3496. [Google Scholar] [CrossRef]
- Seitz, H.K.; Bataller, R.; Cortez-Pinto, H.; Gao, B.; Gual, A.; Lackner, C.; Mathurin, P.; Mueller, S.; Szabo, G.; Tsukamoto, H. Alcoholic liver disease. Nat. Rev. Dis. Primers 2018, 4, 16. [Google Scholar] [CrossRef]
- Warren, K.R.; Murray, M.M. Alcoholic liver disease and pancreatitis: Global health problems being addressed by the US National Institute on Alcohol Abuse and Alcoholism. J. Gastroen. Hepatol. 2013, 28, 4–6. [Google Scholar] [CrossRef]
- Li, D.; Zhao, H.; Gelernter, J. Strong protective effect of the aldehyde dehydrogenase gene (ALDH2) 504lys (* 2) allele against alcoholism and alcohol-induced medical diseases in Asians. Hum. Genet. 2012, 131, 725–737. [Google Scholar] [CrossRef]
- Gao, Y.H.; Zhou, Z.; Ren, T.Y.; Kim, S.-J.; He, Y.; Seo, W.; Guillot, A.; Ding, Y.H.; Wu, R.H.; Shao, S. Alcohol inhibits T-cell glucose metabolism and hepatitis in ALDH2-deficient mice and humans: Roles of acetaldehyde and glucocorticoids. Gut 2019, 68, 1311–1322. [Google Scholar] [CrossRef]
- Xiao, C.Q.; Zhou, F.B.; Zhao, M.M.; Su, G.W.; Sun, B.G. Chicken breast muscle hydrolysates ameliorate acute alcohol-induced liver injury in mice through alcohol dehydrogenase (ADH) activation and oxidative stress reduction. Food Funct. 2018, 9, 774–784. [Google Scholar] [CrossRef]
- Qiao, J.Y.; Li, W.; Zeng, R.Y.; Yu, Y.J.; Chen, Q.W.; Liu, X.H.; Cheng, S.X.; Zhang, X.Z. An orally delivered bacteria-based coacervate antidote for alcohol detoxification. Biomaterials 2023, 296, 122072. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.-Y.; Tsai, I.T.; Hsu, Y.-C. Alcohol-related liver disease: Basic mechanisms and clinical perspectives. Int. J. Mol. Sci. 2021, 22, 5170. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.Y.; Guo, W.H.; Dai, J.Y.; Cheng, Y.; Chen, Y.; Liu, W.; Xu, J.A.; Su, W.; Zhang, X.D.; Wang, C.J. Hydrogen gas alleviates acute ethanol-induced hepatotoxicity in mice via modulating tlr4/9 innate immune signaling and pyroptosis. Int. Immunopharmacol. 2024, 127, 111399. [Google Scholar] [PubMed]
- Louvet, A.; Mathurin, P. Alcoholic liver disease: Mechanisms of injury and targeted treatment. Nat. Rev. Gastro. Hepat. 2015, 12, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Abenavoli, L.; Masarone, M.; Federico, A.; Rosato, V.; Dallio, M.; Loguercio, C.; Persico, M. Alcoholic hepatitis: Pathogenesis, diagnosis and treatment. Rev. Recent Clin. Trials 2016, 11, 159–166. [Google Scholar] [CrossRef]
- Sharma, S.; Baweja, S.; Maras, J.S.; Shasthry, S.M.; Moreau, R.; Sarin, S.K. Differential blood transcriptome modules predict response to corticosteroid therapy in alcoholic hepatitis. JHEP Rep. 2021, 3, 100283. [Google Scholar] [CrossRef]
- Wang, F.; Wang, B.Y. Corticosteroids or non-corticosteroids: A fresh perspective on alcoholic hepatitis treatment. Hepatob. Pancreat. Dis. 2011, 10, 458–464. [Google Scholar] [CrossRef]
- Hmoud, B.S.; Patel, K.; Bataller, R.; Singal, A.K. Corticosteroids and occurrence of and mortality from infections in severe alcoholic hepatitis: A meta-analysis of randomized trials. Liver Int. 2016, 36, 721–728. [Google Scholar] [CrossRef]
- Nguyen-Khac, E.; Thevenot, T.; Piquet, M.-A.; Benferhat, S.; Hezam, A.; Goria, O.; Tramier, B.; Chatelain, D.; Dupas, J.L. Antioxidants plus corticosteroids in the treatment of severe acute alcoholic hepatitis: The question is still open. J. Hepatol. 2008, 49, 147–148. [Google Scholar] [CrossRef]
- Naveau, S.; Chollet-Martin, S.; Dharancy, S.; Mathurin, P.; Jouet, P.; Piquet, M.A.; Davion, T.; Oberti, F.; Broët, P.; Emilie, D. A double-blind randomized controlled trial of infliximab associated with prednisolone in acute alcoholic hepatitis. Hepatology 2004, 39, 1390–1397. [Google Scholar] [CrossRef]
- Mellinger, J.L.; Winder, G.S.; DeJonckheere, M.; Fontana, R.J.; Volk, M.L.; Lok, A.S.F.; Blow, F.C. Misconceptions, preferences and barriers to alcohol use disorder treatment in alcohol-related cirrhosis. J. Subst. Abus. Treat. 2018, 91, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Su, Z.W.; Yan, T.Y.; Feng, J.; Zhang, M.Y.; Han, L.; Zhang, H.F.; Xiao, Y. Protective effects and mechanism of polysaccharides from edible medicinal plants in alcoholic liver injury: A review. Int. J. Mol. Sci. 2023, 24, 16530. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.L.; Luo, H.; Jin, Y.; Shu, Y.; Wen, C.L.; Qin, T.; Yang, X.R.; Ma, L.Q.; Liu, Y.; You, Y. Asperosaponin VI protects alcohol-induced hepatic steatosis and injury via regulating lipid metabolism and ER stress. Phytomedicine 2023, 121, 155080. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.L.; Tan, F.; Li, C.; Li, W.F.; Liao, W.; Li, Q.; Qin, G.H.; Liu, W.W.; Zhao, X. White Peony (fermented Camellia sinensis) polyphenols help prevent alcoholic liver injury via antioxidation. Antioxidants 2019, 8, 524. [Google Scholar] [CrossRef] [PubMed]
- Mai, B.Y.; Han, L.; Zhong, J.R.; Shu, J.Q.; Cao, Z.L.; Fang, J.Q.; Zhang, X.Y.; Gao, Z.L.; Xiao, F.X. Rhoifolin alleviates alcoholic liver disease in vivo and in vitro via inhibition of the TLR4/NF-κB signaling pathway. Front. Pharmacol. 2022, 13, 878898. [Google Scholar] [CrossRef]
- Liu, Y.S.; Yuan, M.H.; Zhang, C.Y.; Liu, H.M.; Liu, J.R.; Wei, A.L.; Ye, Q.; Zeng, B.; Li, M.F.; Guo, Y.P. Puerariae Lobatae radix flavonoids and puerarin alleviate alcoholic liver injury in zebrafish by regulating alcohol and lipid metabolism. Biomed. Pharmacother. 2021, 134, 111121. [Google Scholar] [CrossRef]
- Wang, L.; Suo, S.Z.; Li, J.; Hu, Y.J.; Li, P.; Wang, Y.T.; Hu, H. An investigation into traditional Chinese medicine hospitals in China: Development trend and medical service innovation. Int. J. Health Policy Manag. 2017, 6, 19–25. [Google Scholar] [CrossRef]
- Niu, F.; Zhang, C.; Zheng, J. On the theory of four pagoda and five Aggregates and Dai’s view of medicine and disease. J. Yunnan Univ. Tradit. Chin. Med. 2009, 32, 62–63. [Google Scholar]
- Guo, S.; Ni, K.; Gao, M.; Yang, L.; Jin, J.; Yu, Y. Analysis on the application of Dai medical methods. Yunnan J. Tradit. Chin. Med. 2015, 36, 83–85. [Google Scholar]
- Tang, L. A Preliminary Study on the Application Law of “Yajie” Theory in Dai Medicine. Master’s Thesis, Yunnan University of Traditional Chinese Medicine, Yunnan, China, 2012. [Google Scholar]
- Wen, L.; Liu, H.G.; Luo, Y.; Lai, L.; Lu, S.H.; Qin, Y.E. Determination of total saponins in Panax Notoginseng enteric-coated pellets and their release in vitro. Rev. Chin. Med. 2022, 28, 44–48. [Google Scholar]
- Nickel, J.; Spanier, L.P.; Botelho, F.T.; Gularte, M.A.; Helbig, E. Effect of different types of processing on the total phenolic compound content, antioxidant capacity, and saponin content of Chenopodium quinoa Willd grains. Food Chem. 2016, 209, 139–143. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Nie, S.; Huang, D.; Li, C.; Xie, M.; Wan, Y. Antimicrobial activity of saponin-rich fraction from Camellia oleifera cake and its effect on cell viability of mouse macrophage RAW 264.7. J. Sci. Food Agric. 2012, 92, 2443–2449. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Wu, Z.H.; Shi, W.Q.; Wu, J.P.; Fan, G.R. Optimization of purification process of total saponins from akebiae fructus by macroporous resin and research on its antioxidant activity. China Pharm. 2023, 32, 57–62. [Google Scholar]
- Dan, L.W.; Gao, T.H.; Zhang, D.D.; Huang, W.L.; Jiang, Y.; Wang, H.F.; Song, X.M.; Wang, W.; Li, Y.Z. Study on extraction and purification technology of total saponins from Rhizoma Bambusa and their anti-inflammatory activity. J. Shaanxi Univ. Chin. Med. 2024, 47, 34–42. [Google Scholar]
- Gao, L.; Yuan, J.; Cheng, Y.; Chen, M.; Zhang, G.; Wu, J. Selenomethionine-dominated selenium-enriched peanut protein ameliorates alcohol-induced liver disease in mice by suppressing oxidative stress. Foods 2021, 10, 2979. [Google Scholar] [CrossRef]
- Lu, Y.; Shao, M.; Xiang, H.; Wang, J.; Ji, G.; Wu, T. Qinggan huoxue recipe alleviates alcoholic liver injury by suppressing endoplasmic reticulum stress through LXR-LPCAT3. Front. Pharmacol. 2022, 13, 824185. [Google Scholar] [CrossRef]
- Wu, M.; Yin, F.; Wei, X.; Ren, R.; Chen, C.; Liu, M.; Wang, R.; Yang, L.; Xie, R.; Jiang, S. Hepatocyte-specific deletion of cellular repressor of E1A-stimulated genes 1 exacerbates alcohol-induced liver injury by activating stress kinases. Int. J. Biol. Sci. 2022, 18, 1612. [Google Scholar] [CrossRef]
- Jiang, Z.; Gao, J.; Chai, Y.; Li, W.; Luo, Y.; Chen, Y. Astragaloside alleviates alcoholic fatty liver disease by suppressing oxidative stress. Kaohsiung J. Med. Sci. 2021, 37, 718–729. [Google Scholar] [CrossRef]
- Wu, M.; Zhang, G.; Liu, T.; Shen, J.; Cheng, J.; Shen, J.; Yang, T.; Huang, C.; Zhang, L. Hif-2α regulates lipid metabolism in alcoholic fatty liver disease through mitophagy. Cell Biosci. 2022, 12, 198. [Google Scholar] [CrossRef]
- Dai, C.; Li, B.; Zhou, Y.; Li, D.; Zhang, S.; Li, H.; Xiao, X.; Tang, S. Curcumin attenuates quinocetone induced apoptosis and inflammation via the opposite modulation of Nrf2/HO-1 and NF-kB pathway in human hepatocyte L02 cells. Food Chem. Toxicol. 2016, 95, 52–63. [Google Scholar] [CrossRef]
- Xia, T.; Zhang, J.; Yao, J.; Zhang, B.; Duan, W.; Xia, M.; Song, J.; Zheng, Y.; Wang, M. Shanxi aged vinegar prevents alcoholic liver injury by inhibiting CYP2E1 and NADPH oxidase activities. J. Funct. Foods 2018, 47, 575–584. [Google Scholar] [CrossRef]
- Zhang, X.; Dong, Z.; Fan, H.; Yang, Q.; Yu, G.; Pan, E.; He, N.; Li, X.; Zhao, P.; Fu, M. Scutellarin prevents acute alcohol-induced liver injury via inhibiting oxidative stress by regulating the Nrf2/HO-1 pathway and inhibiting inflammation by regulating the AKT, p38 MAPK/NF-κB pathways. J. Zhejiang Univ. Sci. B 2023, 24, 617–631. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Chen, X.; Fu, Z.; Yin, J.; Wang, Y.; Sun, W.; Ren, H.; Zhang, Y. Kinsenoside alleviates alcoholic liver injury by reducing oxidative stress, inhibiting endoplasmic reticulum stress, and regulating AMPK-dependent autophagy. Front. Pharmacol. 2022, 12, 747325. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Wang, S.; Wu, L.; Yang, K.; Yang, F.; Yang, J.; Hu, S.; Yao, Y.; Xia, X.; Liu, Y. Puerarin inhibits inflammation and lipid accumulation in alcoholic liver disease through regulating MMP8. Chin. J. Nat. Med. 2023, 21, 670–681. [Google Scholar] [CrossRef]
- Che, Z.; Song, Y.; Xu, C.; Li, W.; Dong, Z.; Wang, C.; Ren, Y.; So, K.-F.; Tipoe, G.L.; Wang, F. Melatonin alleviates alcoholic liver disease via EGFR–BRG1–TERT axis regulation. Acta Pharm. Sin. B 2023, 13, 100–112. [Google Scholar] [CrossRef]
- Guo, J.; Chen, Y.; Yuan, F.; Peng, L.; Qiu, C. Tangeretin protects mice from alcohol-induced fatty liver by activating mitophagy through the AMPK–ULK1 pathway. J. Agric. Food Chem. 2022, 70, 11236–11244. [Google Scholar] [CrossRef]
- Ke, X.; Zhang, R.; Li, P.; Zuo, L.; Wang, M.; Yang, J.; Wang, J. Hydrochloride Berberine ameliorates alcohol-induced liver injury by regulating inflammation and lipid metabolism. Biochem. Bioph. Res. Co. 2022, 610, 49–55. [Google Scholar] [CrossRef]
- Choi, E.J.; Kim, H.; Hong, K.-B.; Suh, H.J.; Ahn, Y. Hangover-relieving effect of ginseng berry kombucha fermented by Saccharomyces cerevisiae and Gluconobacter oxydans in ethanol-treated cells and mice model. Antioxidants 2023, 12, 774. [Google Scholar] [CrossRef]
- Xie, L.; Luo, M.; Li, J.; Huang, W.; Tian, G.; Chen, X.; Ai, Y.; Zhang, Y.; He, H.; He, J. Gastroprotective mechanism of modified lvdou gancao decoction on ethanol-induced gastric lesions in mice: Involvement of Nrf-2/HO-1/NF-κB signaling pathway. Front. Pharmacol. 2022, 13, 953885. [Google Scholar] [CrossRef]
- Guo, M.; Gu, L.; Hui, H.; Li, X.; Jin, L. Extracts of Dracocephalum tanguticum maxim ameliorate acute alcoholic liver disease via regulating transcription factors in mice. Front. Pharmacol. 2022, 13, 830532. [Google Scholar] [CrossRef]
- Xie, L.; Huang, W.; Li, J.; Chen, G.; Xiao, Q.; Zhang, Y.; He, H.; Wang, Q.; He, J. The protective effects and mechanisms of modified Lvdou Gancao decoction on acute alcohol intoxication in mice. J. Ethnopharmacol. 2022, 282, 114593. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Gao, Q.; Wang, T.; Zhao, G.; Qian, F.; Huang, J.; Wang, H.; Zhang, X.; Wang, Y. Green tea infusion protects against alcoholic liver injury by attenuating inflammation and regulating the PI3K/Akt/eNOS pathway in C57BL/6 mice. Food Funct. 2017, 8, 3165–3177. [Google Scholar] [CrossRef] [PubMed]
- Qiao, J.; Li, H.; Liu, F.; Li, Y.; Tian, S.; Cao, L.; Hu, K.; Wu, X.; Miao, M. Effects of Portulaca Oleracea extract on acute alcoholic liver injury of rats. Molecules 2019, 24, 2887. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Zhou, J.; Hu, Z.; Fu, C.; Li, X.; Liu, J.; Zhao, W.; Wu, T.; Li, C.; Kang, J. Lamivudine remedies alcoholism by activating acetaldehyde dehydrogenase. Biochem. Pharmacol. 2022, 203, 115199. [Google Scholar] [CrossRef]
- Lai, X.; Wang, X.; Wen, S.; Sun, L.; Chen, R.; Zhang, Z.; Li, Q.; Cao, J.; Lai, Z.; Li, Z. Six types of tea reduce acute alcoholism in mice by enhancing ethanol metabolism, suppressing oxidative stress and inflammation. Front. Nutr. 2022, 9, 848918. [Google Scholar] [CrossRef]
- Chang, X.Y.; Dong, M.R.; Mi, X.; Hu, M.G.; Lu, J.; Chen, X. The protective effect of Trichilia catigua A. Juss. on DEHP-induced reproductive system damage in male mice. Front. Pharmacol. 2022, 13, 832789. [Google Scholar] [CrossRef]
- Yang, L.; Peng, L.Q.; Tai, H.C.; Zhang, X.F. Research progress of Dai-Bai-jie. Chin. J. Ethn. Med. 2021, 27, 55–57. [Google Scholar]
- Li, H.T.; Kang, L.P.; Guo, B.L.; Zhang, Z.L.; Hong, G.Y.; Pang, X.; Peng, Z.Z.; Ma, B.P.; Zhang, L.X. Research on the origin of commonly used Dai medicine “Dai Bai Jie”. China J. Chin. Mater. Med. 2014, 39, 1525–1529. [Google Scholar]
- Guan, Z.B.; Zhang, L.X.; Song, M.F.; Li, H.T.; Zhang, Z.L. Study on the genetic relationship of several medicinal plants from Yunnan Province by ISSR markers. China J. Chin. Mater. Med. 2012, 37, 1550–1552. [Google Scholar]
- Pang, X.; Kang, L.; Fang, X.; Zhao, Y.; Yu, H.; Han, L.; Li, H.; Zhang, L.; Guo, B.; Yu, L. Polyoxypregnane glycosides from the roots of Marsdenia tenacissima and their anti-HIV activities. Planta Med. 2017, 83, 126–134. [Google Scholar] [CrossRef]
- Pang, X.; Kang, L.; Yu, H.; Zhao, Y.; Han, L.; Zhang, J.; Xiong, C.; Zhang, L.; Yu, L.; Ma, B. New polyoxypregnane glycosides from the roots of Marsdenia tenacissima. Steroids 2015, 93, 68–76. [Google Scholar] [CrossRef] [PubMed]
- Pang, X.; Kang, L.; Fang, X.; Yu, H.; Han, L.; Zhao, Y.; Zhang, L.; Yu, L.; Ma, B. C21 steroid derivatives from the Dai herbal medicine Dai-Bai-Jie, the dried roots of Marsdenia tenacissima, and their screening for anti-HIV activity. J. Nat. Med. 2018, 72, 166–180. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Xie, M.-X.; Kang, J.; Zheng, D. Studies on the interaction of total saponins of panax notoginseng and human serum albumin by Fourier transform infrared spectroscopy. Spectrochim. Acta A 2003, 59, 2747–2758. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Wang, S.; Wan, F.; Zhou, Y.; Wang, Z.; Fan, G.; Wang, P.; Luo, H.; Liao, S.; He, L. Quantitative analysis of Camellia oleifera seed saponins and aqueous two-phase extraction and separation. Molecules 2023, 28, 2132. [Google Scholar] [CrossRef]
- Del Hierro, J.N.; Herrera, T.; García-Risco, M.R.; Fornari, T.; Reglero, G.; Martin, D. Ultrasound-assisted extraction and bioaccessibility of saponins from edible seeds: Quinoa, lentil, fenugreek, soybean and lupin. Food Res. Int. 2018, 109, 440–447. [Google Scholar] [CrossRef]
- Samal, K.; Das, C.; Mohanty, K. Application of saponin biosurfactant and its recovery in the MEUF process for removal of methyl violet from wastewater. J. Environ. Manag. 2017, 203, 8–16. [Google Scholar] [CrossRef]
- Fiallos-Jurado, J.; Pollier, J.; Moses, T.; Arendt, P.; Barriga-Medina, N.; Morillo, E.; Arahana, V.; de Lourdes Torres, M.; Goossens, A.; Leon-Reyes, A. Saponin determination, expression analysis and functional characterization of saponin biosynthetic genes in Chenopodium quinoa leaves. Plant Sci. 2016, 250, 188–197. [Google Scholar] [CrossRef]
- Liu, Q.D. Determination of total saponins in radix ilicis asprellae by colorimetric analysis. Chin. J. Ethnomed. Ethnopharm. 2020, 29, 47–49. [Google Scholar]
- Xu, F.F.; Feng, H.L.; Li, L.; Chu, S.J.; Yu, J.; Lou, Z.H.; Cao, Z.Q. Determination of total saponin in black panax notoginseng. Ginseng Res. 2021, 33, 15–18. [Google Scholar]
- Xu, F.; Liu, X.; Liu, Q.; Yang, Y.; Zhao, H.; Cao, W. Determination of gypenosides in Gynostemma pentaphyllum. Food Ind. 2023, 44, 138–141. [Google Scholar]
- Sun, S.; Xie, F.; Xu, X.; Cai, Q.; Zhang, Q.; Cui, Z.; Zheng, Y.; Zhou, J. Advanced oxidation protein products induce S-phase arrest of hepatocytes via the ROS-dependent, β-catenin-CDK2-mediated pathway. Redox Biol. 2018, 14, 338–353. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Liu, J.; Lu, X.; Yan, X.; Huang, C.; Meng, X.; Li, J. miR-203 inhibits alcohol-induced hepatic steatosis by targeting lipin1. Front. Pharmacol. 2018, 9, 275. [Google Scholar] [CrossRef] [PubMed]
- Hong, M.; Li, S.; Wang, N.; Tan, H.-Y.; Cheung, F.; Feng, Y. A biomedical investigation of the hepatoprotective effect of radix salviae miltiorrhizae and network pharmacology-based prediction of the active compounds and molecular targets. Int. J. Mol. Sci. 2017, 18, 620. [Google Scholar] [CrossRef]
- Zhuang, X.Y.; Deng, Z.B.; Mu, J.Y.; Zhang, L.F.; Yan, J.; Miller, D.; Feng, W.K.; Mcclain, C.J.; Zhang, H.G. Ginger-derived nanoparticles protect against alcohol-induced liver damage. J. Extracell. Vesicles 2015, 4, 28713. [Google Scholar] [CrossRef]
- Wen, Y.M.; Zhou, Y.C.; Tian, L.; He, Y.J. Ethanol extracts of Isochrysis zhanjiangensis alleviate acute alcoholic liver injury and modulate intestinal bacteria dysbiosis in mice. J. Sci. Food Agric. 2024, 104, 4354–4362. [Google Scholar] [CrossRef]
- Song, H.R.; Song, C.; Yan, C.H.; Yang, J.F.; Song, S. Sea cucumber polysaccharide from Stichopus japonicu and its photocatalytic degradation product alleviate acute alcoholic liver injury in mice. Foods 2024, 13, 963. [Google Scholar] [CrossRef]
- Zou, J.; Yang, R.J.; Feng, R.B.; Liu, J.Y.; Wan, J.B. Ginsenoside Rk2, a dehydroprotopanaxadiol saponin, alleviates alcoholic liver disease via regulating NLRP3 and NLRP6 inflammasome signaling pathways in mice. J. Pharm. Anal. 2023, 13, 999–1012. [Google Scholar] [CrossRef]
- Li, W.; Liu, Y.; Wang, Z.; Han, Y.; Tian, Y.H.; Zhang, G.S.; Sun, Y.S.; Wang, Y.P. Platycodin D isolated from the aerial parts of Platycodon grandiflorum protects alcohol-induced liver injury in mice. Food Funct. 2015, 6, 1418–1427. [Google Scholar] [CrossRef]
- Zeng, M.N.; Feng, A.; Wang, L.; Li, K.; Zhou, J.H. Aralia saponin A isolated from Achyranthes bidentata Bl. ameliorates LPS/D-GalN induced acute liver injury via SPHK1/S1P/S1PR1 pathway in vivo and in vitro. Int. Immunopharmacol. 2023, 124, 110912. [Google Scholar] [CrossRef]
- Jiang, N.; Xin, W.Y.; Wang, T.; Zhang, L.M.; Fan, H.Y.; Du, Y.; Li, C.; Fu, F.H. Protective effect of aescin from the seeds of Aesculus hippocastanum on liver injury induced by endotoxin in mice. Phytomedicine 2011, 18, 1276–1284. [Google Scholar] [CrossRef]
- Jiang, X.X.; Yan, C.L.; Zhang, H.L.; Chen, L.; Jiang, R.; Zheng, K.X.; Jin, W.Z.; Ma, H.J.; Liu, X.M.; Dong, M. Oral probiotic expressing human ethanol dehydrogenase attenuates damage caused by Acute Alcohol Consumption in mice. Microbiol. Spectr. 2023, 11, e0429422. [Google Scholar] [CrossRef] [PubMed]
- Hyun, J.; Han, J.; Lee, C.B.; Yoon, M.; Jung, Y.M. Pathophysiological aspects of alcohol metabolism in the liver. Int. J. Mol. Sci. 2021, 22, 5717. [Google Scholar] [CrossRef] [PubMed]
- Bramness, J.G.; Skulberg, K.R.; Skulberg, A.; Moe, J.S.; Mørland, J. The Self-Rated Effects of Alcohol Are Related to Presystemic Metabolism of Alcohol. Alcohol Alcohol. 2023, 58, 203–208. [Google Scholar] [CrossRef]
- Wolszczak-Biedrzycka, B.; Zasimowicz-Majewska, E.; Bieńkowska, A.; Biedrzycki, G.; Dorf, J.; Jelski, W. Activity of total alcohol dehydrogenase, alcohol dehydrogenase isoenzymes and aldehyde dehydrogenase in the serum of patients with alcoholic fatty liver disease. Medicina 2021, 58, 25. [Google Scholar] [CrossRef]
- Lee, S.L.; Lee, Y.-P.; Wu, M.L.; Chi, Y.C.; Liu, C.M.; Lai, C.L.; Yin, S.J. Inhibition of human alcohol and aldehyde dehydrogenases by aspirin and salicylate: Assessment of the effects on first-pass metabolism of ethanol. Biochem. Pharmacol. 2015, 95, 71–79. [Google Scholar] [CrossRef]
- Chien, T.-H.; Lin, C.-L.; Chen, L.-W.; Chien, C.-H.; Hu, C.-C. Patients with Non-Alcoholic Fatty Liver Disease and Alcohol Dehydrogenase 1B/Aldehyde Dehydrogenase 2 Mutant Gene Have Higher Values of Serum Alanine Transaminase. J. Pers. Med. 2023, 13, 758. [Google Scholar] [CrossRef]
- Zhang, J.; Guo, Y.Y.; Zhao, X.K.; Pang, J.J.; Pan, C.; Wang, J.L.; Wei, S.J.; Yu, X.; Zhang, C.; Chen, Y.G. The role of aldehyde dehydrogenase 2 in cardiovascular disease. Nat. Rev. Cardiol. 2023, 20, 495–509. [Google Scholar] [CrossRef]
- Zhang, H.; Xia, Y.H.; Wang, F.; Luo, M.; Yang, K.; Liang, S.B.; An, S.N.; Wu, S.C.; Yang, C.; Chen, D. Aldehyde dehydrogenase 2 mediates alcohol-induced colorectal cancer immune escape through stabilizing PD-L1 expression. Adv. Sci. 2021, 8, 2003404. [Google Scholar] [CrossRef]
- Li, Y.Z.; Wang, H.M.; Leng, X.P.; Gao, J.M.; Li, C.; Huang, D.F. Polysaccharides from Eucommia ulmoides Oliv. Leaves Alleviate Acute Alcoholic Liver Injury by Modulating the Microbiota–Gut–Liver Axis in Mice. Foods 2024, 13, 1089. [Google Scholar] [CrossRef]
- Wang, Y.P.; Fan, Z.F.; Yang, M.L.; Wang, Y.D.; Cao, J.X.; Khan, A.; Liu, Y.P.; Cheng, G.G. Protective effects of E Se tea extracts against alcoholic fatty liver disease induced by high fat/alcohol diet: In vivo biological evaluation and molecular docking study. Phytomedicine 2022, 101, 154113. [Google Scholar] [CrossRef]
- Li, Y.H.; Sun, Y.; Zang, Y.; Su, Y.T.; Zhou, H.P.; Wang, J.; Xie, M.; Liu, L.; Mei, Q.B. GanMeijian ameliorates lipid accumulation and oxidative damage in alcoholic fatty liver disease in Wistar rats. Life Sci. 2020, 255, 117721. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Jia, L.; Lin, M.H.; Shi, Y.; Yin, J.M.; Liu, Y.; Chen, D.X.; Meng, Q.H. ASPP 2 attenuates triglycerides to protect against hepatocyte injury by reducing autophagy in a cell and mouse model of non-alcoholic fatty liver disease. J. Cell. Mol. Med. 2015, 19, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.R.; Hsu, Y.W.; Pan, T.M.; Lee, C.L. Monascin and ankaflavin of Monascus purpureus prevent alcoholic liver disease through regulating AMPK-mediated lipid metabolism and enhancing both anti-inflammatory and anti-oxidative systems. Molecules 2021, 26, 6301. [Google Scholar] [CrossRef]
- Martín-Fernández, M.; Arroyo, V.; Carnicero, C.; Sigüenza, R.; Busta, R.; Mora, N.; Antolín, B.; Tamayo, E.; Aspichueta, P.; Carnicero-Frutos, I. Role of oxidative stress and lipid peroxidation in the pathophysiology of NAFLD. Antioxidants 2022, 11, 2217. [Google Scholar] [CrossRef]
- Osna, N.A.; Donohue, T.M., Jr.; Kharbanda, K.K. Alcoholic liver disease: Pathogenesis and current management. Alcohol Res. Curr. Rev. 2017, 38, 147–161. [Google Scholar]














| Gene | Species | Forward (5′–3′) | Reverse (3′–5′) |
|---|---|---|---|
| Adh1b | Mouse | CTGTGGGTTCTAACTGGCTATG | GGCAAACTTGTCCTTGTTGATGT |
| Aldh2 | Mouse | TTCGGCAGGAGAATGTGTATGA | CGATTTGATGTAGCCGAGGATCT |
| Nf-κb p65 | Mouse | CTTCTGGGCCTTATGTGGAGATC | GGTCCTGTGTAGCCATTGATCTT |
| Gapdh | Mouse | ACTCTTCCACCTTCGATGCC | TGGGATAGGGCCTCTCTTGC |
| Concentration (mg/mL) | Absorbance (ΔA) |
|---|---|
| 0.1 | 0.2433 |
| 0.2 | 0.39452 |
| 0.3 | 0.54096 |
| 0.4 | 0.70112 |
| 0.5 | 0.84528 |
| 0.6 | 1.03262 |
| Compounds | tR | Formula | Ionization Model | Exact Mass (Da) | Structures | Percentage of Relative Abundance (%) |
|---|---|---|---|---|---|---|
| 2,3,23-Trihydroxyolean-12-en-28-oic acid | 7.28 | C30H48O5 | [M-H]− | 488.3502 | ![]() | 49.15 |
| 2-Aldehydo-A(1)-norlup-20(29)-en-27,28-dioic acid (Zizyberanal acid) | 8.58 | C30H44O5 | [M-H]− | 484.3189 | ![]() | 42.15 |
| 3β,19-Dihydroxyurs-12-en-28-oic acid | 8.93 | C30H48O4 | [M-H]− | 472.3553 | ![]() | 100 |
| 2α,3β-Dihydroxylup-20(29)-en-28-oic acid | 9.30 | C30H48O4 | [M-H]− | 472.3553 | ![]() | 90.72 |
| 3β,25-Epoxy-3-hydroxyolean-18-en-28-oic acid | 10.60 | C30H46O4 | [M-H]− | 470.3396 | ![]() | 2.04 |
| Oleanolic acid | 11.00 | C30H48O3 | [M-H]− | 456.3603 | ![]() | 7.12 |
| 3-Oxolup-20(29)-en-28-oic acid | 11.15 | C30H46O3 | [M-H]− | 454.3447 | ![]() | 1.12 |
| (3I(2),25R)-3-Hydroxy-24-methylene-9,19-cyclolanostan-26-oic acid | 12.26 | C31H50O3 | [M-H]− | 470.376 | ![]() | 0.40 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, N.; Xue, H.; Li, Y.; Liu, J.; Lou, Y.; Li, S.; Wang, Y.; Lu, J.; Chen, X. Potential Mechanisms and Effects of Dai Bai Jie Ethanol Extract in Preventing Acute Alcoholic Liver Injury. Curr. Issues Mol. Biol. 2025, 47, 3. https://doi.org/10.3390/cimb47010003
Xia N, Xue H, Li Y, Liu J, Lou Y, Li S, Wang Y, Lu J, Chen X. Potential Mechanisms and Effects of Dai Bai Jie Ethanol Extract in Preventing Acute Alcoholic Liver Injury. Current Issues in Molecular Biology. 2025; 47(1):3. https://doi.org/10.3390/cimb47010003
Chicago/Turabian StyleXia, Niantong, Hongwei Xue, Yihang Li, Jia Liu, Yang Lou, Shuyang Li, Yutian Wang, Juan Lu, and Xi Chen. 2025. "Potential Mechanisms and Effects of Dai Bai Jie Ethanol Extract in Preventing Acute Alcoholic Liver Injury" Current Issues in Molecular Biology 47, no. 1: 3. https://doi.org/10.3390/cimb47010003
APA StyleXia, N., Xue, H., Li, Y., Liu, J., Lou, Y., Li, S., Wang, Y., Lu, J., & Chen, X. (2025). Potential Mechanisms and Effects of Dai Bai Jie Ethanol Extract in Preventing Acute Alcoholic Liver Injury. Current Issues in Molecular Biology, 47(1), 3. https://doi.org/10.3390/cimb47010003









