Next Article in Journal
Preliminary Data Regarding the Alleviating Effects of Haloperidol and Risperidone on the Short-Term Memory and Associative Learning in a Zebrafish Model of Schizophrenia
Previous Article in Journal
Multi-Kinase Inhibition by New Quinazoline–Isatin Hybrids: Design, Synthesis, Biological Evaluation and Mechanistic Studies
Previous Article in Special Issue
DFT Structural and UV–Vis Spectral Insights into Photosensitivity of Vandetanib: A Dual EGFR/SARS-CoV-2 Mpro Inhibitor
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 18
Issue 10
10.3390/ph18101547
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Direct Targeting of CXCR2 Receptor Inhibits Neuroblastoma Growth: An In Vitro Assessment

by
Rameswari Chilamakuri
,
Deepika Godugu
and
Saurabh Agarwal
*
Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences, St. John’s University, New York, NY 11439, USA
*
Author to whom correspondence should be addressed.
Pharmaceuticals 2025, 18(10), 1547; https://doi.org/10.3390/ph18101547
Submission received: 4 September 2025 / Revised: 2 October 2025 / Accepted: 11 October 2025 / Published: 14 October 2025
(This article belongs to the Special Issue Small Molecules in Targeted Cancer Therapy and Diagnosis)
Browse Figures
Versions Notes

Abstract

Background: This study addresses an important vulnerability in the treatment of high-risk neuroblastoma (NB). NB is characterized by high rates of metastasis, drug resistance, relapse, and treatment-related toxicities. Current treatments, which include intensive chemotherapy, surgical removal of tumors, and stem cell transplants, have less than 50 percent survival rates among high-risk NB patients, demonstrating the need for novel targeted treatment approaches. CXC chemokine receptor 2 (CXCR2), a G-protein-coupled receptor, has been implicated in promoting cancer cell proliferation, invasion, metastasis, angiogenesis, chemoresistance, and maintaining cancer stem cells. Methods: We analyzed transcriptomic data from 1464 primary NB patient samples to evaluate the prognostic significance of CXCR2 expression. Pharmacological inhibition of CXCR2 using SB225002, a selective small-molecule antagonist, was evaluated to determine its effects on cell growth, colony formation, apoptosis, and cell cycle progression in different NB cell lines. Three-dimensional (3D) spheroid models were used to examine tumor growth under physiologically relevant conditions. Mechanistic studies included gene expression analyses and immunoblot validation of key signaling regulators. Results: High CXCR2 expression was found to be inversely correlated with overall survival in patient datasets, suggesting a role in NB pathogenesis. Treatment with SB225002 significantly inhibited NB proliferation and colony formation while inducing apoptosis and cell cycle arrest in a dose-dependent manner. In 3D spheroid models, SB225002 significantly impaired spheroid formation and growth, confirming its potent anti-tumor efficacy. Mechanistically, CXCR2 blockade inhibited the expression of key pathway targets, including GLIPR1, BACH2, JUN, CHEK1, AKT1, and CXCR2 itself. Immunoblot analysis confirmed significant inhibition of CXCR2 and GLIPR1 protein levels in response to SB225002 treatment. Conclusions: Taken together, our findings demonstrate that pharmacological inhibition of CXCR2 using SB225002 effectively inhibits NB tumor cell growth and tumorigenicity by modulating oncogenic signaling networks. This study provides strong evidence for elucidating CXCR2-targeted therapies as an attractive treatment option for NB. These findings support the development of CXCR2-targeted therapies for high-risk NB.

Graphical Abstract

1. Introduction

The development and progression of tumors are significantly influenced by chemokines and their receptors [1]. Chemokines are primarily secreted by immune cells but can also be secreted by non-immune cells, such as vascular endothelial cells. C-X-C chemokine receptor 2 (CXCR2) is a prominent G-protein-seven transmembrane-coupled receptor that binds to a plethora of chemokines such as CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 (IL-8) to trigger its action [1,2]. CXCL3 is the strongest agonist, and CXCL5 is the weakest against the CXCR2 receptor. CXCR1 and CXCR2 are also known as IL-8 RA and IL-8 RB receptors. CXCR1 shares approximately 77% sequence homology with CXCR2, but the differences at the end sequence play an important role in ligand binding specificity [3]. However, CXCR1 expression in primary NB tumors and cell lines is generally lower and more variable compared to CXCR2, which is consistently upregulated in NB and plays a dominant role in recruiting neutrophils and myeloid-derived suppressor cells (MDSCs) to the tumor microenvironment, promoting angiogenesis, inflammation, and tumor progression [4,5].
IL-8 binds to both CXCR1 and CXCR2. Activation of CXCR2 induces dissociation of the G-protein-coupled receptor and releases Gβγ subunits from the Gα subunit. Uncoupled Gβγ subunits activate PLC (phospholipase C) and promote calcium mobilization from the endoplasmic reticulum to the cytosol, which is crucial for neutrophil chemotaxis [1]. PLC further promotes the phosphorylation of p38 and activates the NF-κB pathway. Activation of CXCR2 induces rapid phosphorylation of the ERK1/2 and PI3K/AKT pathways [1].
Aberrant activation of CXCR2 has been reported in multiple cancers, including neuroblastoma (NB), melanoma, colon, breast, ovarian, pancreatic, and prostate cancers [6]. In glioblastoma, the vascular system maintains the cancer stem cells (CSCs) via IL-8/CXCR2 signaling [7]. Increased IL-8 expression not only upregulated the expression of the CXCR2 receptor but also enhanced the migration of CSCs [7]. In esophageal carcinoma and leukemia, high amounts of IL-8 enhanced cell proliferation by dramatically upregulating CXCR2 expression [8,9]. The stroma-derived CCL2-promoted proliferation and CXCL12-mediated invasion were both amplified in PTEN-deficient prostate cancer due to the abnormal activation of the IL-8/CXCR2 signaling pathway [10]. Similarly, IL-8 expression upregulated the proliferation of lung cancer cells via EGFR transactivation [8] and the GAB2-dependent autocrine pathway in ovarian cancer [9]. Gastric cancer metastases are driven by interactions dominated by CXCR2 between tumor cells and macrophages [2]. Therefore, antagonizing the CXCR2 receptor could inhibit the receptor activity, inhibit tumor growth, and increase the sensitivity to chemotherapy [1].
NB is an extracranial solid pediatric tumor that originates from neural crest cells of the parasympathetic nervous system during the early embryonic stage. NB is highly heterogeneous, and this is reflected in patient survival rates. Low- and intermediate-risk NB patients have a >95% overall survival rate, high-risk NB patients have a <50% overall survival rate, and high-risk NB patients have a <50% long-term survival rate [10]. CXCR2 signaling enhances the invasive capacity of NB cells co-cultured with tumor-associated macrophages [11,12], and single-cell transcriptomics revealed that the upregulation of CXCR2 expression promoted NB cell proliferation via myeloid-derived suppressor cells [13].
Various small-molecule inhibitors that target the IL-8/CXCR2 signaling pathway are currently in phase 1/2 clinical trials, including AZD5069 (metastatic castration-resistant prostate cancer; NCT03177187), SX-682 (pancreatic ductal adenocarcinoma; NCT04477343), and MGTA-145 (multiple myeloma; NCT04552743). In the present study, we repurposed a CXCR2 inhibitor, SB225002, in NB. SB225002 [N-(2-hydroxy-4-nitrophenyl)-N′-(2-bromophenyl) urea] is a potent specific non-peptide, small-molecule antagonist of CXCR2 receptor [14], which was first developed for the treatment of inflammatory diseases to regulate neutrophil migration [15]. The anti-cancer activity of SB225002 has been reported in various cancers, including breast [16], ovarian [17], nasopharyngeal [18], esophageal [19], clear-cell renal cell carcinoma (CCRCC) [20], intrahepatic cholangiocellular carcinoma [21], and pancreatic cancer with activated K-Ras [22]. SB225002 has been reported to inhibit microtubule polymerization, angiogenesis, and cell cycle progression, promote mitotic catastrophe, manage acute and chronic pain, and inhibit gamma-secretase [17,23]. In the present study, we aim to evaluate the potential effects of SB225002 on NB in both MYCN-amplified and non-amplified cell lines, which is particularly relevant for high-risk patients. Our data from cell proliferation assays indicate that SB225002 inhibits NB cell growth in both two-dimensional cell culture and three-dimensional spheroid tumor models in a dose-dependent manner by inhibiting cell cycle progression. Additionally, we noted a dose-dependent activation of apoptosis in NB cells and a suppression of CXCR2 pathway genes and proteins following SB225002 treatments. Overall, our results indicate that SB225002 significantly inhibits NB growth and point out a new focused therapeutic approach against NB by targeting the CXCR2 pathway.

2. Results

2.1. CXCR2 Expression Inversely Correlates with NB Patients’ Survival

The role of CXCR2 in NB was examined using 1486 primary NB patient samples from four datasets to establish the link between the CXCR2 gene and overall NB patient outcomes. The Kaplan–Meier survival study showed that CXCR2 gene expression inversely correlates with NB patient survival. Low CXCR2 gene expression was associated with better overall survival in NB patients, while high expression was associated with poor prognosis (Versteeg dataset N = 88, p = 0.118; Kocak dataset N = 649, p = 0.019; RPM dataset N = 498, p = 9.2 × 10−6; Oberthuer dataset N = 251, p = 3.7 × 10−6; Figure 1).
Although the Versteeg dataset did not reach statistical significance, likely due to limited sample size, the consistent and significant associations observed in the three larger cohorts strongly support CXCR2 as a prognostic factor in NB. In contrast, analysis of patient datasets for CXCR1 (Supplementary Figure S1A–D) showed that high CXCR1 expression correlated with improved survival, suggesting it is not a driver of NB progression. Furthermore, CXCR1 transcripts were undetectable in NB cell lines compared to CXCR2 (Supplementary Figure S1E). Collectively, these findings highlight CXCR2 as a key prognostic marker and therapeutic target in NB.

2.2. SB225002 Inhibits NB Cell Proliferation

Additionally, SB225002, a specific small-molecule inhibitor, was used to inhibit the CXCR2 receptor. Control non-cancerous fibroblast cell lines (WI-38) and six NB cell lines, including MYCN-amplified (NGP, LAN-5, IMR-32) and MYCN non-amplified (SH-SY5Y, CHLA-255, SK-N-AS), were used in cell proliferation experiments. In comparison to control fibroblast cell lines, the results showed that SB225002 strongly inhibited NB cell proliferation in both MYCN-amplified and MYCN non-amplified cell lines (Figure 2). For SK-N-AS, the IC50 values are 0.28 µM, while for NGP, they are 5.85 µM (Figure 2A,B). Notably, MYCN-amplified cell lines exhibited higher IC50 values than non-amplified cell lines, which may be attributable to elevated CXCR2 expression.
Additionally, a colony formation assay was used to confirm the anti-proliferative effect of SB225002 in all six NB cell lines. The results demonstrated that SB225002 significantly inhibited NB colony growth compared to controls (Figure 2C,D). Overall, these findings demonstrated that SB225002 effectively suppresses NB cell proliferation when it targets CXC2.

2.3. SB225002 Induces Apoptosis and Blocks Cell Cycle Progression in NB

To ascertain the effects of SB225002, we also conducted apoptosis and cell cycle studies in two NB cell lines, SH-SY5Y (MYCN-non-amplified) and NGP (MYCN-amplified). Our results show that SB225002 treatment significantly and dose-dependently increases the percentage of early apoptotic cells in NGP and SH-SY5Y by approximately 4 and 14 times, respectively, compared to control treatments (Figure 3A,B). Furthermore, SB225002 treatments significantly impede cell cycle progression, according to cell cycle studies conducted in NB cell lines. In SH-SY5Y and NGP cells, cell cycle S phase was shown to be approximately 4.5 and 2.3 times lower than the control, respectively, when CXCR2 was inhibited by SB225002 (Figure 3C,D) Additionally, we found that SB225002 blocked NB cell cycle progression at the G2/M phase, which was evident by about a 5.6-fold increase in the percentage of cells in the G2/M phase in both SH-SY5Y and NGP cells (Figure 3C,D). This data further confirmed the efficacy and cytotoxicity effects of SB225002 by inducing apoptosis and arresting NB cell cycle progression.

2.4. SB225002 Inhibits NB 3D Spheroid Growth

Further, we validated the anti-proliferative activity of SB225002 using two NB 3D spheroid tumor models developed using the SH-SY5Y and NGP cells (Figure 4). Three-dimensional spheroids closely recapitulate the in vivo tumor growth characteristics of solid tumors, including NB. The results from our 3D spheroid tumor studies demonstrate that SB225002 significantly, in a dose-dependent manner, inhibits spheroid tumor growth compared to control treatments in both cell lines (Figure 4A,B,D,E). Additionally, SB225002 significantly inhibits the live cells and increases the dead cells in spheroids, as determined using live (calcein-AM) and dead (EthD-III) cell staining of the terminal day spheroids (Figure 4C,F). Overall, the results of the 3D spheroid studies demonstrate that SB225002 significantly and dose-dependently inhibits NB spheroidal tumor development and growth.

2.5. SB225002 Inhibits the CXCR2 Receptor Pathway

SB225002 is a selective and potent inhibitor of CXCR2 and consequently affects downstream signaling through the CHK1 pathway. To delineate its molecular effects in NB, we performed gene expression and Western blot analyses. RT-qPCR demonstrated that SB225002 dose-dependently suppressed mRNA expression of CXCR2, JUN, GLIPR1, BACH2, AKT1, CHEK1, and P38 genes compared with controls (Figure 5A–G). At the protein level, SB225002 significantly reduced CXCR2 and GLIPR1 expression levels. Interestingly, Western blot analysis revealed a biphasic response, in which CXCR2 and GLIPR1 levels initially decreased but subsequently increased at higher SB225002 concentrations (Figure 5H–J). This pattern may be due to the activation of stress-response pathways at elevated drug concentrations, altered protein stability, or the release of feedback inhibition of upstream regulators.
Collectively, these data demonstrate that SB225002 inhibits CXCR2 at both the transcriptional and protein levels, thereby blocking CXCR2-driven oncogenic signaling and suppressing NB growth.

3. Discussion

CXCR2 is ubiquitously expressed and is important for many different biological functions, including cell motility, cell adhesion, membrane trafficking, actin cytoskeleton reorganizations, and membrane receptor signaling [1]. The expression of CXCR2 is predominantly high in solid tumors, including NB, and is known to control the regulation of the PI3K/AKT, ERK1/2, NF-κB, and JAK/STAT pathways [24,25]. The CXCR2 chemokine signaling axis controls a range of tumorigenic processes, including cancer cell proliferation, invasion, metastases, self-renewal ability, and angiogenesis [2,26]. Inhibition of CXCR2 signaling suppressed the metastatic ability of colorectal, hepatocellular, and breast cancer cells [27,28]. Recent studies emphasize the wide-spectrum anti-tumor potential of SB225002 in multiple cancers by targeting CXCR2. SB225002 specifically decreases cell viability and induces apoptosis and cell cycle arrest (G2/M) in colorectal cancer in stromal cells [29]. In breast cancer, the IL-8/ CXCR2 axis inhibition by SB225002 also proves its high effectiveness in preventing tumor growth and metastasis.
Our findings, consistent with previous reports, demonstrate that SB225002, a selective CXCR2 antagonist, exerts potent anti-tumor activity in NB cell lines and 3D spheroid models, which more closely recapitulate in vivo tumor physiology [26]. SB225002 suppressed proliferation, induced apoptosis, and caused G2/M cell cycle arrest through disruption of key regulators, including CXCR2, PI3K/AKT, CHEK1, P38, and GLIPR1. These results are consistent with studies in colorectal, breast, and cervical cancers, where SB225002 similarly inhibited tumor growth and metastasis via blockade of the IL-8/CXCR2 signaling axis [26,29].
Importantly, the mechanisms of SB225002 may extend beyond CXCR2 inhibition. Recent evidence indicates that SB225002 interferes with microtubule polymerization, which may contribute to its anti-tumor effects and raises the possibility of off-target activity that could influence therapeutic specificity. Nevertheless, CXCR2-driven effects remain central, as CXCR2-knockout mouse models of prostate and renal cancers exhibit comparable tumor suppression [30,31,32]. Furthermore, senescence-induced pancreatic stellate cells secrete CXCL1, CXCL2, and CXCL3, and blockade of the CXCR2 axis suppresses pancreatic cancer cell proliferation [33]. Similarly, SB225002 inhibited cervical cancer cell proliferation and induced apoptosis in a dose-dependent manner by blocking CXCR2–CXCL1 interactions [34]. In addition, SB225002-mediated inhibition of neutrophil recruitment in the NB tumor microenvironment parallels CXCR2-specific effects observed in other tumor types, further reinforcing its targeted action.
SB225002 has been reported to downregulate cholesterol biosynthesis in ALL (acute lymphoblastic leukemia) cells [14]. Transcriptome network analysis exposed that SB225002 induces ALL cell death via the p53 pathway and arrests the ALL cell cycle by activating the GLIPR1 pathway [14]. Conversely, we noted a dose-dependent decrease in GLIPR1 expression upon treatment with SB225002 at both the protein and mRNA levels. We also identified that SB225002 impedes NB cell cycle growth at the G2/M phase by disrupting the PI3K/AKT pathway, the cell cycle regulator CHEK1, and P38. Oncogenic RAS-mediated cellular transformation results in elevated expression of all CXCR2 ligands, significantly contributing to tumorigenesis. Research indicates an interaction between IL-8 and VEGF signaling, which further upregulates BCL2 expression [35]. A combination of SB225002 and temozolomide downregulated the expression of the anti-apoptotic gene, BCL2, to induce apoptosis [36]. Our data show that SB225002 induced apoptosis in NB cell lines in a dose-dependent manner compared to controls by inhibiting multiple CXCR2 pathway genes. SB225002 has been reported to significantly inhibit the HOXC10-mediated colorectal cancer metastasis in combination with anti-PD-L1 therapy [37]. SB225002 increased the efficacy of anti-PD-1 therapy by inhibiting the accumulation of PMN-MDSCs in gastric cancer cells [38]. In contrast, Li et.al. indicated that gastric cancer cell lines with high CXCL17 expression are less sensitive to SB225002 [39]. SB225002 eradicated the formation of the pro-tumor immune microenvironment and blocked the recruitment of neutrophils and macrophages [40].
DNA damage response (DDR) is one of the most traditional anti-cancer mechanisms, with CHK1 playing a critical role in DNA replication stress and DDR [41]. Dysregulation of cell-cycle-regulatory genes, such as CHK1, has been reported in multiple cancers, including NB [42]. SB225002 inhibited the expression of CHK1 in a dose-dependent manner in ovarian cancer cells [43], and we observed similar results in NB. SB225002 reduced the invasion ability of prostate cancer cells by inhibiting the expression of BSP, OPN, and MMP-2 proteins [44]. In contrast, the CXCR2 axis facilitates integrin-dependent peritoneal metastasis of colon cancer cells [45]. The CXCR2 axis has been reported to induce angiogenesis in liver cancer mouse models via IL-17A [46]. Nevertheless, the CXCL5-CXCR2 signaling pathway has been reported to promote tumor metastasis by interacting with lymphatic endothelial cells and head-and-neck malignancies. The activation of p38 by epithelial–stromal communication of the CXCL1-CXCR2 interaction restored the proliferation of ovarian cancer cells [47]. Our data show that SB225002 significantly inhibited the expression of p38 in NB cells.
Recent reviews also suggest that CXCR2 is a central regulator of both cancer progression and inflammation, and CXCR2 antagonists such as SB225002 showed potential as therapeutic agents due to their capacity to prevent myeloid-derived suppressor cell (MDSC) recruitment and facilitate immune responses in prostate, hepatocellular, lung, and thyroid cancers in preclinical studies [48]. In the microenvironment of neuroblastoma, the CXCL2/CXCR2 axis enhances the invasiveness of the tumor via the macrophage-derived signal, justifying the rationale of targeting CXCR2 in NB [49]. Furthermore, in tumor-associated neutrophils (TANs), CXCR2 mediates recruitment and protumor polarization, as N2 and SB225002 can have anti-tumor activity by inhibiting N2 TAN accumulation and enhance radiotherapy in nasopharyngeal carcinoma and synergizing with cisplatin in lung carcinomas [50]. The CXCL2/CXCR2 axis also plays a role in immune evasion and resistance to therapy in different types of cancer, where SB225002 suppresses recruiting neutrophils and tumor growth under stress in hepatocellular carcinoma models [51]. Current understanding supports the therapeutic flexibility of SB2250002 in interfering with CXCR2-induced oncogenic multiple pathways.
In conclusion, various studies have confirmed that SB225002 exhibits anti-tumor activity by antagonizing IL-8 binding to CXCR2 receptors. Our findings demonstrate an inverse correlation between CXCR2 levels and the overall outcomes of NB patients. SB225002 substantially suppressed the proliferation of NB cells in a dose-dependent manner by inducing apoptosis and obstructing the progression of the NB cell cycle at the G2/M phase. Our research emphasizes that SB225002 may serve as a novel therapeutic strategy for NB by directly targeting the CXCR2 receptor. To further explore efficient therapeutic strategies for NB patients, we will integrate SB225002 with existing therapies in future endeavors.

4. Materials and Methods

4.1. Cell Culture and Patient Dataset

The following cell lines were investigated: human NB cell lines NGP, LAN-5, IMR-32, SH-SY5Y, SK-N-AS, and CHLA-255, as well as WI-38, a non-cancerous fibroblast control cell line, and all of them were cultured and passaged as previously outlined [25]. MedChem Express, Monmouth Junction, NJ, USA, provided SB225002. The control groups for this study were treated with DMSO unless otherwise declared.

4.2. Clinical Patient Dataset

We analyzed a total of 1486 primary NB patient samples from four different NB patient datasets using R2: Genomic Analysis and Visualization Platform (https://hgserver1.amc.nl/cgi-bin/r2/main.cgi, accessed on 23 September 2024). This platform is publicly available and supports multiparametric analysis of NB patients with microarray profiles and gene expression data.

4.3. Cell Proliferation and 3D Spheroid Assays

NB cell proliferation assays and colony formation assays in response to SB225002 treatments were performed as described previously [52,53]. Cell proliferation assays were performed using MTT cell proliferation dye (L11939; Alfa Aesar, Ward Hill, MA, USA). NB 3D spheroids for SH-SY5Y and NGP cell lines were developed as described previously [52]. Spheroids were randomized and treated with increasing concentrations of SB225002 for 12 days. Images were taken every third day to analyze the spheroid size using the Leica DMi1 microscope and LASX version 3.10 software suite tools (Leica Microsystems, Buffalo Grove, IL, USA).

4.4. Apoptosis and Cell Cycle Assay:

An Annexin V-FITC Apoptosis Detection Kit was used to assess the apoptosis of NB cells after 24 h of treatment with SB225002 (ThermoFisher Scientific, Waltham, MA, USA), as described previously [54]. Similarly, NB cell cycle analysis in response to SB225002 treatment for 24 h was performed using a Click-iT Plus EdU Alexa Fluor 488 Flow Cytometry Assay Kit (ThermoFisher Scientific), according to manufacturer’s instructions and as described previously [54]. Flow cytometry data was analyzed using the Flow Jo software version 10 (BD Biosciences, Franklin Lakes, NJ, USA).

4.5. Gene Expression and Immunoblotting Assays

RT-qPCR was used to analyze gene expression in SH-SY5Y cells after 24 h of SB225002 treatment, as previously described [52,53,54]. SYBR Green dye and the Quant Studio 3 Real-Time PCR System (ThermoFisher Scientific) were utilized, with GAPDH as a housekeeping gene. The reactions were carried out in triplicate and repeated three times. The RT-qPCR primers used in this investigation are shown in Table 1.
Immuno-blotting analysis, as described previously [52], was performed on SH-SY5Y cells after treatment with SB225002 for 24 h. Clarity ECL Western substrate (Bio-Rad, Hercules, CA, USA) was used to develop and visualize the blots. The immunoblots were visualized and documented using the ChemiDoc XRS Plus system (Bio-Rad). Cyclophilin B was used as a loading control, and densitometric analysis was performed using the ImageJ software version 1.54g. Antibodies used in the present study were anti-CXCR2 (A2889) and anti-GLIPR1 (A16490), purchased from ABclonal Technology, Woburn, MA, USA, and anti-cyclophilin B (43603S) and anti-rabbit IgG HRP-linked secondary antibody (7074S) from Cell Signaling Technology (Danvers, MA, USA).

4.6. Statistical Analysis

Results are reported as mean ± standard error of replicates unless otherwise stated. Unless otherwise indicated, all experiments were conducted with a minimum of three biological replicates, and each measurement was derived from at least three technical replicates. Data was normalized and graphed using control treatment groups. GraphPad Prism 9 calculated IC50 values and statistically analyzed the data. The drug treatment groups’ statistical significance was determined by Student’s two-tailed t-test.

5. Conclusions

This study identifies SB225002 as a promising therapeutic candidate for NB, demonstrating efficacy in both conventional cell lines and 3D spheroid models that better recapitulate the in vivo tumor architecture. By selectively inhibiting CXCR2 signaling, SB225002 suppressed NB cell proliferation, induced apoptosis, and caused G2/M cell cycle arrest in a dose-dependent manner. These findings highlight the dual impact of SB225002 on intrinsic oncogenic signaling and extrinsic tumor-supportive processes, underscoring its potential as a stand-alone therapy or in rational combinations with other drugs. Future studies should focus on validating the effects of SB225002 in preclinical in vivo models, exploring pharmacological properties, and assessing synergy with targeted or immunomodulatory therapies. Overall, this work advances our understanding of CXCR2-targeted strategies and provides a strong rationale for the translational development of SB225002 to improve outcomes in NB and other CXCR2-driven malignancies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ph18101547/s1, Figure S1: CXCR1 expression strongly correlates with poor survival of NB patients.

Author Contributions

R.C.: Methodology, validation, investigation, writing—original draft, methodology, investigation. D.G.: Validation, investigation, review and editing. S.A.: Conceptualization, methodology, investigation, review and editing, visualization, supervision, project administration, funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

Saurabh Agarwal received a Scholar Career Development Award from the St. Baldrick’s Foundation and seed grants from St. John’s University to support this study. Rameswari Chilamakuri received financial assistance through the St. John’s University Teaching Fellowship.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors gratefully acknowledge the Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences at St. John’s University for supporting this study and providing fellowship funding.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Korbecki, J.; Kupnicka, P.; Chlubek, M.; Goracy, J.; Gutowska, I.; Baranowska-Bosiacka, I. CXCR2 Receptor: Regulation of Expression, Signal Transduction, and Involvement in Cancer. Int. J. Mol. Sci. 2022, 23, 2168. [Google Scholar] [CrossRef] [PubMed]
  2. Liu, Q.; Li, A.; Tian, Y.; Wu, J.D.; Liu, Y.; Li, T.; Chen, Y.; Han, X.; Wu, K. The CXCL8-CXCR1/2 pathways in cancer. Cytokine Growth Factor Rev. 2016, 31, 61–71. [Google Scholar] [CrossRef] [PubMed]
  3. Capucetti, A.; Albano, F.; Bonecchi, R. Multiple Roles for Chemokines in Neutrophil Biology. Front. Immunol. 2020, 11, 1259. [Google Scholar] [CrossRef] [PubMed]
  4. Safarulla, S.; Madan, A.; Xing, F.; Chandrasekaran, A. CXCR2 Mediates Distinct Neutrophil Behavior in Brain Metastatic Breast Tumor. Cancers 2022, 14, 515. [Google Scholar] [CrossRef]
  5. Sawant, K.V.; Sepuru, K.M.; Lowry, E.; Penaranda, B.; Frevert, C.W.; Garofalo, R.P.; Rajarathnam, K. Neutrophil recruitment by chemokines Cxcl1/KC and Cxcl2/MIP2: Role of Cxcr2 activation and glycosaminoglycan interactions. J. Leukoc. Biol. 2021, 109, 777–791. [Google Scholar] [CrossRef]
  6. Hou, R.; Yu, Y.; Sluter, M.N.; Li, L.; Hao, J.; Fang, J.; Yang, J.; Jiang, J. Targeting EP2 receptor with multifaceted mechanisms for high-risk neuroblastoma. Cell Rep. 2022, 39, 111000. [Google Scholar] [CrossRef]
  7. Brat, D.J.; Bellail, A.C.; Van Meir, E.G. The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 2005, 7, 122–133. [Google Scholar] [CrossRef]
  8. Luppi, F.; Longo, A.M.; de Boer, W.I.; Rabe, K.F.; Hiemstra, P.S. Interleukin-8 stimulates cell proliferation in non-small cell lung cancer through epidermal growth factor receptor transactivation. Lung Cancer 2007, 56, 25–33. [Google Scholar] [CrossRef]
  9. Duckworth, C.; Zhang, L.; Carroll, S.L.; Ethier, S.P.; Cheung, H.W. Overexpression of GAB2 in ovarian cancer cells promotes tumor growth and angiogenesis by upregulating chemokine expression. Oncogene 2016, 35, 4036–4047. [Google Scholar] [CrossRef]
  10. PDQ Pediatric Treatment Editorial Board. Neuroblastoma Treatment (PDQ®): Health Professional Version. In PDQ Cancer Information Summaries; National Cancer Institute: Bethesda, MD, USA, 2002. [Google Scholar] [PubMed]
  11. Hashimoto, O.; Yoshida, M.; Koma, Y.; Yanai, T.; Hasegawa, D.; Kosaka, Y.; Nishimura, N.; Yokozaki, H. Collaboration of cancer-associated fibroblasts and tumour-associated macrophages for neuroblastoma development. J. Pathol. 2016, 240, 211–223. [Google Scholar] [CrossRef]
  12. Liu, K.X.; Joshi, S. “Re-educating” Tumor Associated Macrophages as a Novel Immunotherapy Strategy for Neuroblastoma. Front. Immunol. 2020, 11, 1947. [Google Scholar] [CrossRef] [PubMed]
  13. Costa, A.; Thirant, C.; Kramdi, A.; Pierre-Eugene, C.; Louis-Brennetot, C.; Blanchard, O.; Surdez, D.; Gruel, N.; Lapouble, E.; Pierron, G.; et al. Single-cell transcriptomics reveals shared immunosuppressive landscapes of mouse and human neuroblastoma. J. Immunother. Cancer 2022, 10, e004807. [Google Scholar] [CrossRef] [PubMed]
  14. de Vasconcellos, J.F.; Laranjeira, A.B.; Leal, P.C.; Bhasin, M.K.; Zenatti, P.P.; Nunes, R.J.; Yunes, R.A.; Nowill, A.E.; Libermann, T.A.; Zerbini, L.F.; et al. SB225002 Induces Cell Death and Cell Cycle Arrest in Acute Lymphoblastic Leukemia Cells through the Activation of GLIPR1. PLoS ONE 2015, 10, e0134783. [Google Scholar] [CrossRef] [PubMed]
  15. White, J.R.; Lee, J.M.; Young, P.R.; Hertzberg, R.P.; Jurewicz, A.J.; Chaikin, M.A.; Widdowson, K.; Foley, J.J.; Martin, L.D.; Griswold, D.E.; et al. Identification of a potent, selective non-peptide CXCR2 antagonist that inhibits interleukin-8-induced neutrophil migration. J. Biol. Chem. 1998, 273, 10095–10098. [Google Scholar] [CrossRef]
  16. Yu, M.; Berk, R.; Kosir, M.A. CXCL7-Mediated Stimulation of Lymphangiogenic Factors VEGF-C, VEGF-D in Human Breast Cancer Cells. J. Oncol. 2010, 2010, 939407. [Google Scholar] [CrossRef]
  17. Du, M.; Qiu, Q.; Gruslin, A.; Gordon, J.; He, M.; Chan, C.C.; Li, D.; Tsang, B.K. SB225002 promotes mitotic catastrophe in chemo-sensitive and -resistant ovarian cancer cells independent of p53 status in vitro. PLoS ONE 2013, 8, e54572. [Google Scholar] [CrossRef]
  18. Lo, M.C.; Yip, T.C.; Ngan, K.C.; Cheng, W.W.; Law, C.K.; Chan, P.S.; Chan, K.C.; Wong, C.K.; Wong, R.N.; Lo, K.W.; et al. Role of MIF/CXCL8/CXCR2 signaling in the growth of nasopharyngeal carcinoma tumor spheres. Cancer Lett. 2013, 335, 81–92. [Google Scholar] [CrossRef]
  19. Wang, B.; Hendricks, D.T.; Wamunyokoli, F.; Parker, M.I. A growth-related oncogene/CXC chemokine receptor 2 autocrine loop contributes to cellular proliferation in esophageal cancer. Cancer Res. 2006, 66, 3071–3077. [Google Scholar] [CrossRef]
  20. Grepin, R.; Guyot, M.; Giuliano, S.; Boncompagni, M.; Ambrosetti, D.; Chamorey, E.; Scoazec, J.Y.; Negrier, S.; Simonnet, H.; Pages, G. The CXCL7/CXCR1/2 axis is a key driver in the growth of clear cell renal cell carcinoma. Cancer Res. 2014, 74, 873–883. [Google Scholar] [CrossRef]
  21. Sueoka, H.; Hirano, T.; Uda, Y.; Iimuro, Y.; Yamanaka, J.; Fujimoto, J. Blockage of CXCR2 suppresses tumor growth of intrahepatic cholangiocellular carcinoma. Surgery 2014, 155, 640–649. [Google Scholar] [CrossRef]
  22. Matsuo, Y.; Campbell, P.M.; Brekken, R.A.; Sung, B.; Ouellette, M.M.; Fleming, J.B.; Aggarwal, B.B.; Der, C.J.; Guha, S. K-Ras promotes angiogenesis mediated by immortalized human pancreatic epithelial cells through mitogen-activated protein kinase signaling pathways. Mol. Cancer Res. 2009, 7, 799–808. [Google Scholar] [CrossRef]
  23. Bakshi, P.; Jin, C.; Broutin, P.; Berhane, B.; Reed, J.; Mullan, M. Structural optimization of a CXCR2-directed antagonist that indirectly inhibits gamma-secretase and reduces Abeta. Bioorg. Med. Chem. 2009, 17, 8102–8112. [Google Scholar] [CrossRef]
  24. Zhou, Z.; Xia, G.; Xiang, Z.; Liu, M.; Wei, Z.; Yan, J.; Chen, W.; Zhu, J.; Awasthi, N.; Sun, X.; et al. A C-X-C Chemokine Receptor Type 2-Dominated Cross-talk between Tumor Cells and Macrophages Drives Gastric Cancer Metastasis. Clin. Cancer Res. 2019, 25, 3317–3328. [Google Scholar] [CrossRef]
  25. Dong, Y.L.; Kabir, S.M.; Lee, E.S.; Son, D.S. CXCR2-driven ovarian cancer progression involves upregulation of proinflammatory chemokines by potentiating NF-κB activation via EGFR-transactivated Akt signaling. PLoS ONE 2013, 8, e83789. [Google Scholar] [CrossRef]
  26. Jeong, Y.; Yoon, S.Y.; Jung, S.P.; Nam, S.J.; Lee, J.E.; Kim, S. Inhibition of Interleukin-8/C-X-C Chemokine Receptor 2 Signaling Axis Prevents Tumor Growth and Metastasis in Triple-Negative Breast Cancer Cells. Pharmacology 2025, 110, 178–190. [Google Scholar] [CrossRef]
  27. Erin, N.; Nizam, E.; Tanriover, G.; Koksoy, S. Autocrine control of MIP-2 secretion from metastatic breast cancer cells is mediated by CXCR2: A mechanism for possible resistance to CXCR2 antagonists. Breast Cancer Res. Treat. 2015, 150, 57–69. [Google Scholar] [CrossRef]
  28. Song, X.; Wang, Z.; Jin, Y.; Wang, Y.; Duan, W. Loss of miR-532-5p in vitro promotes cell proliferation and metastasis by influencing CXCL2 expression in HCC. Am. J. Transl. Res. 2015, 7, 2254–2261. [Google Scholar] [PubMed]
  29. Bazzichetto, C.; Di Martile, M.; Del Bufalo, D.; Milella, M.; Conciatori, F. Induction of cell death by the CXCR2 antagonist SB225002 in colorectal cancer and stromal cells. Biomed. Pharmacother. 2025, 188, 118203. [Google Scholar] [CrossRef] [PubMed]
  30. Li, Y.; He, Y.; Butler, W.; Xu, L.; Chang, Y.; Lei, K.; Zhang, H.; Zhou, Y.; Gao, A.C.; Zhang, Q.; et al. Targeting cellular heterogeneity with CXCR2 blockade for the treatment of therapy-resistant prostate cancer. Sci. Transl. Med. 2019, 11, eaax0428. [Google Scholar] [CrossRef] [PubMed]
  31. Mestas, J.; Burdick, M.D.; Reckamp, K.; Pantuck, A.; Figlin, R.A.; Strieter, R.M. The role of CXCR2/CXCR2 ligand biological axis in renal cell carcinoma. J. Immunol. 2005, 175, 5351–5357. [Google Scholar] [CrossRef]
  32. Stofas, A.; Levidou, G.; Piperi, C.; Adamopoulos, C.; Dalagiorgou, G.; Bamias, A.; Karadimou, A.; Lainakis, G.A.; Papadoukakis, S.; Stravodimos, K.; et al. The role of CXC-chemokine receptor CXCR2 and suppressor of cytokine signaling-3 (SOCS-3) in renal cell carcinoma. BMC Cancer 2014, 14, 149. [Google Scholar] [CrossRef]
  33. Takikawa, T.; Hamada, S.; Matsumoto, R.; Tanaka, Y.; Kataoka, F.; Sasaki, A.; Masamune, A. Senescent Human Pancreatic Stellate Cells Secrete CXCR2 Agonist CXCLs to Promote Proliferation and Migration of Human Pancreatic Cancer AsPC-1 and MIAPaCa-2 Cell Lines. Int. J. Mol. Sci. 2022, 23, 9275. [Google Scholar] [CrossRef]
  34. Sun, J.; Yuan, J. Chemokine (C-X-C motif) ligand 1/chemokine (C-X-C motif) receptor 2 autocrine loop contributes to cellular proliferation, migration and apoptosis in cervical cancer. Bioengineered 2022, 13, 7579–7591. [Google Scholar] [CrossRef]
  35. Yu, L.; Zhou, G.; Shi, Z.; Guo, J.; Yu, S.; Yu, C.; Shen, C. Interleukin-8 Regulates the Autophagy and Apoptosis in Gastric Cancer Cells via Regulating PI3K/Akt Signaling Pathway. Dis. Markers 2022, 2022, 7300987. [Google Scholar] [CrossRef] [PubMed]
  36. Urbantat, R.M.; Jelgersma, C.; Vajkoczy, P.; Brandenburg, S.; Acker, G. Combining TMZ and SB225002 induces changes of CXCR2 and VEGFR signalling in primary human endothelial cells in vitro. Oncol. Rep. 2022, 48, 158. [Google Scholar] [CrossRef] [PubMed]
  37. Yu, J.; Chen, X.; Zhao, S.; Jing, J.; Wang, Q.; Dang, Y. HOXC10 Promotes Metastasis in Colorectal Cancer by Recruiting Myeloid-derived Suppressor Cells. J. Cancer 2022, 13, 3308–3317. [Google Scholar] [CrossRef] [PubMed]
  38. Zhou, X.; Fang, D.; Liu, H.; Ou, X.; Zhang, C.; Zhao, Z.; Zhao, S.; Peng, J.; Cai, S.; He, Y.; et al. PMN-MDSCs accumulation induced by CXCL1 promotes CD8+ T cells exhaustion in gastric cancer. Cancer Lett. 2022, 532, 215598. [Google Scholar] [CrossRef]
  39. Li, Y.; Liu, A.; Liu, S.; Yan, L.; Yuan, Y.; Xu, Q. Involvement of CXCL17 and GPR35 in Gastric Cancer Initiation and Progression. Int. J. Mol. Sci. 2022, 24, 615. [Google Scholar] [CrossRef]
  40. Wang, X.; Chen, Y.; Lan, B.; Wang, Y.; Lin, W.; Jiang, X.; Ye, J.; Shang, B.; Feng, C.; Liu, J.; et al. Heterogeneity of tyrosine-based melanin anabolism regulates pulmonary and cerebral organotropic colonization microenvironment of melanoma cells. Theranostics 2022, 12, 2063–2079. [Google Scholar] [CrossRef]
  41. Sun, B.; Ross, S.M.; Rowley, S.; Adeleye, Y.; Clewell, R.A. Contribution of ATM and ATR kinase pathways to p53-mediated response in etoposide and methyl methanesulfonate induced DNA damage. Environ. Mol. Mutagen. 2017, 58, 72–83. [Google Scholar] [CrossRef]
  42. Liu, Z.; Rader, J.; He, S.; Phung, T.; Thiele, C.J. CASZ1 inhibits cell cycle progression in neuroblastoma by restoring pRb activity. Cell Cycle 2013, 12, 2210–2218. [Google Scholar] [CrossRef]
  43. Nie, S.; Wan, Y.; Wang, H.; Liu, J.; Yang, J.; Sun, R.; Meng, H.; Ma, X.; Jiang, Y.; Cheng, W. CXCL2-mediated ATR/CHK1 signaling pathway and platinum resistance in epithelial ovarian cancer. J. Ovarian Res. 2021, 14, 115. [Google Scholar] [CrossRef]
  44. Xu, M.; Jiang, H.; Wang, H.; Liu, J.; Liu, B.; Guo, Z. SB225002 inhibits prostate cancer invasion and attenuates the expression of BSP, OPN and MMP-2. Oncol. Rep. 2018, 40, 726–736. [Google Scholar] [CrossRef] [PubMed]
  45. Lepsenyi, M.; Algethami, N.; Al-Haidari, A.A.; Algaber, A.; Syk, I.; Rahman, M.; Thorlacius, H. CXCL2-CXCR2 axis mediates alphaV integrin-dependent peritoneal metastasis of colon cancer cells. Clin. Exp. Metastasis 2021, 38, 401–410. [Google Scholar] [CrossRef] [PubMed]
  46. Liu, L.; Sun, H.; Wu, S.; Tan, H.; Sun, Y.; Liu, X.; Si, S.; Xu, L.; Huang, J.; Zhou, W.; et al. IL-17A promotes CXCR2-dependent angiogenesis in a mouse model of liver cancer. Mol. Med. Rep. 2019, 20, 1065–1074. [Google Scholar] [CrossRef] [PubMed]
  47. Park, G.Y.; Pathak, H.B.; Godwin, A.K.; Kwon, Y. Epithelial-stromal communication via CXCL1-CXCR2 interaction stimulates growth of ovarian cancer cells through p38 activation. Cell. Oncol. 2021, 44, 77–92. [Google Scholar] [CrossRef]
  48. Lazennec, G.; Rajarathnam, K.; Richmond, A. CXCR2 chemokine receptor—A master regulator in cancer and physiology. Trends Mol. Med. 2024, 30, 37–55. [Google Scholar] [CrossRef]
  49. Stip, M.C.; Teeuwen, L.; Dierselhuis, M.P.; Leusen, J.H.W.; Krijgsman, D. Targeting the myeloid microenvironment in neuroblastoma. J. Exp. Clin. Cancer Res. 2023, 42, 337. [Google Scholar] [CrossRef]
  50. Zhou, Y.; Shen, G.; Zhou, X.; Li, J. Therapeutic potential of tumor-associated neutrophils: Dual role and phenotypic plasticity. Signal Transduct. Target. Ther. 2025, 10, 178. [Google Scholar] [CrossRef]
  51. Lv, Y.; Chen, C.; Han, M.; Tian, C.; Song, F.; Feng, S.; Xu, M.; Zhao, Z.; Zhou, H.; Su, W.; et al. CXCL2: A key player in the tumor microenvironment and inflammatory diseases. Cancer Cell Int. 2025, 25, 133. [Google Scholar] [CrossRef]
  52. Chilamakuri, R.; Rouse, D.C.; Yu, Y.; Kabir, A.S.; Muth, A.; Yang, J.; Lipton, J.M.; Agarwal, S. BX-795 inhibits neuroblastoma growth and enhances sensitivity towards chemotherapy. Transl. Oncol. 2022, 15, 101272. [Google Scholar] [CrossRef]
  53. Chilamakuri, R.; Rouse, D.C.; Agarwal, S. Inhibition of Polo-like Kinase 1 by HMN-214 Blocks Cell Cycle Progression and Inhibits Neuroblastoma Growth. Pharmaceuticals 2022, 15, 523. [Google Scholar] [CrossRef]
  54. Chilamakuri, R.; Agarwal, S. Direct Targeting of the Raf-MEK-ERK Signaling Cascade Inhibits Neuroblastoma Growth. Curr. Oncol. 2022, 29, 6508–6522. [Google Scholar] [CrossRef]
Pharmaceuticals 18 01547 g001
Figure 1. Poor NB patient survival is highly correlated with CXCR2 expression. The CXCR2 gene’s Kaplan–Meier survival analysis indicates a poor overall probability of survival for NB patients. (A) Versteeg, (B) Kocak, (C) RPM, and (D) Oberthuer datasets.
Figure 1. Poor NB patient survival is highly correlated with CXCR2 expression. The CXCR2 gene’s Kaplan–Meier survival analysis indicates a poor overall probability of survival for NB patients. (A) Versteeg, (B) Kocak, (C) RPM, and (D) Oberthuer datasets.
Pharmaceuticals 18 01547 g001
Pharmaceuticals 18 01547 g002
Figure 2. NB cell lines in response to different concentrations of SB225002. (A,B) Cell proliferation assays in (A) MYCN-non-amplified and (B) MYCN-amplified cell lines. (C,D) Colony formation assays, and their quantitative data represent relative inhibition of colony formation. * p < 0.05, ** p < 0.01, and *** p < 0.001.
Figure 2. NB cell lines in response to different concentrations of SB225002. (A,B) Cell proliferation assays in (A) MYCN-non-amplified and (B) MYCN-amplified cell lines. (C,D) Colony formation assays, and their quantitative data represent relative inhibition of colony formation. * p < 0.05, ** p < 0.01, and *** p < 0.001.
Pharmaceuticals 18 01547 g002
Pharmaceuticals 18 01547 g003
Figure 3. SB225002 induces apoptosis (A,B) and blocks NB cell cycle progression (C,D) in both MYCN non-amplified cell line SH-SY5Y and MYCN-amplified cell line NGP, in dose-dependent manner. * p < 0.05, ** p < 0.01.
Figure 3. SB225002 induces apoptosis (A,B) and blocks NB cell cycle progression (C,D) in both MYCN non-amplified cell line SH-SY5Y and MYCN-amplified cell line NGP, in dose-dependent manner. * p < 0.05, ** p < 0.01.
Pharmaceuticals 18 01547 g003
Pharmaceuticals 18 01547 g004
Figure 4. SB225002 inhibits NB 3D spheroid tumor growth in (A–C) SH-SY5Y and (D–F) NGP cells. (C,F) Calcein AM (green; live cells) and EthD-III (red; dead cells) fluorescence dyes were used to stain spheroids on the terminal day. Scale bar: (A,C,D,F) 750 μm. * p < 0.05, ** p < 0.01, and *** p < 0.001.
Figure 4. SB225002 inhibits NB 3D spheroid tumor growth in (A–C) SH-SY5Y and (D–F) NGP cells. (C,F) Calcein AM (green; live cells) and EthD-III (red; dead cells) fluorescence dyes were used to stain spheroids on the terminal day. Scale bar: (A,C,D,F) 750 μm. * p < 0.05, ** p < 0.01, and *** p < 0.001.
Pharmaceuticals 18 01547 g004
Pharmaceuticals 18 01547 g005
Figure 5. SB225002 antagonizes the CXCR2 receptor. (A–G) Gene expression analysis of CXCR2 receptor and downstream signaling pathways in response to SB225002. (H–J) Immuno-blot analysis of CXCR2 and GLIPR1 in response to SB225002 and corresponding densitometric analysis. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 5. SB225002 antagonizes the CXCR2 receptor. (A–G) Gene expression analysis of CXCR2 receptor and downstream signaling pathways in response to SB225002. (H–J) Immuno-blot analysis of CXCR2 and GLIPR1 in response to SB225002 and corresponding densitometric analysis. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Pharmaceuticals 18 01547 g005
Table 1. RT-qPCR primers used in the study.
Table 1. RT-qPCR primers used in the study.
S.No.Gene Forward Primer (5′-3′)Reverse Primer (5′-3′)
1CXCR2CTCCAATAACAGCAGGTCACGGCTCAGCAGGAATACCA
2JUNCCCCAAGATCCTGAAACAGACCGTTGCTGGACTGGATTAT
3GLIPR1AGCTGCACCCAAACTTCACTATCTGCCCAAACAACCTGAG
4BACH2GAAAACGATGCTGCCATTTTTTGGTGCACACTTCTGCTTC
5CHEK1GACTGGGACTTGGTGCAAACTGCCATGAGTTGATGGAAGA
6P38CGCAAGGTCACTGGAGGAATCTGGGCTTTAGGTCCCTGTG
7AKT1GCACAAACGAGGGGAGTACAAAGGTGCGTTCGATGACAGT
8GAPDHCACCATCTTCCAGGAGCGAGTGATGACCCTTTTGGCTCCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chilamakuri, R.; Godugu, D.; Agarwal, S. Direct Targeting of CXCR2 Receptor Inhibits Neuroblastoma Growth: An In Vitro Assessment. Pharmaceuticals 2025, 18, 1547. https://doi.org/10.3390/ph18101547

AMA Style

Chilamakuri R, Godugu D, Agarwal S. Direct Targeting of CXCR2 Receptor Inhibits Neuroblastoma Growth: An In Vitro Assessment. Pharmaceuticals. 2025; 18(10):1547. https://doi.org/10.3390/ph18101547

Chicago/Turabian Style

Chilamakuri, Rameswari, Deepika Godugu, and Saurabh Agarwal. 2025. "Direct Targeting of CXCR2 Receptor Inhibits Neuroblastoma Growth: An In Vitro Assessment" Pharmaceuticals 18, no. 10: 1547. https://doi.org/10.3390/ph18101547

APA Style

Chilamakuri, R., Godugu, D., & Agarwal, S. (2025). Direct Targeting of CXCR2 Receptor Inhibits Neuroblastoma Growth: An In Vitro Assessment. Pharmaceuticals, 18(10), 1547. https://doi.org/10.3390/ph18101547

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop