Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Growth Conditions, and Reagents
2.2. Clustering Based on Multilocus Sequence Analysis
2.3. Copper Tolerance Assays
2.4. Analysis of Copper-Resistance-Related Genes
3. Results
3.1. Clustering Based on Multilocus Sequence Analysis
3.2. Copper Resistance
3.3. Copper-Resistance-Related Genes
3.4. Two Gene Clusters Were Highly Conserved
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Faostat. FAOSTAT Statistical Database. 2021. Available online: http://www.fao.org/faostat/en/#data/QCL (accessed on 6 July 2021).
- Commonwealth Agricultural Bureaux International(CABI) Digital Library. Xanthomonas axonopodis pv. manihotis (Cassava Bacterial Blight). Available online: https://www.cabidigitallibrary.org/doi/10.1079/cabicompendium.56952 (accessed on 12 May 2022).
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow MA, X.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [Scilit]
- Zhu, S.-S.; Pan, Y.-Y.; Li, K.; Fan, R.-C.; Xiang, L.; Huang, S.-Y.; Jia, S.-H.; Niu, X.-L.; Li, C.-X.; Chen, Y.-H. Complete genome sequence of Xanthomonas phaseoli pv. manihotis strain CHN01, the causal agent of cassava bacterial blight. Plant Dis. 2022, 106, 1039–1041. [Google Scholar] [PubMed]
- Wen, Y.-T. Pathogen identification of cassava bacterial blight. Chin. J. Trop. Crops 1982, 2, 91–97. [Google Scholar]
- Li, C.-P.; Shi, T.; Liu, X.-B.; Cai, J.-M.; Pei, Y.-L.; Huang, G.-X. General survey on cassava diseases and safety assessment of cassava bacterial blight. Chin. J. Trop. Crops 2011, 1, 116–121. [Google Scholar]
- Da Gama, M.A.S.; Mariano, R.D.L.R.; da Silva, J.W.J.; de Farias, A.R.G.; Barbosa, M.A.G.; da Silva Velloso Ferreira, M.A.; Costa, C.R.L., Jr.; Santos, L.A.; de Souza, E.B. Taxonomic repositioning of Xanthomonas campestris pv. viticola (Nayudu 1972) Dye 1978 as Xanthomonas citri pv. viticola (Nayudu 1972) Dye 1978 Comb. nov. and emendation of the description of Xanthomonas citri pv. anacardii to include pigmented isolates pathogenic to cashew plant. Phytopathology 2018, 108, 1143–1153. [Google Scholar] [PubMed]
- Stackebrandt, E.; Frederiksen, W.; Garrity, G.M.; Grimont, P.A.D.; Kampfer, P.; Maiden, M.C.J.; Nesme, X.; Rossello-Mora, R.; Swings, J.; Truper, H.G.; et al. Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology. Int. J. Syst. Evol. Microbiol. 2002, 52, 1043–1047. [Google Scholar]
- Louws, F.J.; Rademaker, J.L.W.; de Bruijn, F.J. The three DS of PCR-based genomic analysis of phytobacteria: Diversity, detection, and disease diagnosis. Annu. Rev. Phytopathol. 1999, 37, 81–125. [Google Scholar] [CrossRef] [Scilit]
- Ntambo, M.S.; Meng, J.-Y.; Rott, C.; Royer, M.; Lin, L.-H.; Zhang, H.-L.; Gao, S.-J. Identification and characterization of Xanthomonas albilineans causing sugarcane leaf scald in China using multilocus sequence analysis. Plant Pathol. 2019, 68, 269–277. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Kong, C.-C.; Yang, L.-M.; Zhuang, M.; Zhang, Y.-Y.; Wang, Y.; Ji, J.-L.; Fang, Z.-Y.; Lv, H.-H. Genetic diversity and population structure of the Xanthomonas campestris pv. campestris strains affecting cabbages in China revealed by MLST and Rep-PCR based genotyping. Plant Pathol. J. 2021, 5, 476–488. [Google Scholar] [CrossRef] [Scilit]
- Restrepo, S.; Vélez, C.M.; Erdier, V.V. Measuring the genetic diversity of Xanthomonas axonopodis pv. manihotis within different fields in Colombia. Phytopathology 2000, 7, 683–690. [Google Scholar] [CrossRef] [Scilit]
- Bart, R.; Cohn, M.; Kassen, A.; McCallum, E.J.; Shybut, M.; Petriello, A.; Krasileva, K.; Dahlbeck, D.; Medina, C.; Alicai, T.; et al. High-throughput genomic sequencing of cassava bacterial blight strains identifies conserved effectors to target for durable resistance. Proc. Natl. Acad. Sci. USA 2012, 109, E1972–E1979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verdier, V.; Restrepo, S.; Mosquera, G.; Jorge, V.; López Carrascal, C.E. Recent progress in the characterization of molecular determinants in the Xanthomonas axonopodis pv. manihotis-cassava interaction. Plant Mol. Biol. 2004, 56, 573–584. [Google Scholar] [CrossRef] [Scilit]
- Restrepo, S.; Vélez, C.M.; Duque, M.C. Genetic structure and population dynamics of Xanthomonas axonopodis pv. manihotis in Colombia from 1995 to 1999. Appl. Environ. Microbiol. 2004, 1, 255–261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogunjobi, A.A.; Fagade, O.E.; Dixon, A.G.O. Comparative analysis of genetic variation among Xanthomonas axonopodis pv manihotis isolated from the western states of Nigeria using RAPD and AFLP. Indian J. Microbiol. 2010, 6, 132–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, X.; Li, C.-P.; Shi, T.; Huang, G.-X. Bactericide screening against pathogen of cassava bacterial blight. Chin. J. Trop. Agric. 2013, 2, 53–56. [Google Scholar]
- Cooksey, D.A.; Azad, H.R.; Cha, J.-S.; Lim, C.-K. Copper resistance gene homologs in pathogenic and saprophytic bacterial species from tomato. Appl. Environ. Microbiol. 1990, 56, 431–435. [Google Scholar] [CrossRef] [Scilit]
- Franklin, B.; Jason, C.H.; Jeffrey, B.J.; James, H.G. Evidence for acquisition of copper resistance genes from different sources in citrus-associated Xanthomonads. Phytopathology 2013, 5, 409–418. [Google Scholar]
- Teixeira, E.C.; de Oliveira, J.C.F.; Novo, M.T.M.; Bertolini, M.C. The copper resistance operon copAB from Xanthomonas axonopodis pathovar citri: Gene inactivation results in copper sensitivity. Microbiology 2008, 154, 402–412. [Google Scholar] [CrossRef] [Scilit]
- Voloudakis, A.E.; Reignier, T.M.; Cooksey, D.A. Regulation of resistance to copper in Xanthomonas axonopodis pv. vesicatoria. Appl. Environ. Microbiol. 2005, 2, 782–789. [Google Scholar] [CrossRef] [Scilit]
- Behlau, F.; Canteros, B.I.; Minsavage, G.V.; Jones, J.B.; Graham, J.H. Molecular characterization of copper resistance genes from Xanthomonas citri subsp. citri and Xanthomonas alfalfae subsp. citrumelonis. Appl. Environ. Microbiol. 2011, 12, 4089–4096. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.-A.; Hendson, M.; Panopoulos, N.-J.; Schroth, M.-N. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: Homology with small blue copper proteins and multicopper oxidase. J. Bacteriol. 1994, 1, 173–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryan, R.P.; Ryan, D.J.; Sun, Y.-C.; Li, F.-M.; Wang, Y.-P.; David, N.D. An acquired efflux system is responsible for copper resistance in Xanthomonas strain IG-8 isolated from China. FEMS Microbiol. Lett. 2007, 268, 40–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, X.; Li, C.-P.; Shi, T.; Cai, J.-M.; Huang, G.-X. Pathogen identification of cassava bacterial blight from several main cultivation area in China. Guangdong Agric. Sci. 2013, 21, 84–87. [Google Scholar]
- Fargier, E.; Fischer-Le Saux, M.; Manceau, C. A multilocus sequence analysis of Xanthomonas campestris reveals a complex structure within crucifer-attacking pathovars of this species. Syst. Appl. Microbiol. 2011, 34, 156–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bella, P.; Moretti, C.; Licciardello, G.; Strano, C.P.; Pulvirenti, A.; Alaimo, S.; Zaccardelli, M.; Branca, F.; Buonaurio, R.; Vicente, J.G.; et al. Multilocus sequence typing analysis of Italian Xanthomonas campestris pv. campestris strains suggests the evolution of local endemic populations of the pathogen and does not correlate with race distribution. Plant Pathol. 2019, 68, 278–287. [Google Scholar] [CrossRef] [Scilit]
- Jalan, N.; Aritua, V.; Kumar, D.; Yu, F.; Jones, J.B.; Graham, J.H.; Setubal, J.C.; Wang, N. Comparative genomic analysis of Xanthomonas axonopodis pv. citrumelo F1, which causes citrus bacterial spot disease, and related strains provides insights into virulence and host specificity. J. Bacteriol. 2011, 12, 6342–6357. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Fischer-Le, S.M.; Bonneau, S.; Essakhi, S.; Manceau, C.; Jacques, M.A. Aggressive emerging pathovars of Xanthomonas arboricola represent widespread epidemic clones distinct from poorly pathogenic strains, as revealed by multilocus sequence typing. Appl. Environ. Microbiol. 2015, 81, 46514668. [Google Scholar] [CrossRef] [Scilit]
- Hamza, A.A.; Robene-Soustrade, I.; Jouen, E.; Lefeuvre, P.; Chiroleu, F.; Fisher-Le, S.M.; Gagnevin, L.; Pruvost, O. Multilocus sequence analysis and amplified fragment length polymorphism-based characterization of Xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species. Syst. Appl. Microbiol. 2012, 35, 183–190. [Google Scholar] [CrossRef] [Scilit]
- Pao, G.M.; Saier, M.H. Response regulators of bacterial signal transduction systems: Selective domain shuffling during evolution. J. Mol. Evol. 1995, 2, 136–154. [Google Scholar] [CrossRef] [Scilit]
- Fu, B.; Zhu, J.; Lee, C.; Wang, L. Multilocus sequence analysis and copper ion resistance detection of 60 Xanthomonas arboricola pv. juglandis isolates from China. Plant Dis. 2021, 11, 3715–3719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garde, S.; Bender, C.L. DNA probes for detection of copper resistance genes in Xanthomonas campestris pv. vesicatoriat. Appl. Environ. Microbio. 1991, 8, 2435–2439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roach, R.; Mann, R.; Gambley, G.G.; Shivas, R.G.; Rodoni, B. Identification of Xanthomonas species associated with bacterial leaf spot of tomato, capsicum and chilli crops in eastern Australia. Eur. J. Plant Pathol. 2018, 150, 595–608. [Google Scholar] [CrossRef] [Scilit]
- Roach, R.; Mann, R.; Gambley, G.G.; Shivas, R.G.; Chapman, T.; Rodoni, B. Pathogenicity and copper tolerance in Australian Xanthomonas species associated with bacterial leaf spot. Crop Prot. 2020, 127, 104923. [Google Scholar] [CrossRef] [Scilit]
- Pervaiz, A.A.; Salah, E.K.; Brian, W.; Liang, Z. Occurrence of copper-resistant strains and a shift in Xanthomonas spp. causing tomato bacterial spot in Ontario. Can. J. Microbiol. 2015, 61, 753–761. [Google Scholar]
- Hsiao, Y.M.; Liu, Y.F.; Lee, P.Y.; Hsu, P.C.; Tseng, S.Y.; Pan, Y.C. Functional characterization of copA gene encoding multicopper oxidase in Xanthomonas campestris pv. campestris. J. Agric. Food Chem. 2011, 595, 9290–9302. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.-N. Cloning and Functional Identification of the Copper Resistance Gene copB in Xanthomonas gardneri. Ph.D. Thesis, Hunan Agricultural University, Hunan, China, 2012. [Google Scholar]
- Xu, C.-H.; Shi, T.; Wang, G.-F.; Li, C.-P.; Cai, J.-M.; Huang, G.-X. Evaluation of control effect of four new pesticides against cassava bacterial blight. Chin. J. Trop. Agric. 2019, 5, 53–57. [Google Scholar]


| NO. | Strain | Year of Samples Collected | Source | MIC a (mM) |
|---|---|---|---|---|
| 1 | CJX01 | 2013 | Dongxiang, Jiangxi, China | 1.4 |
| 2 | CJX05 | 2015 | Dongxiang, Jiangxi, China | 1.3 |
| 3 | CJX07 | 2020 | Fuzhou, Jiangxi, China | 1.4 |
| 4 | CHN02 | 2009 | Danzhou, Hainan, China | 1.3 |
| 5 | CHN03 | 2009 | Qionghai, Hainan, China | 1.6 |
| 6 | CHN09 | 2009 | Wenchang, Hainan, China | 1.5 |
| 7 | CHN11 | 2015 | Qiongzhong, Hainan, China | 1.4 |
| 8 | CHN16 | 2017 | Haikou, Hainan, China | 1.5 |
| 9 | CHN17 | 2017 | Danzhou, Hainan, China | 1.5 |
| 10 | CHN21 | 2017 | Chengmai, Hainan, China | 1.4 |
| 11 | CHN22 | 2017 | Wenchang, Hainan, China | 1.7 |
| 12 | CHN27 | 2018 | Danzhou, Hainan, China | 1.6 |
| 13 | CHN31 | 2019 | Chengmai, Hainan, China | 1.6 |
| 14 | CGD11 | 2008 | Suixi, Guangdong, China | 1.5 |
| 15 | CGD12 | 2009 | Yangjiang, Guangdong, China | 1.6 |
| 16 | CGD17 | 2009 | Kaiping, Guangdong, China | 1.5 |
| 17 | CGD19 | 2012 | Zhanjiang, Guangdong, China | 1.6 |
| 18 | CGD24 | 2013 | Yunfu, Guangdong, China | 1.4 |
| 19 | CGD25 | 2015 | Guangzhou, Guangdong, China | 1.6 |
| 20 | CGD31 | 2016 | Leizhou, Guangdong, China | 1.7 |
| 21 | CGD37 | 2016 | Suixi, Guangdong, China | 1.6 |
| 22 | CGD43 | 2017 | Yunfu, Guangdong, China | 1.5 |
| 23 | CGD50 | 2017 | Jiangmen, Guangdong, China | 1.6 |
| 24 | CGD55 | 2019 | Kaiping, Guangdong, China | 1.4 |
| 25 | CGD56 | 2020 | Leizhou, Guangdong, China | 1.5 |
| 26 | CGX01 | 2008 | Wuming, Guangxi, China | 1.3 |
| 27 | CGX04 | 2008 | Hepu, Guangxi, China | 1.7 |
| 28 | CGX07 | 2009 | Dongxing, Guangxi, China | 1.5 |
| 29 | CGX11 | 2010 | Beihai, Guangxi, China | 1.6 |
| 30 | CGX13 | 2015 | Pingnan, Guangxi, China | 1.6 |
| 31 | CGX15 | 2015 | Guiping, Guangxi, China | 1.5 |
| 32 | CGX18 | 2016 | Nanning, Guangxi, China | 1.4 |
| 33 | CGX23 | 2016 | Beihai, Guangxi, China | 1.4 |
| 34 | CGX29 | 2017 | Wuxuan, Guangxi, China | 1.4 |
| 35 | CGX33 | 2017 | Hepu, Guangxi, China | 1.5 |
| 36 | CGX36 | 2018 | Nanning, Guangxi, China | 1.5 |
| 37 | CGX44 | 2019 | Longan, Guangxi, China | 1.6 |
| 38 | CGX69 | 2020 | Pingnan, Guangxi, China | 1.5 |
| 39 | CGX71 | 2020 | Guiping, Guangxi, China | 1.4 |
| 40 | UGD1 | 2014 | Kiryandongo, Uganda | 1.4 |
| 41 | UGD2 | 2014 | Masindi, Uganda | 1.5 |
| 42 | UGD3 | 2015 | Hoima, Uganda | 1.6 |
| 43 | KHM01 | 2016 | Kratié, Cambodia | 1.4 |
| 44 | KHM03 | 2017 | Kratié, Cambodia | 1.6 |
| 45 | KHM04 | 2018 | Stung Treng, Cambodia | 1.4 |
| 46 | MLXY1825 | 2018 | Sabah, Malaysia | 1.4 |
| 47 | MLXY1827 | 2018 | Sabah, Malaysia | 1.3 |
| 48 | MK1825 | 2018 | Micronesia | 1.5 |
| 49 | GLBY06 | 2013 | Colombia | 1.7 |
| 50 | GLBY07 | 2013 | Colombia | 1.4 |
| Gene/Gene Cluster | Coding Protein | Primer Name | Sequence (5′–3′) b | Size of Amplicon | Reference |
|---|---|---|---|---|---|
| atpD | ATP synthase β-chain | P-X-atpDF | GGGCAAGATCGTTCAGAT | 868 nt | Fischer-Le Saux et al. (2015) [30]. |
| P-X-atpDR | GCTCTTGGTCGAGGTGAT | ||||
| ATPD-S1 | CTGGAAACCGGCATCAAGGTC | This study | |||
| ATPD-S2 | CGTGGTAGAAGTCGTTGCCCT | ||||
| dnaK | Molecular chaperone DnaK (HSP70) | P-X-dnaKF | GGTATTGACCTCGGCACCAC | 1034 nt | Fischer-Le et al. (2015) [30]. |
| P-X-dnaKR | ACCTTCGGCATACGGGTCT | ||||
| dnaK-S1 | ACTTCAACGACAGCCAG | This study | |||
| dnaK-S2 | TACTCGATGACGCGGTTGT | ||||
| gyrB | DNA topoisomerase β-subunit | X-gyrB1F | ACGAGTACAACCCGGACAA | 904 nt | Fischer-Le et al. (2015) [30]. |
| X-gyrB1R | CCCATCAAGGTGCTGAAGAT | ||||
| gyrB-S1 | TTGTTGATGCTGTTCACCA | This study | |||
| gyrB-S2 | CTCTTGTTGCCGCGCACGATCT | ||||
| efp | elongation factor P | X-efp1F | TCATCACCGAGACCGAAT | 445 nt | Hamza et al. (2012) [31]. |
| X-efp1R | TCCTGGTTGACGAACAG | ||||
| rpoD | RNA polymerase sigma factor | X-rpoD1F | TGGTCAACGGCATCAAGGA | 959 nt | This study |
| X-rpoD1R | CAACGCCTTGGCCTCTATCT | ||||
| rpoD-S1 | TCAAGGACCAGATCATCTCC | ||||
| rpoD-S2 | TCGATCATGTGCACCGGGATAC | ||||
| copLAB | metal-binding regulatory protein, multicopper oxidase and copper resistance protein | X-LABF X-LABR | ATGCTATGCTCGCTGCACCT | 3459 nt | This study |
| TCAAAACCACACGCGTACAC | |||||
| copLAB-S1 | AGGAGATGTCATGTCGTTCGAT | ||||
| copLAB-S2 | AGCCACGACAACTACGCACA | ||||
| copLAB-S3 | GCAACCCGCTGATCGACAT | ||||
| copLAB-S4 | TACGCAAGCACACCATCGACAT | ||||
| copLAB-S5 | AACGACACGACGGACGCACCGAAT | ||||
| xmeRSA | transcriptional regulatory protein, sensor histidine kinase efflux regulator and multidrug efflux RND transporter periplasmic adaptor subunit | X-RSAF X-RSAR | ATTCCTCAGTCGGCCTTGG | 3444 nt | This study |
| TCACGGCTCAAACCGATACC | |||||
| xmeRSA-S1 | CAGAGCGAGGTGCTGGCCAC | ||||
| xmeRSA-S2 | TGTAGTCGAGATTGATGCGC | ||||
| xmeRSA-S3 | TTACCGCGCTTCGCATCACCTC | ||||
| xmeRSA-S4 | CAAGCGCTGGAGCACAACGAA | ||||
| xmeRSA-S5 | ATGTGCTGATCGTCGAGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, T.; Li, C.; Wang, G.; Huang, G. Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava. Curr. Issues Mol. Biol. 2023, 45, 5389-5402. https://doi.org/10.3390/cimb45070342
Shi T, Li C, Wang G, Huang G. Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava. Current Issues in Molecular Biology. 2023; 45(7):5389-5402. https://doi.org/10.3390/cimb45070342
Chicago/Turabian StyleShi, Tao, Chaoping Li, Guofen Wang, and Guixiu Huang. 2023. "Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava" Current Issues in Molecular Biology 45, no. 7: 5389-5402. https://doi.org/10.3390/cimb45070342
APA StyleShi, T., Li, C., Wang, G., & Huang, G. (2023). Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava. Current Issues in Molecular Biology, 45(7), 5389-5402. https://doi.org/10.3390/cimb45070342

