Molecular Heterogeneity of the Brain Endothelium
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Brain Capillary Isolation
2.3. Purity Control of the Collected Brain Capillary
2.4. mRNA Expression Profiling of the BBB Components by Real-Time PCR
2.5. Protein Expression Profiling of the BBB Components by Western Blot Analysis
2.6. Statistical Analysis
3. Results
4. Discussion
5. Limitations of the Study
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liebner, S.; Dijkhuizen, R.M.; Reiss, Y.; Plate, K.H.; Agalliu, D.; Constantin, G. Functional morphology of the blood–brain barrier in health and disease. Acta Neuropathol. 2018, 135, 311–336. [Google Scholar] [CrossRef] [Scilit]
- Daneman, R.; Prat, A. The Blood–Brain Barrier. Cold Spring Harb. Perspect. Biol. 2015, 7, a020412. [Google Scholar] [CrossRef] [Scilit]
- Abbott, N.J.; Patabendige, A.A.K.; Dolman, D.E.M.; Yusof, S.R.; Begley, D.J. Structure and function of the blood–brain barrier. Neurobiol. Dis. 2010, 37, 13–25. [Google Scholar] [CrossRef] [Scilit]
- Zlokovic, B.V. The Blood-Brain Barrier in Health and Chronic Neurodegenerative Disorders. Neuron 2008, 57, 178–201. [Google Scholar] [CrossRef] [Scilit]
- Shinohara, M.; Tachibana, M.; Kanekiyo, T.; Bu, G. Role of LRP1 in the pathogenesis of Alzheimer’s disease: Evidence from clinical and preclinical studies. J. Lipid Res. 2017, 58, 1267–1281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Storck, S.E.; Hartz, A.M.; Bernard, J.; Wolf, A.; Kachlmeier, A.; Mahringer, A.; Weggen, S.; Pahnke, J.; Pietrzik, C.U. The concerted amyloid-beta clearance of LRP1 and ABCB1/P-gp across the blood-brain barrier is linked by PICALM. Brain Behav. Immun. 2018, 73, 21–33. [Google Scholar] [CrossRef] [Scilit]
- Hersh, D.S.; Wadajkar, A.S.; Roberts, N.B.; Perez, J.G.; Connolly, N.P.; Frenkel, V.; Winkles, J.A.; Woodworth, G.F.; Kim, A.J. Evolving Drug Delivery Strategies to Overcome the Blood Brain Barrier. Curr. Pharm. Des. 2016, 22, 1177–1193. [Google Scholar] [CrossRef] [Scilit]
- Villabona-Rueda, A.; Erice, C.; Pardo, C.A.; Stins, M.F. The Evolving Concept of the Blood Brain Barrier (BBB): From a Single Static Barrier to a Heterogeneous and Dynamic Relay Center. Front. Cell. Neurosci. 2019, 13, 405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aird, W.C. Phenotypic Heterogeneity of the Endothelium. Circ. Res. 2007, 100, 174–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Becker, L.M.; Chen, S.-H.; Rodor, J.; de Rooij, L.P.M.H.; Baker, A.H.; Carmeliet, P. Deciphering endothelial heterogeneity in health and disease at single-cell resolution: Progress and perspectives. Cardiovasc. Res. 2023, 119, 6–27. [Google Scholar] [CrossRef] [Scilit]
- Paik, D.T.; Tian, L.; Williams, I.M.; Rhee, S.; Zhang, H.; Liu, C.; Mishra, R.; Wu, S.; Red-Horse, K.; Wu, J.C. Single-Cell RNA Sequencing Unveils Unique Transcriptomic Signatures of Organ-Specific Endothelial Cells. Circulation 2020, 142, 1848–1862. [Google Scholar] [CrossRef] [Scilit]
- Jambusaria, A.; Hong, Z.; Zhang, L.; Srivastava, S.; Jana, A.; Toth, P.T.; Dai, Y.; Malik, A.B.; Rehman, J. Endothelial heterogeneity across distinct vascular beds during homeostasis and inflammation. ELife 2020, 9, e51413. [Google Scholar] [CrossRef] [Scilit]
- Hennigs, J.K.; Matuszcak, C.; Trepel, M.; Körbelin, J. Vascular Endothelial Cells: Heterogeneity and Targeting Approaches. Cells 2021, 10, 2712. [Google Scholar] [CrossRef] [Scilit]
- Bendayan, M. Morphological and cytochemical aspects of capillary permeability. Microsc. Res. Tech. 2002, 57, 327–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aird, W.C. Endothelial Cell Heterogeneity. Cold Spring Harb. Perspect. Med. 2012, 2, a006429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parab, S.; Quick, R.E.; Matsuoka, R.L. Endothelial cell-type-specific molecular requirements for angiogenesis drive fenestrated vessel development in the brain. ELife 2021, 10, e64295. [Google Scholar] [CrossRef] [Scilit]
- Ross, J.M.; Kim, C.; Allen, D.; Crouch, E.E.; Narsinh, K.; Cooke, D.L.; Abla, A.A.; Nowakowski, T.J.; Winkler, E.A. The Expanding Cell Diversity of the Brain Vasculature. Front. Physiol. 2020, 11, 600767. [Google Scholar] [CrossRef] [Scilit]
- Kalucka, J.; de Rooij, L.P.M.H.; Goveia, J.; Rohlenova, K.; Dumas, S.J.; Meta, E.; Conchinha, N.; Taverna, F.; Teuwen, L.-A.; Veys, K.; et al. Single-Cell Transcriptome Atlas of Murine Endothelial Cells. Cell 2020, 180, 764–779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanlandewijck, M.; He, L.; Mäe, M.A.; Andrae, J.; Ando, K.; Del Gaudio, F.; Nahar, K.; Lebouvier, T.; Laviña, B.; Gouveia, L.; et al. A molecular atlas of cell types and zonation in the brain vasculature. Nature 2018, 554, 475–480. [Google Scholar] [CrossRef] [Scilit]
- Winkler, E.A.; Kim, C.N.; Ross, J.M.; Garcia, J.H.; Gil, E.; Oh, I.; Chen, L.Q.; Wu, D.; Catapano, J.S.; Raygor, K.; et al. A single-cell atlas of the normal and malformed human brain vasculature. Science 2022, 375, eabi7377. [Google Scholar] [CrossRef] [Scilit]
- Saunders, A.; Macosko, E.Z.; Wysoker, A.; Goldman, M.; Krienen, F.M.; de Rivera, H.; Bien, E.; Baum, M.; Bortolin, L.; Wang, S.; et al. Molecular Diversity and Specializations among the Cells of the Adult Mouse Brain. Cell 2018, 174, 1015–1030. [Google Scholar] [CrossRef] [Scilit]
- Xie, Y.; He, L.; Lugano, R.; Zhang, Y.; Cao, H.; He, Q.; Chao, M.; Liu, B.; Cao, Q.; Wang, J.; et al. Key molecular alterations in endothelial cells in human glioblastoma uncovered through single-cell RNA sequencing. JCI Insight 2021, 6, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hupe, M.; Li, M.X.; Kneitz, S.; Davydova, D.; Yokota, C.; Kele, J.; Hot, B.; Stenman, J.M.; Gessler, M.; van der Vlist, M.; et al. Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels. Sci. Signal. 2017, 10, eaag2476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morita, K.; Sasaki, H.; Furuse, M.; Tsukita, S. Endothelial Claudin: Claudin-5/Tmvcf Constitutes Tight Junction Strands in Endothelial Cells. J. Cell Biol. 1999, 147, 185–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyata, S. New aspects in fenestrated capillary and tissue dynamics in the sensory circumventricular organs of adult brains. Front. Neurosci. 2015, 9, 390. [Google Scholar] [CrossRef] [Scilit]
- Ben-Zvi, A.; Liebner, S. Developmental regulation of barrier- and non-barrier blood vessels in the CNS. J. Intern. Med. 2022, 292, 31–46. [Google Scholar] [CrossRef] [Scilit]
- Matsuoka, R.L.; Buck, L.D.; Vajrala, K.P.; Quick, R.E.; Card, O.A. Historical and current perspectives on blood endothelial cell heterogeneity in the brain. Cell Mol. Life Sci. 2022, 79, 372. [Google Scholar] [CrossRef] [Scilit]
- de Graaf, R.A.; Pan, J.W.; Telang, F.; Lee, J.-H.; Brown, P.; Novotny, E.J.; Hetherington, H.P.; Rothman, D.L. Differentiation of Glucose Transport in Human Brain Gray and White Matter. J. Cereb. Blood Flow Metab. 2001, 21, 483–492. [Google Scholar] [CrossRef] [Scilit]
- El-Khoury, N.; Braun, A.; Hu, F.; Pandey, M.; Nedergaard, M.; Lagamma, E.F.; Ballabh, P. Astrocyte End-Feet in Germinal Matrix, Cerebral Cortex, and White Matter in Developing Infants. Pediatr. Res. 2006, 59, 673–679. [Google Scholar] [CrossRef] [Scilit]
- Wilhelm, I.; Nyúl-Tóth, Á.; Suciu, M.; Hermenean, A.; Krizbai, I.A. Heterogeneity of the blood-brain barrier. Tissue Barriers 2016, 4, e1143544. [Google Scholar] [CrossRef] [Scilit]
- Nyúl-Tóth, A.; Suciu, M.; Molnár, J.; Fazakas, C.; Haskó, J.; Herman, H.; Farkas, A.E.; Kaszaki, J.; Hermenean, A.; Wilhelm, I.; et al. Differences in the molecular structure of the blood-brain barrier in the cerebral cortex and white matter: An in silico, in vitro, and ex vivo study. Am. J. Physiol. Heart Circ. Physiol. 2016, 310, H1702–H1714. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noumbissi, M.E.B.; Stins, M.F. Brain vascular heterogeneity: Implications for disease pathogenesis and design of in vitro blood–brain barrier models. Fluids Barriers CNS 2018, 15, 12. [Google Scholar] [CrossRef] [Scilit]
- Schaum, N.; Karkanias, J.; Neff, N.F.; May, A.P.; Quake, S.R.; Wyss-Coray, T.; Darmanis, S.; Batson, J.; Botvinnik, O.; Chen, M.B.; et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 2018, 562, 367–372. [Google Scholar] [CrossRef] [Scilit]
- Harati, R.; Hafezi, S.; Mabondzo, A.; Tlili, A. Silencing miR-202-3p increases MMP-1 and promotes a brain invasive phenotype in metastatic breast cancer cells. PLoS ONE 2020, 15, e0239292. [Google Scholar] [CrossRef] [Scilit]
- Harati, R.; Benech, H.; Villégier, A.S.; Mabondzo, A. P-Glycoprotein, Breast Cancer Resistance Protein, Organic Anion Transporter 3, and Transporting Peptide 1a4 during Blood–Brain Barrier Maturation: Involvement of Wnt/β-Catenin and Endothelin-1 Signaling. Mol. Pharm. 2013, 10, 1566–1580. [Google Scholar] [CrossRef] [Scilit]
- Harati, R.; Villégier, A.-S.; Banks, W.A.; Mabondzo, A. Susceptibility of juvenile and adult blood–brain barrier to endothelin-1: Regulation of P-glycoprotein and breast cancer resistance protein expression and transport activity. J. Neuroinflammation 2012, 9, 765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harati, R.; Mohammad, M.G.; Tlili, A.; El-Awady, R.A.; Hamoudi, R. Loss of miR-101-3p Promotes Transmigration of Metastatic Breast Cancer Cells through the Brain Endothelium by Inducing COX-2/MMP1 Signaling. Pharmaceuticals 2020, 13, 144. [Google Scholar] [CrossRef] [Scilit]
- Harati, R.; Mabondzo, A.; Tlili, A.; Khoder, G.; Mahfood, M.; Hamoudi, R. Combinatorial targeting of microRNA-26b and microRNA-101 exerts a synergistic inhibition on cyclooxygenase-2 in brain metastatic triple-negative breast cancer cells. Breast Cancer Res. Treat. 2021, 187, 695–713. [Google Scholar] [CrossRef] [Scilit]
- Hammash, D.; Mahfood, M.; Khoder, G.; Ahmed, M.; Tlili, A.; Hamoudi, R.; Harati, R. miR-623 Targets Metalloproteinase-1 and Attenuates Extravasation of Brain Metastatic Triple-Negative Breast Cancer Cells. Breast Cancer (Dove Med. Press) 2022, 14, 187–198. [Google Scholar] [CrossRef] [Scilit]
- Harati, R.; Hammad, S.; Tlili, A.; Mahfood, M.; Mabondzo, A.; Hamoudi, R. miR-27a-3p regulates expression of intercellular junctions at the brain endothelium and controls the endothelial barrier permeability. PLoS ONE 2022, 17, e0262152. [Google Scholar] [CrossRef] [Scilit]
- Greene, C.; Hanley, N.; Campbell, M. Claudin-5: Gatekeeper of neurological function. Fluids Barriers CNS 2019, 16, 3. [Google Scholar] [CrossRef] [Scilit]
- van Horssen, J.; Brink, B.P.; de Vries, H.E.; van der Valk, P.; Bø, L. The Blood-Brain Barrier in Cortical Multiple Sclerosis Lesions. J. Neuropathol. Exp. Neurol. 2007, 66, 321–328. [Google Scholar] [CrossRef] [Scilit]
- Prins, M.; Schul, E.; Geurts, J.; van der Valk, P.; Drukarch, B.; van Dam, A.-M. Pathological differences between white and grey matter multiple sclerosis lesions. Ann. N. Y. Acad. Sci. 2015, 1351, 99–113. [Google Scholar] [CrossRef] [Scilit]
- Buschmann, J.P.; Berger, K.; Awad, H.; Clarner, T.C.; Kipp, M. Inflammatory Response and Chemokine Expression in the White Matter Corpus Callosum and Gray Matter Cortex Region During Cuprizone-Induced Demyelination. J. Mol. Neurosci. 2012, 48, 66–76. [Google Scholar] [CrossRef] [Scilit]
- Gudi, V.; Moharregh-Khiabani, D.; Skripuletz, T.; Koutsoudaki, P.N.; Kotsiari, A.; Skuljec, J.; Trebst, C.; Stangel, M. Regional differences between grey and white matter in cuprizone induced demyelination. Brain Res. 2009, 1283, 127–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janssen, K.; Rickert, M.; Clarner, T.; Beyer, C.; Kipp, M. Absence of CCL2 and CCL3 Ameliorates Central Nervous System Grey Matter But Not White Matter Demyelination in the Presence of an Intact Blood–Brain Barrier. Mol. Neurobiol. 2016, 53, 1551–1564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Persidsky, Y.; Ghorpade, A.; Rasmussen, J.; Limoges, J.; Liu, X.J.; Stins, M.; Fiala, M.; Way, D.; Kim, K.S.; Witte, M.H.; et al. Microglial and Astrocyte Chemokines Regulate Monocyte Migration through the Blood-Brain Barrier in Human Immunodeficiency Virus-1 Encephalitis. Am. J. Pathol. 1999, 155, 1599–1611. [Google Scholar] [CrossRef] [Scilit]
- Stins, M.F.; Pearce, D.; Di Cello, F.; Erdreich-Epstein, A.; Pardo, C.A.; Sik Kim, K. Induction of Intercellular Adhesion Molecule-1 on Human Brain Endothelial Cells by HIV-1 gp120: Role of CD4 and Chemokine Coreceptors. Lab. Investig. 2003, 83, 1787–1798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dallasta, L.M.; Pisarov, L.A.; Esplen, J.E.; Werley, J.V.; Moses, A.V.; Nelson, J.A.; Achim, C.L. Blood-Brain Barrier Tight Junction Disruption in Human Immunodeficiency Virus-1 Encephalitis. Am. J. Pathol. 1999, 155, 1915–1927. [Google Scholar] [CrossRef] [Scilit]
- Başkaya, M.K.; Muralikrishna Rao, A.; Doğan, A.; Donaldson, D.; Dempsey, R.J. The biphasic opening of the blood–brain barrier in the cortex and hippocampus after traumatic brain injury in rats. Neurosci. Lett. 1997, 226, 33–36. [Google Scholar] [CrossRef] [Scilit]
- Keaney, J.; Walsh, D.M.; O’Malley, T.; Hudson, N.; Crosbie, D.E.; Loftus, T.; Sheehan, F.; McDaid, J.; Humphries, M.M.; Callanan, J.J.; et al. Autoregulated paracellular clearance of amyloid-β across the blood-brain barrier. Sci. Adv. 2015, 1, e1500472. [Google Scholar] [CrossRef] [Scilit]
- Campbell, M.; Hanrahan, F.; Gobbo, O.L.; Kelly, M.E.; Kiang, A.-S.; Humphries, M.M.; Nguyen, A.T.; Ozaki, E.; Keaney, J.; Blau, C.W.; et al. Targeted suppression of claudin-5 decreases cerebral oedema and improves cognitive outcome following traumatic brain injury. Nat. Commun. 2012, 3, 849. [Google Scholar] [CrossRef] [Scilit]
- Campbell, M.; Nguyen, A.T.H.; Kiang, A.-S.; Tam, L.C.S.; Gobbo, O.L.; Kerskens, C.; Ni Dhubhghaill, S.; Humphries, M.M.; Farrar, G.-J.; Kenna, P.F.; et al. An experimental platform for systemic drug delivery to the retina. Proc. Natl. Acad. Sci. USA 2009, 106, 17817–17822. [Google Scholar] [CrossRef] [Scilit]
- Greene, C.; Campbell, M. Tight junction modulation of the blood brain barrier: CNS delivery of small molecules. Tissue Barriers 2016, 4, e1138017. [Google Scholar] [CrossRef] [Scilit]
- Strazielle, N.; Ghersi-Egea, J.-F. Efflux transporters in blood-brain interfaces of the developing brain. Front. Neurosci. 2015, 9, 21. [Google Scholar] [CrossRef] [Scilit]
- Hartz, M.; Bauer, A.B. ABC Transporters in the CNS-An Inventory. CPB 2011, 12, 656–673. [Google Scholar] [CrossRef] [Scilit]
- Gil-Martins, E.; Barbosa, D.J.; Silva, V.; Remião, F.; Silva, R. Dysfunction of ABC transporters at the blood-brain barrier: Role in neurological disorders. Pharmacol. Ther. 2020, 213, 107554. [Google Scholar] [CrossRef] [Scilit]
- Fricker, A.; Fricker, G. ABC transporters at the blood–brain barrier. Expert Opin. Drug Metab. Toxicol. 2016, 12, 499–508. [Google Scholar] [CrossRef] [Scilit]
- Hammad, S.; Mabondzo, A.; Hamoudi, R.; Harati, R. Regulation of P-glycoprotein by miR-27a-3p at the Brain Endothelial Barrier. J. Pharm. Sci. 2021, 111, S0022354921005621. [Google Scholar] [CrossRef] [Scilit]
- Silva, R.; Vilas-Boas, V.; Carmo, H.; Dinis-Oliveira, R.J.; Carvalho, F.; Bastos, M.D.L.; Remião, F. Modulation of P-glycoprotein efflux pump: Induction and activation as a therapeutic strategy. Pharmacol. Ther. 2015, 149, 1–123. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Bodles-Brakhop, A.M.; Barger, S.W. A Role for P-Glycoprotein in Clearance of Alzheimer Amyloid β -Peptide from the Brain. Curr. Alzheimer. Res 2016, 13, 615–620. [Google Scholar] [CrossRef] [Scilit]
- Ogunmokun, G.; Dewanjee, S.; Chakraborty, P.; Valupadas, C.; Chaudhary, A.; Kolli, V.; Anand, U.; Vallamkondu, J.; Goel, P.; Paluru, H.P.R.; et al. The Potential Role of Cytokines and Growth Factors in the Pathogenesis of Alzheimer’s Disease. Cells 2021, 10, 2790. [Google Scholar] [CrossRef] [Scilit]
- Langford, D.; Grigorian, A.; Hurford, R.; Adame, A.; Ellis, R.J.; Hansen, L.; Masliah, E. Altered P-Glycoprotein Expression in AIDS Patients with HIV Encephalitis. J. Neuropathol. Exp. Neurol. 2004, 63, 1038–1047. [Google Scholar] [CrossRef] [Scilit]
- Bartels, A.L.; Willemsen, A.T.M.; Kortekaas, R.; De Jong, B.M.; De Vries, R.; De Klerk, O.; Van Oostrom, J.C.H.; Portman, A.; Leenders, K.L. Decreased blood–brain barrier P-glycoprotein function in the progression of Parkinson’s disease, PSP and MSA. J. Neural Transm. 2008, 115, 1001–1009. [Google Scholar] [CrossRef] [Scilit]
- Sisodiya, S.M.; Lin, W.-R.; Harding, B.N.; Squier, M.V.; Thom, M. Drug resistance in epilepsy: Expression of drug resistance proteins in common causes of refractory epilepsy. Brain 2002, 125, 22–31. [Google Scholar] [CrossRef] [Scilit]
- Gidal, B.E. P-glycoprotein Expression and Pharmacoresistant Epilepsy: Cause or Consequence? Epilepsy Curr. 2014, 14, 136–138. [Google Scholar] [CrossRef] [Scilit]
- Kooij, G.; van Horssen, J.; Bandaru, V.V.R.; Haughey, N.; de Vries, H. The Role of ATP-Binding Cassette Transporters in Neuro-Inflammation: Relevance for Bioactive Lipids. Front. Pharmacol. 2012, 3, 74. [Google Scholar] [CrossRef] [Scilit]
- Bakos, É.; Homolya, L. Portrait of multifaceted transporter, the multidrug resistance-associated protein 1 (MRP1/ABCC1). Pflügers Archiv-European J. Physiol. 2007, 453, 621–641. [Google Scholar] [CrossRef] [Scilit]
- Begley, J.D. ABC Transporters and the Blood-Brain Barrier. Curr. Pharm. Des. 2004, 10, 1295–1312. [Google Scholar] [CrossRef] [Scilit]
- Sarkadi, B.; Özvegy-Laczka, C.; Német, K.; Váradi, A. ABCG2-a transporter for all seasons. FEBS Letters 2004, 567, 116–120. [Google Scholar] [CrossRef]
- Agarwal, S.M.; Hartz, A.F.; Elmquist, W.; Bauer, B. Breast Cancer Resistance Protein and P-Glycoprotein in Brain Cancer: Two Gatekeepers Team Up. Curr. Pharm. Des. 2011, 17, 2793–2802. [Google Scholar] [CrossRef] [Scilit]
- Storck, S.; Meister, S.; Nahrath, J.; Meißner, J.N.; Schubert, N.; Di Spiezio, A.; Baches, S.; Vandenbroucke, R.; Bouter, Y.; Prikulis, I.; et al. Endothelial LRP1 transports amyloid-β1–42 across the blood-brain barrier. J. Clin. Invest 2016, 126, 123–136. [Google Scholar] [CrossRef] [Scilit]
- Pardridge, W.M. Delivery of Biologics Across the Blood–Brain Barrier with Molecular Trojan Horse Technology. BioDrugs 2017, 31, 503–519. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Liu, Q.Y.; Haqqani, A.S.; Leclerc, S.; Liu, Z.; Fauteux, F.; Baumann, E.; Delaney, C.E.; Ly, D.; Star, A.T.; et al. Differential expression of receptors mediating receptor-mediated transcytosis (RMT) in brain microvessels, brain parenchyma and peripheral tissues of the mouse and the human. Fluids Barriers CNS 2020, 17, 47. [Google Scholar] [CrossRef] [Scilit]
- Bourassa, P.; Alata, W.; Tremblay, C.; Paris-Robidas, S.; Calon, F. Transferrin Receptor-Mediated Uptake at the Blood–Brain Barrier Is Not Impaired by Alzheimer’s Disease Neuropathology. Mol. Pharm. 2019, 16, 583–594. [Google Scholar] [CrossRef] [Scilit]
- Arora, S.; Sharma, D.; Singh, J. GLUT-1: An Effective Target To Deliver Brain-Derived Neurotrophic Factor Gene Across the Blood Brain Barrier. ACS Chem. Neurosci. 2020, 11, 1620–1633. [Google Scholar] [CrossRef] [Scilit]
- Rubin, L.L.; Hall, D.E.; Porter, S.; Barbu, K.; Cannon, C.; Horner, H.C.; Janatpour, M.; Liaw, C.W.; Manning, K.; Morales, J. A cell culture model of the blood-brain barrier. J. Cell Biol. 1991, 115, 1725–1735. [Google Scholar] [CrossRef] [Scilit]
- Goldstein, G.W. Endothelial Cell-Astrocyte Interactions. Ann. N. Y. Acad. Sci. 1988, 529, 31–39. [Google Scholar] [CrossRef] [Scilit]
- Tao-Cheng, J.; Nagy, Z.; Brightman, M. Tight junctions of brain endothelium in vitro are enhanced by astroglia. J. Neurosci. 1987, 7, 3293. [Google Scholar] [CrossRef] [Scilit]
- Nakagawa, S.; Deli, M.A.; Nakao, S.; Honda, M.; Hayashi, K.; Nakaoke, R.; Kataoka, Y.; Niwa, M. Pericytes from Brain Microvessels Strengthen the Barrier Integrity in Primary Cultures of Rat Brain Endothelial Cells. Cell. Mol. Neurobiol. 2007, 27, 687–694. [Google Scholar] [CrossRef] [Scilit]
- Nakagawa, S.; Deli, M.A.; Kawaguchi, H.; Shimizudani, T.; Shimono, T.; Kittel, A.; Tanaka, K.; Niwa, M. A new blood–brain barrier model using primary rat brain endothelial cells, pericytes and astrocytes. Neurochem. Int. 2009, 54, 253–263. [Google Scholar] [CrossRef] [Scilit]
- Daneman, R.; Zhou, L.; Kebede, A.A.; Barres, B.A. Pericytes are required for blood–brain barrier integrity during embryogenesis. Nature 2010, 468, 562–566. [Google Scholar] [CrossRef] [Scilit]
- Bell, R.D.; Winkler, E.A.; Sagare, A.P.; Singh, I.; LaRue, B.; Deane, R.; Zlokovic, B.V. Pericytes Control Key Neurovascular Functions and Neuronal Phenotype in the Adult Brain and during Brain Aging. Neuron 2010, 68, 409–427. [Google Scholar] [CrossRef] [Scilit]
- Armulik, A.; Genové, G.; Mäe, M.; Nisancioglu, M.H.; Wallgard, E.; Niaudet, C.; He, L.; Norlin, J.; Lindblom, P.; Strittmatter, K.; et al. Pericytes regulate the blood–brain barrier. Nature 2010, 468, 557–561. [Google Scholar] [CrossRef] [Scilit]
- Villaseñor, R.; Kuennecke, B.; Ozmen, L.; Ammann, M.; Kugler, C.; Grüninger, F.; Loetscher, H.; Freskgård, P.-O.; Collin, L. Region-specific permeability of the blood–brain barrier upon pericyte loss. J. Cereb. Blood Flow Metab. 2017, 37, 3683–3694. [Google Scholar] [CrossRef] [Scilit]
- Zobel, K.; Hansen, U.; Galla, H.-J. Blood-brain barrier properties in vitro depend on composition and assembly of endogenous extracellular matrices. Cell Tissue Res. 2016, 365, 233–245. [Google Scholar] [CrossRef] [Scilit]
- Baeten, K.M.; Akassoglou, K. Extracellular matrix and matrix receptors in blood–brain barrier formation and stroke. Dev. Neurobiol. 2011, 71, 1018–1039. [Google Scholar] [CrossRef] [Scilit]
- Laksitorini, M.D.; Yathindranath, V.; Xiong, W.; Hombach-Klonisch, S.; Miller, D.W. Modulation of Wnt/β-catenin signaling promotes blood-brain barrier phenotype in cultured brain endothelial cells. Sci. Rep. 2019, 9, 19718. [Google Scholar] [CrossRef] [Scilit]





| Klk8 Mouse qPCR Primer Pair (NM_008940): Hippocampus marker | |
| Forward Sequence | TCCTGGTTGGAGACAGATGGGT |
| Reverse Sequence | AGGATGCTGGATAGACTGAGCC |
| Spink8 Mouse qPCR Primer Pair (NM_183136): Hippocampus marker | |
| Forward Sequence | CATCCTTCCTATGAACTTTCACATG |
| Reverse Sequence | CTCGTAGGTCACTTGGTTGCTG |
| Tnnc1 Mouse qPCR Primer Pair (NM_009393): Cortex marker | |
| Forward Sequence | GATGGTTCGGTGCATGAAGGAC |
| Reverse Sequence | CTTCCGTAATGGTCTCACCTGTG |
| Hkdc1 Mouse qPCR Primer Pair (NM_145419): Cortex marker | |
| Forward Sequence | TTTCGCTCAGCCAATCTCTGCG |
| Reverse Sequence | ACCACCTTGTGTAGGCGTTTGG |
| Gapdh Mouse qPCR Primer Pair (NM_008084) | |
| Forward Sequence | CATCACTGCCACCCAGAAGACTG |
| Reverse Sequence | ATGCCAGTGAGCTTCCCGTTCAG |
| Cldn5 Mouse qPCR Primer Pair (NM_013805) | |
| Forward Sequence | TGACTGCCTTCCTGGACCACAA |
| Reverse Sequence | CATACACCTTGCACTGCATGTGC |
| Abcb1a Mouse qPCR Primer Pair (NM_011076) | |
| Forward Sequence | TCCTCACCAAGCGACTCCGATA |
| Reverse Sequence | ACTTGAGCAGCATCGTTGGCGA |
| Abcg2 Mouse qPCR Primer Pair (NM_011920) | |
| Forward Sequence | CAGTTCTCAGCAGCTCTTCGAC |
| Reverse Sequence | TCCTCCAGAGATGCCACGGATA |
| Abcc1 Mouse qPCR Primer Pair (NM_008576) | |
| Forward Sequence | CAGTGGTTCAGGGAAGGAGTCA |
| Reverse Sequence | CACTGTGGGAAGACGAGTTGCT |
| Lrp1 Mouse qPCR Primer Pair (NM_008512) | |
| Forward Sequence | CGAGAGCCTTTGTGCTGGATGA |
| Reverse Sequence | CGGATGTCCTTCTCAATGAGGG |
| Tfrc Mouse qPCR Primer Pair (NM_011638) | |
| Forward Sequence | GAAGTCCAGTGTGGGAACAGGT |
| Reverse Sequence | CAACCACTCAGTGGCACCAACA |
| Slc2a1 Mouse qPCR Primer Pair (NM_011400) | |
| Forward Sequence | GCTTCTCCAACTGGACCTCAAAC |
| Reverse Sequence | ACGAGGAGCACCGTGAAGATGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alnaqbi, N.; Mohammad, M.G.; Hamoudi, R.; Mabondzo, A.; Harati, R. Molecular Heterogeneity of the Brain Endothelium. Curr. Issues Mol. Biol. 2023, 45, 3462-3478. https://doi.org/10.3390/cimb45040227
Alnaqbi N, Mohammad MG, Hamoudi R, Mabondzo A, Harati R. Molecular Heterogeneity of the Brain Endothelium. Current Issues in Molecular Biology. 2023; 45(4):3462-3478. https://doi.org/10.3390/cimb45040227
Chicago/Turabian StyleAlnaqbi, Nada, Mohammad G. Mohammad, Rifat Hamoudi, Aloïse Mabondzo, and Rania Harati. 2023. "Molecular Heterogeneity of the Brain Endothelium" Current Issues in Molecular Biology 45, no. 4: 3462-3478. https://doi.org/10.3390/cimb45040227
APA StyleAlnaqbi, N., Mohammad, M. G., Hamoudi, R., Mabondzo, A., & Harati, R. (2023). Molecular Heterogeneity of the Brain Endothelium. Current Issues in Molecular Biology, 45(4), 3462-3478. https://doi.org/10.3390/cimb45040227

