Effect of Ethanol on Parthenogenetic Activation and α-Tocopherol Supplementation during In Vitro Maturation on Developmental Competence of Summer-Collected Bovine Oocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Experimental Design
2.2.1. Experiment 1
2.2.2. Experiment 2
2.3. In Vitro Maturation
2.4. Parthenogenetic Activation
2.5. Assessment of Meiotic Progression
2.6. In Vitro Fertilization
2.7. Assessment of Pronucleus Formation
2.8. In Vitro Culture
2.9. Cell Counting in Parthenogenetic Blastocysts
2.10. Assessment of Total Cell Number and DNA Fragmentation
2.11. Gene Expression
2.12. Statistical Analysis
3. Results
3.1. Experiment 1
3.2. Experiment 2
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Giro, A.; Carlos, A.; Bernardi, D.C.; Barioni, W.; Prudêncio, A.; Botta, D.; Romanello, N.; Barreto, N.; Rossetto, A. Application of microchip and infrared thermography for monitoring body temperature of beef cattle kept on pasture. J. Therm. Biol. 2019, 84, 121–128. [Google Scholar] [CrossRef] [PubMed]
- Hansen, P.J. Effects of heat stress on mammalian reproduction. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 3341–3350. [Google Scholar] [CrossRef]
- Roth, Z. Reproductive physiology and endocrinology responses of cows exposed to environmental heat stress—Experiences from the past and lessons for the present. Theriogenology 2020, 155, 150–156. [Google Scholar] [CrossRef] [PubMed]
- Stamperna, K.; Giannoulis, T.; Nanas, I.; Dadouli, K.; Moutou, K.; Amiridis, G.S. Short term temperature elevation during IVM affects embryo yield and alters gene expression pattern in oocytes, cumulus cells and blastocysts in cattle. Theriogenology 2020, 156, 36–45. [Google Scholar] [CrossRef] [PubMed]
- De Rensis, F.; Scaramuzzi, R.J. Heat stress and seasonal effects on reproduction in the dairy cow—A review. Theriogenology 2003, 60, 1139–1151. [Google Scholar] [CrossRef]
- Wolfenson, D.; Roth, Z.; Meidan, R. Impaired reproduction in heat-stressed cattle: Basic and applied aspects. Anim. Reprod. Sci. 2000, 60–61, 535–547. [Google Scholar] [CrossRef]
- Morrell, J.M. Theriogenology Heat stress and bull fertility. Theriogenology 2020, 153, 62–67. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, T.A.; Ispada, J.; Risolia, P.H.B.; Rodrigues, M.T.; Lima, R.S.; Assumpção, M.E.O.A.; Visintin, J.A.; Paula-Lopes, F.F. Thermoprotective effect of insulin-like growth factor 1 on in vitro matured bovine oocyte exposed to heat shock. Theriogenology 2016, 86, 2028–2039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Katanani, Y.M.; Paula-Lopes, F.F.; Hansen, P.J. Effect of season and exposure to heat stress on oocyte competence in Holstein cows. J. Dairy Sci. 2002, 85, 390–396. [Google Scholar] [CrossRef]
- Rocha, A.; Randel, R.D.; Broussard, J.R.; Lim, J.M.; Blair, R.M.; Roussel, J.D.; Godke, R.A.; Hansel, W. High environmental temperature and humidity decrease oocyte quality in Bos taurus but not in Bos indicus cows. Theriogenology 1998, 49, 657–665. [Google Scholar] [CrossRef]
- Roth, Z.; Arav, A.; Bor, A.; Zeron, Y.; Braw-Tal, R.; Wolfenson, D. Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction 2001, 122, 737–744. [Google Scholar] [CrossRef]
- Roth, Z. Heat stress reduces maturation and developmental capacity in bovine oocytes. Reprod. Fertil. Dev. 2021, 33, 66–75. [Google Scholar] [CrossRef]
- Ferreira, R.M.; Ayres, H.; Chiaratti, M.R.; Ferraz, M.L.; Araújo, A.B.; Rodrigues, C.A.; Watanabe, Y.F.; Vireque, A.A.; Joaquim, D.C.; Smith, L.C.; et al. The low fertility of repeat-breeder cows during summer heat stress is related to a low oocyte competence to develop into blastocysts. J. Dairy Sci. 2011, 94, 2383–2392. [Google Scholar] [CrossRef] [PubMed]
- Yaacobi-Artzi, S.; Shimoni, C.; Kalo, D.; Hansen, P.J.; Roth, Z. Melatonin slightly alleviates the effect of heat shock on bovine oocytes and resulting blastocysts. Theriogenology 2020, 158, 477–489. [Google Scholar] [CrossRef]
- Morado, S.A.; Cetica, P.D.; Beconi, M.T.; Dalvit, G.C. Reactive oxygen species in bovine oocyte maturation In Vitro. Reprod. Fertil. Dev. 2009, 21, 608–614. [Google Scholar] [CrossRef]
- Kitagawa, Y.; Suzuki, K.; Yoneda, A.; Watanabe, T. Effects of oxygen concentration and antioxidants on the In Vitro developmental ability, production of reactive oxygen species (ROS), and DNA fragmentation in porcine embryos. Theriogenology 2004, 62, 1186–1197. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Chen, H.; Tian, N.N.; Huo, D.T.; Li, G.; Zhang, Y.H.; Liu, Y.; Fang, F.G.; Ding, J.P.; Zhang, X.R. Effects of L-Ascorbic Acid, α-Tocopherol and Co-culture on In Vitro Developmental Potential of Porcine Cumulus Cells Free Oocytes. Reprod. Domest. Anim. 2010, 45, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Natarajan, R.; Shankar, M.B.; Munuswamy, D. Effect of α-tocopherol supplementation on In Vitro maturation of sheep oocytes and In Vitro development of preimplantation sheep embryos to the blastocyst stage. J. Assist. Reprod. Genet. 2010, 27, 483–490. [Google Scholar] [CrossRef] [Green Version]
- Olson, S.E.; Seidel, G.E. Culture of In Vitro-Produced Bovine Embryos with Vitamin E Improves Development In Vitro and After Transfer to Recipients 1. Biol. Reprod. 2000, 62, 248–252. [Google Scholar] [CrossRef] [Green Version]
- Arias-Álvarez, M.; García-García, R.M.; López-Tello, J.; Rebollar, P.G.; Gutiérrez-Adán, A.; Lorenzo, P.L. α-Tocopherol modifies the expression of genes related to oxidative stress and apoptosis during In Vitro maturation and enhances the developmental competence of rabbit oocytes. Reprod. Fertil. Dev. 2018, 30, 1728–1738. [Google Scholar] [CrossRef] [Green Version]
- Tao, Y.; Zhou, B.; Xia, G.; Wang, F.; Wu, Z.; Fu, M. Exposure to L-Ascorbic Acid or α-Tocopherol Facilitates the Development of Porcine Denuded Oocytes from Metaphase I to Metaphase II and Prevents Cumulus Cells from Fragmentation. Reprod. Domest. Anim. 2004, 39, 52–57. [Google Scholar] [CrossRef]
- Amaral, C.S.; Koch, J.; Correa, E.E., Jr.; Bertolin, K.; Mujica, L.K.S.; Fiorenza, M.F.; Rosa, S.G.; Nogueira, C.W.; Comim, F.V.; Portela, V.V.M.; et al. Heat stress on oocyte or zygote compromises embryo development, impairs interferon tau production and increases reactive oxygen species and oxidative stress in bovine embryos produced In Vitro. Mol. Reprod. Dev. 2020, 87, 899–909. [Google Scholar] [CrossRef] [PubMed]
- Minamihashi, A.; Watson, A.J.; Watson, P.H.; Church, R.B.; Schultz, G.A. Bovine parthenogenetic blastocysts following In Vitro maturation and oocyte activation with ethanol. Theriogenology 1993, 40, 63–76. [Google Scholar] [CrossRef]
- Suvá, M.; Canel, N.G.; Salamone, D.F. Effect of single and combined treatments with MPF or MAPK inhibitors on parthenogenetic haploid activation of bovine oocytes. Reprod. Biol. 2019, 19, 386–393. [Google Scholar] [CrossRef]
- Novaes, M.A.S.; Lima, L.F.; Sá, N.A.R.; Ferreira, A.C.A.; Paes, V.M.; Souza, J.F.; Alves, B.G.; Gramosa, N.V.; Torres, C.A.A.; Pukazhenthi, B.; et al. Impact of ethanol and heat stress–dependent effect of ultra-diluted Arnica montana 6 cH on In Vitro embryo production in cattle. Theriogenology 2021, 162, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Thom, E.C. The Discomfort Index. Weatherwise 1959, 12, 57–61. [Google Scholar] [CrossRef]
- Harvey, A.J. The role of oxygen in ruminant preimplantation embryo development and metabolism. Anim. Reprod. Sci. 2007, 98, 113–128. [Google Scholar] [CrossRef] [PubMed]
- Tseng, J.K.; Chen, C.H.; Chou, P.C.; Yeh, S.P.; Ju, J.C. Influences of follicular size on parthenogenetic activation and In Vitro heat shock on the cytoskeleton in cattle oocytes. Reprod. Domest. Anim. 2004, 39, 146–153. [Google Scholar] [CrossRef]
- Holm, P.; Booth, P.J.; Schmidt, M.H.; Greve, T.; Callesen, H. High bovine blastocyst development in a static In Vitro production system using SOFaa medium supplemented with sodium citrate and myo-inositol with or without serum-proteins. Theriogenology 1999, 52, 683–700. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 22212ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Du Preez, J.H.; Giesecke, W.H.; Hattingh, P.J. Heat stress in dairy cattle and other livestock under southern African conditions. I. Temperature-humidity index mean values during the four main seasons. Onderstepoort J. Vet. Res. 1990, 57, 77–87. [Google Scholar]
- Méo, S.C.; Yamazaki, W.; Ferreira, C.R.; Perecin, F.; Saraiva, N.Z.; Leal, C.L.V.; Garcia, J.M. Parthenogenetic activation of bovine oocytes using single and combined strontium, ionomycin and 6-dimethylaminopurine treatments. Zygote 2007, 15, 295–306. [Google Scholar] [CrossRef] [Green Version]
- Méo, S.C.; Yamazaki, W.; Leal, C.L.V.; de Oliveira, J.A.; Garcia, J.M. Use of strontium for bovine oocyte activation. Theriogenology 2005, 63, 2089–2102. [Google Scholar] [CrossRef]
- Ayoub, M.A.; Hunter, A.G. Parthenogenetic Activation of In Vitro Matured Bovine Oocytes. J. Dairy Sci. 1993, 76, 421–429. [Google Scholar] [CrossRef]
- de Oliveira Santos, M.V.; Nascimento, L.E.; Praxedes, É.A.; Borges, A.A.; Silva, A.R.; Bertini, L.M.; Pereira, A.F. Syzygium aromaticum essential oil supplementation during in vitro bovine oocyte maturation improves parthenogenetic embryonic development. Theriogenology 2019, 128, 74–80. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Z.; Niu, Z.; Liu, Z.; Ma, J.; Qu, P.; Qiao, F.; Su, J.; Zhang, Y.; Wang, Y. The effects of glycine-glutamine dipeptide replaced l-glutamine on bovine parthenogenetic and IVF embryo development. Theriogenology 2020, 141, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Dalvit, G.; Llanes, S.P.; Descalzo, A.; Insani, M.; Beconi, M.; Cetica, P. Effect of alpha-tocopherol and ascorbic acid on bovine oocyte In Vitro maturation. Reprod. Domest. Anim. 2005, 40, 93–97. [Google Scholar] [CrossRef] [PubMed]
- Thiyagarajan, B.; Valivittan, K. Ameliorating effect of vitamin e on In Vitro development of preimplantation buffalo embryos. J. Assist. Reprod. Genet. 2009, 26, 217–225. [Google Scholar] [CrossRef] [Green Version]
- Adeldust, H.; Zeinoaldini, S.; Kohram, H.; Roudbar, M.A.; Joupari, M.D. In Vitro maturation of ovine oocyte in a modified granulosa cells co-culture system and alpha-tocopherol supplementation: Effects on nuclear maturation and cleavage. J. Anim. Sci. Technol. 2015, 57, 27. [Google Scholar] [CrossRef] [Green Version]
- Tareq, K.M.A.; Akter, S.; Khandoker, M.A.M.Y. Selenium and vitamin E improve the In Vitro maturation, fertilization and culture to blastocysts of porcne oocytes. J. Reprod. Dev. 2012, 58, 621–628. [Google Scholar] [CrossRef] [Green Version]
- Yashiro, I.; Tagiri, M.; Ogawa, H.; Tashima, K.; Takashima, S.; Hara, H.; Hirabayashi, M.; Hochi, S. High revivability of vitrified-warmed bovine mature oocytes after recovery culture with α-tocopherol. Reproduction 2015, 149, 347–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maier, C.M.; Chan, P.H. Role of superoxide dismutases in oxidative damage and neurodegenerative disorders. Neuroscientist 2002, 8, 323–334. [Google Scholar] [CrossRef] [PubMed]
- Ghanem, N.; Ha, A.N.; Fakruzzaman, M.; Bang, J.I.; Lee, S.C.; Kong, I.K. Differential expression of selected candidate genes in bovine embryos produced In Vitro and cultured with chemicals modulating lipid metabolism. Theriogenology 2014, 82, 238–250. [Google Scholar] [CrossRef]
- Corrêa, G.A.; Rumpf, R.; Mundim, T.C.D.; Franco, M.M.; Dode, M.A.N. Oxygen tension during In Vitro culture of bovine embryos: Effect in production and expression of genes related to oxidative stress. Anim. Reprod. Sci. 2008, 104, 132–142. [Google Scholar] [CrossRef]
- Ha, A.N.; Lee, S.R.; Jeon, J.S.; Park, H.S.; Lee, S.H.; Jin, J.I.; Sessions, B.R.; Wang, Z.; White, K.L.; Kong, I.K. Development of a modified straw method for vitrification of In Vitro-produced bovine blastocysts and various genes expression in between the methods. Cryobiology 2014, 68, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Borcąri, N.R.; Santos, J.F.D.; Reigado, G.R.; Freitas, B.L.; Araújo, M.D.S.; Nunes, V.A. Vitamins Modulate the Expression of Antioxidant Genes in Progesterone-Treated Pancreatic β Cells: Perspectives for Gestational Diabetes Management. Int. J. Endocrinol. 2020, 2020. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Lu, P.; Beeraka, N.M.; Sukocheva, O.A.; Madhunapantula, S.R.V.; Liu, J.; Sinelnikov, M.Y.; Nikolenko, V.N.; Bulygin, K.V.; Mikhaleva, L.M.; et al. Mitochondrial mutations and mitoepigenetics: Focus on regulation of oxidative stress-induced responses in breast cancers. Semin. Cancer Biol. 2020. [Google Scholar] [CrossRef]
- Zappe, K.; Pointner, A.; Switzeny, O.J.; Magnet, U.; Tomeva, E.; Heller, J.; Mare, G.; Wagner, K.H.; Knasmueller, S.; Haslberger, A.G. Counteraction of oxidative stress by Vitamin E affects epigenetic regulation by increasing global methylation and gene expression of MLH1 and DNMT1 dose dependently in Caco-2 cells. Oxid. Med. Cell. Longev. 2018, 2018, 3734250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Remely, M.; Ferk, F.; Sterneder, S.; Setayesh, T.; Kepcija, T.; Roth, S.; Noorizadeh, R.; Greunz, M.; Rebhan, I.; Wagner, K.H.; et al. Vitamin e modifies high-fat diet-induced increase of DNA strand breaks, and changes in expression and DNA methylation of DNMT1 and MLH1 in C57BL/6J male mice. Nutrients 2017, 9, 607. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Gene Symbol | Primer Sequence (5′-3′) | Fragment Size (bp) | GenBank Accession No. |
---|---|---|---|---|
Interferon tau | IFNT2 | F: TCTGAGGACCACATGCTAGG R: GATCCTTCTGGAGCTGGTTG | 145 | NM_001015511.3 |
Heat shock protein 70 | HSPA1A | F: CTTCAACATGAAGAGCGCCG R: TGATGGGGTTACACACCTGC | 182 | NM_203322.3 |
Manganese superoxide dismutase | SOD2 | F: CCCATGAAGCCTTTCTAATCCTG R: TTCAGAGGCGCTACTATTTCCTTC | 307 | NM_201527.2 |
Catalase | CAT | F: GTTCGCTTCTCCACTGTT R: GGCCATAGTCAGGATCTT | 454 | NM_001035386.2 |
Bcl-2-associated X protein | BAX | F: TTTGCTTCAGGGTTTCATCCA R: CCGATGCGCTTCAGACACT | 126 | NM_173894.1 |
B-cell lymphoma 2 | BCL2 | F: GAGTCGGATCGCAACTTGGA R: CTCTCGGCTGCTGCATTGT | 120 | NM_001077486.2 |
Glyceraldehyde 3-phosphate dehydrogenase | GAPDH | F: GATTGTCAGCAATGCCTCCT R: GGTCATAAGTCCCTCCACGA | 94 | NM_001034034.2 |
Temperature (°C) | Relative Humidity (%) | THI | |
---|---|---|---|
Maximal | 25–29.8 | 87–94 | 75.78–83.94 |
Minimal | 19.7–21.8 | 44–71 | 64.81–67.88 |
Average | 23.31 ± 1.22 | 70.38 ± 5.05 | 71.31 ± 1.5 |
Control (% ± s.e.m.) | 0.05% EtOH (% ± s.e.m.) | 3% EtOH (% ± s.e.m.) | 7% EtOH (% ± s.e.m.) | p-Value | |
---|---|---|---|---|---|
Stages of nucleus | |||||
2 Pronucleus | 0 | 0 | 2.08 ± 2.0 | 5.00 ± 2.23 | 0.098 |
1 Pronuclei | 7.91 ± 2.75 b | 7.69 ± 2.9 b | 19.37 ± 3.5 a | 25.09 ± 2.25 a | 0.006 |
Telophase II | 4.16 ± 2.84 | 4.44 ± 2.93 | 9.12 ± 4.28 | 3.33 ± 3.0 | 0.62 |
Metaphase II + polar body | 65.42 ± 2.00 | 58.73 ± 2.42 | 52.62 ±6.32 | 50.18 ± 3.68 | 0.062 |
Immature | 10.27 ± 3.34 | 11.99 ± 3.91 | 4.16 ± 2.63 | 7.26 ± 2.32 | 0.32 |
Degenerated | 12.21 ± 2.97 | 18.1 ± 1.07 | 15.96 ± 4.05 | 9.12 ± 3.42 | 0.21 |
Total oocytes evaluated | 54 | 53 | 48 | 53 |
Control (% ± s.e.m.) | Ethanol (% ± s.e.m.) | α-50 (% ± s.e.m.) | α-100 (% ± s.e.m.) | α-200 (% ± s.e.m.) | p-Value | |
---|---|---|---|---|---|---|
Nuclear maturation | ||||||
Metaphase II + polar body | 71.66 ± 1.9 | 73.35 ± 3.17 | 71.7 ± 1.08 | 76.49 ± 1.89 | 76.54 ± 1.98 | 0.14 |
Immature | 17.8 ± 2.32 | 20.28 ± 1.5 | 20.89 ± 2.74 | 16.66 ± 0.53 | 18.54 ± 2.01 | 0.63 |
Degenerated | 9.58 ± 2.42 | 7.24 ± 2.4 | 7.46 ± 2.1 | 6.91 ± 1.96 | 5.08 ± 2.48 | 0.27 |
Total oocytes evaluated | 73 | 69 | 67 | 66 | 59 | |
Fertilization rate | ||||||
Total fertilized | 78.55 ± 1.81 | 75.89 ± 1.74 | 77.14 ± 2.79 | 80.58 ± 14 | 73.74 ± 2.77 | 0.25 |
Normal | 60.1 ± 1.79 | 58.1 ± 2.26 | 59 ± 2.8 | 65.51 ± 1.71 | 60.12 ± 3.9 | 0.25 |
Polyspermic | 5.92 ± 2.48 | 4.62 ± 2.34 | 5.27 ± 2 | 0 | 1.78 ± 1.78 | 0.2 |
Asyncronic | 18.45 ± 1.76 | 17.78 ± 1.73 | 18.36 ± 1.58 | 15.06 ± 1.32 | 14.62 ± 3.86 | 0.5 |
Unfertilized | 21.43 ± 1.81 | 24.09 ± 1.74 | 22.84 ± 2.79 | 19.4 ± 1.4 | 26.24 ±2.77 | 0.26 |
Total oocytes evaluated | 71 | 73 | 70 | 66 | 73 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Báez, F.; Gómez, B.; de Brun, V.; Rodríguez-Osorio, N.; Viñoles, C. Effect of Ethanol on Parthenogenetic Activation and α-Tocopherol Supplementation during In Vitro Maturation on Developmental Competence of Summer-Collected Bovine Oocytes. Curr. Issues Mol. Biol. 2021, 43, 2253-2265. https://doi.org/10.3390/cimb43030158
Báez F, Gómez B, de Brun V, Rodríguez-Osorio N, Viñoles C. Effect of Ethanol on Parthenogenetic Activation and α-Tocopherol Supplementation during In Vitro Maturation on Developmental Competence of Summer-Collected Bovine Oocytes. Current Issues in Molecular Biology. 2021; 43(3):2253-2265. https://doi.org/10.3390/cimb43030158
Chicago/Turabian StyleBáez, Francisco, Belén Gómez, Victoria de Brun, Nélida Rodríguez-Osorio, and Carolina Viñoles. 2021. "Effect of Ethanol on Parthenogenetic Activation and α-Tocopherol Supplementation during In Vitro Maturation on Developmental Competence of Summer-Collected Bovine Oocytes" Current Issues in Molecular Biology 43, no. 3: 2253-2265. https://doi.org/10.3390/cimb43030158
APA StyleBáez, F., Gómez, B., de Brun, V., Rodríguez-Osorio, N., & Viñoles, C. (2021). Effect of Ethanol on Parthenogenetic Activation and α-Tocopherol Supplementation during In Vitro Maturation on Developmental Competence of Summer-Collected Bovine Oocytes. Current Issues in Molecular Biology, 43(3), 2253-2265. https://doi.org/10.3390/cimb43030158