The Annotation of Zebrafish Enhancer Trap Lines Generated with PB Transposon
Abstract
1. Introduction
2. Materials and Methods
2.1. GFP Detection of Enhancer-Trapped Zebrafish Lines
2.2. PCR for Transgenes
2.3. Splinkerette PCR for Genome Insertion Sites
2.4. Enhancer and Endogenous Gene Annotation
2.5. Whole-Mount In Situ Hybridization
3. Results
3.1. GFP Expression Patterns in Zebrafish Enhancer Trap Line
3.2. Insertion of Genome
3.3. Enhancer Annotation
3.4. Itgav Gene Expresstion Pattern
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Du, Y.; Zuo, Z. Advances in research methods for gene function. Chin. Bull. Life Sci. 2008, 20, 589–592. [Google Scholar]
- Liu, C.; Song, G.; Mao, L.; Long, Y.; Li, Q.; Cui, Z. Generation of an Enhancer-Trapping Vector for Insertional Mutagenesis in Zebrafish. PLoS ONE 2015, 10, e0139612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellen, H.; O’Kane, C.; Wilson, C.; Grossniklaus, U.; Pearson, R.K.; Gehring, W.J. P-element-mediated enhancer detection: A versatile method to study development in Drosophila. Genes Dev. 1989, 3, 1288–1300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naldini, L.; Trono, D.; Verma, I. Lentiviral vectors, two decades later. Science 2016, 353, 1101–1102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, Y.; Huang, W.; Du, J.; Wang, Z.; He, J.; Luo, L. Tol2 Improved -mediated enhancer trap identifies weakly expressed genes during liver and β cell development and regeneration in zebrafish. J. Biol. Chem. 2019, 294, 932–940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parinov, S.; Kondrichin, I.; Korzh, V.; Emelyanov, A. Tol2 transposon-mediated enhancer trap to identify developmentally regulated zebrafish genes in vivo. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2004, 231, 449–459. [Google Scholar] [CrossRef] [Scilit]
- Grabher, C.; Henrich, T.; Sasado, T.; Arenz, A.; Wittbrodt, J.; Furutani-Seiki, M. Transposon-mediated enhancer trapping in medaka. Gene 2003, 322, 57–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, D.; Xue, S.; Chan, S.; Sang, Y.; Wang, S.; Wang, Y.; Chen, C.; Gao, B.; Mueller, F.; Song, C. Enhancer Trapping and Annotation in Zebrafish Mediated with Sleeping Beauty, piggyBac and Tol2 Transposons. Genes 2018, 9, 630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balciunas, D.; Davidson, A.; Sivasubbu, S.; Hermanson, S.B.; Welle, Z.; Ekker, S.C. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genom. 2008, 5, 62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potter, C.; Luo, L. Splinkerette PCR for mapping transposable elements in Drosophila. PLoS ONE 2010, 5, e10168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sang, Y.; Shen, D.; Chen, W.; Chan, S.; Gu, H.; Gao, B.; Song, C. Enhancer trapping nearby rps26 gene in zebrafish mediated by the Tol2 transposon and it’s annotation. Sheng Wu Gong Cheng Xue Bao Chin. J. Biotechnol. 2018, 34, 449–458. [Google Scholar] [CrossRef]
- Thisse, C.; Thisse, B. High-resolution in situ hybridization to wholemount zebrafish embryos. Nat. Protoc. 2008, 3, 59–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fraser, M.J.; Smith, G.E.; Summers, M. Acquisition of Host Cell DNA Sequences by Baculoviruses: Relationship Between Host DNA Insertions and FP Mutants of Autographa californica and Galleria mellonella Nuclear Polyhedrosis Viruses. J. Virol. 1983, 47, 287–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shima, Y.; Sugino, K.; Hempel, C.M.; Shima, M.; Taneja, P.; Bullis, J.B.; Nelson, S.B. A Mammalian enhancer trap resource for discovering and manipulating neuronal cell types. Elife 2016, 5, e13503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Lin, C.; Lu, D.; Ning, Z.; Cox, T.; Melvin, D.; Wang, X.; Bradley, A.; Liu, P. Chromosomal transposition of PiggyBac in mouse embryonic stem cells. Proc. Natl. Acad. Sci. USA 2008, 105, 9290–9295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, Q.; Kong, J.; Stalker, J.; Bradley, A. Chromosomal mobilization and reintegration of Sleeping Beauty and PiggyBac transposons. Genesis 2009, 47, 404–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.A.; Pettitt, S.J.; Eckert, S.; Ning, Z.; Rice, S.; Cadiñanos, J.; Yusa, K.; Conte, N.; Bradley, A. The piggyBac Transposon Displays Local and Distant Reintegration Preferences and Can Cause Mutations at Noncanonical Integration Sites. Mol. Cell. Biol. 2013, 33, 1317–1330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trinh, L.A.; Fraser, S.E. Enhancer and gene traps for molecular imaging and genetic analysis in zebrafish. Dev. Growth Differ. 2013, 55, 434–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jhunjhunwala, S.; van Zelm, M.; Peak, M.M.; Cutchin, S.; Riblet, R.; Van Dongen, J.; Grosveld, F.G.; Knoch, T.A.; Murre, C. The 3D Structure of the Immunoglobulin HeavyChain Locus: Implications for LongRange Genomic Interactions. Cell 2008, 133, 265–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chatterjee, S.; Min, L.; Karuturi, R.K.M.; Lufkin, T. The role of post-transcriptional RNA processing and plasmid vector sequences on transient transgene expression in zebrafish. Transgenic Res. 2010, 19, 299–304. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Name | Sequence (5′–3′) |
|---|---|
| Krt4-F | GTGTGTGTGTGAGCAGTCAG |
| GFP-F | CACCATGGTGAGCAAGGGCG |
| GFP-R | TTGTACAGCTCGCCATGCCGA |
| Name | Sequence (5′–3′) |
|---|---|
| SPLINK 1 | CGAAGAGTAACCGTTGCTAGGAGAGACC |
| PB-SP1F | GACCTGCAGCCCAAAACTAA |
| SPLINK 2 | GTGGCTGAATGAGACTGGTGTCGAC |
| PB-SP2F | ACCGATAAAACACATGCGTCA |
| SPLNK-GATC-TOP | GATCCCACTAGTGTCGACACCAGTCTCTAATTTTTTTTTTAAAAAAA |
| SPLNK-BOT | CGAAGAGTAACCGTTGCTAGGAGAGACCGTGGCTGAATGAGACTGGTGTCGACACTAGTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, W.; Guan, Z.; Shi, S.; Xiang, K.; Chen, P.; Tan, F.; Ullah, N.; Diaby, M.; Guo, M.; Song, C.; et al. The Annotation of Zebrafish Enhancer Trap Lines Generated with PB Transposon. Curr. Issues Mol. Biol. 2022, 44, 2614-2621. https://doi.org/10.3390/cimb44060178
Jia W, Guan Z, Shi S, Xiang K, Chen P, Tan F, Ullah N, Diaby M, Guo M, Song C, et al. The Annotation of Zebrafish Enhancer Trap Lines Generated with PB Transposon. Current Issues in Molecular Biology. 2022; 44(6):2614-2621. https://doi.org/10.3390/cimb44060178
Chicago/Turabian StyleJia, Wenzhu, Zhongxia Guan, Shasha Shi, Kuilin Xiang, Peihong Chen, Fen Tan, Numan Ullah, Mohamed Diaby, Mengke Guo, Chengyi Song, and et al. 2022. "The Annotation of Zebrafish Enhancer Trap Lines Generated with PB Transposon" Current Issues in Molecular Biology 44, no. 6: 2614-2621. https://doi.org/10.3390/cimb44060178
APA StyleJia, W., Guan, Z., Shi, S., Xiang, K., Chen, P., Tan, F., Ullah, N., Diaby, M., Guo, M., Song, C., & Gao, B. (2022). The Annotation of Zebrafish Enhancer Trap Lines Generated with PB Transposon. Current Issues in Molecular Biology, 44(6), 2614-2621. https://doi.org/10.3390/cimb44060178

