Next Article in Journal
Pharmacovigilance in Vaccines: Importance, Main Aspects, Perspectives, and Challenges—A Narrative Review
Previous Article in Journal
The Effectiveness of a Dietary Supplement with Honey, Propolis, Pelargonium sidoides Extract, and Zinc in Children Affected by Acute Tonsillopharyngitis: An Open, Randomized, and Controlled Trial
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 17
Issue 6
10.3390/ph17060806
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Potential Molecular Mechanism of Illicium simonsii Maxim Petroleum Ether Fraction in the Treatment of Hepatocellular Carcinoma

by
Sihua Zou
1,†,
Yanchun Wu
2,3,†,
Meiqi Wen
2,
Jiao Liu
1,
Minghui Chen
1,
Jingquan Yuan
2,* and
Bei Zhou
1,3,*
1
School of Pharmacy, Guangxi University of Chinese Medicine, Nanning 530200, China
2
Guangxi Scientific Research Centre of Traditional Chinese Medicine, Guangxi University of Chinese Medicine, Nanning 530200, China
3
Guangxi Key Laboratory of Efficacy Study on Chinese Materia Medica, Nanning 530200, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pharmaceuticals 2024, 17(6), 806; https://doi.org/10.3390/ph17060806
Submission received: 19 May 2024 / Revised: 11 June 2024 / Accepted: 14 June 2024 / Published: 19 June 2024
(This article belongs to the Section Natural Products)
Browse Figures
Review Reports Versions Notes

Abstract

:
Traditional Chinese medicine (TCM) has been considered, for many years, an important source of medicine to treat different diseases. As a type of TCM, Illicium simonsii Maxim (ISM) is used as an anti-inflammatory, anti-bacterial, and anti-virus. Besides, ISM is also used in the treatment of cancer. In order to evaluate the anti-hepatocellular carcinoma (HCC) activity, petroleum ether extract was prepared from part of the fruit of ISM. First, the compounds of the petroleum ether fraction of Illicium simonsii Maxim (PEIM) were identified using LC-MS/MS analysis. Next, the cell viability and morphological changes were evaluated by MTT assay and Hoechst staining. In addition, the effect of PEIM on the levels of inflammatory factors (TNF-α, IL-1β, and IL-6) was determined using the ELISA kit. Furthermore, apoptosis was evaluated by flow cytometry, and gene expression and the regulation of signaling pathways were investigated, respectively, by real-time fluorescence quantitative PCR (RT-qPCR) and western blot. Results showed that a total of 64 compounds were identified in the PEIM. Additionally, the PEIM had anti-HCC activity against HepG2 cells, in which the half maximal inhibitory concentration (IC50) was 55.03 μg·mL−1. As well, the PEIM was able to modulate the expression of TNF-α, IL-1β, and IL-6, while we also found that it induced HepG2 cell apoptosis through the activation of P53 mRNA and caspase-3 mRNA. Finally, the PEIM possibly downregulated the expression of TLR4, MyD88, p-NF-κBp65, TNF-α, IL-1β, INOS, IL-6, JAK2, STAT3, CyclinD1, CDK4, MDM2, and Bcl-2, and upregulated the expression of P53, P21, Bax, Cytochrome-C, Caspase-9, and Caspase-3 in HepG2 cells. These findings may confirm that the PEIM has possible anti-HCC effects. However, additional studies are required to fully understand the mechanisms of action of the PEIM and the signaling pathways involved in its effects. Moreover, the anti-HCC activity of the PEIM should be studied in vivo, and signaling pathways involved in its effects should be explored to develop the anti-HCC drug.

1. Introduction

HCC, an aggressive malignant disease, is commonly known as the king of cancer and one of the most common malignant tumors in the clinic, and the 5-year survival rate is only 18% in the United States (USA), while it is only 12% in China [1,2,3]. HCC belongs to the category of liver accumulation and abdominal mass in traditional Chinese medicine science, that is, a syndrome of deficiency in origin and excess in superficiality [4]. Modern medicine believes that long-term heavy drinking, eating moldy food, genetic and environmental factors, and so on may be the causes of HCC. Seventy percent of HCC is already in the intermediate and advanced stages once discovered [5]. Interventional therapy, targeted therapy (sorafenib or lenvatinib, etc.) and immunotherapy (PD-1/PD-L1 antibodies, etc.), are often used for intermediate and advanced HCC [6]. However, both targeted therapy and immunotherapy have disadvantages. On one hand, targeted therapy is prone to drug resistance and has a high cost. On the other hand, immunotherapy has side effects such as edema, fever, and skin toxicity. In order to overcome or reduce their side effects, it is necessary to develop an alternative chemotherapeutic or complementary strategy to treat HCC. Hence, TCM and its bioactive compounds can be explored as safer alternatives in the form of combinational treatment strategies in addition to interventional therapy, targeted therapy, and immunotherapy. It is worth mentioning that toxic TCM has been proven to be able to treat HCC, which may be related to the toxicity. However, studies have shown that toxic TCM may play a role in anti-HCC by regulating a variety of signaling pathways, such as NF-κB and STAT3 [7,8].
Illicium L. has 40 species and a long history of medicinal use in the world. It was recorded in the Compendium of Materia Medica more than 400 years ago. Besides, Illicium L. is a source of sesquiterpenes, diterpenes and triterpenoids, flavonoids, phenylpropanoids, lignans, and volatile oils [9]. ISM, a member of Illicium L., is mainly indigenous in India, Myanmar, and the southwestern part of China [10]. In addition, the research on ISM mainly focuses on the separation of its chemical compounds and pharmacological activities, such as anti-inflammatory [11], antibacterial [12], and neuroprotective effects [13]. In addition, anisatin and (1S)-minwanenone separated from ISM can inhibit the growth of SMMC-7721 cells [14]. Our previous study showed that the DEIM (dichloromethane fraction of Illicium simonsii Maxim) and PEIM have an anti-HCC effect. In particular, the PEIM has the best anti-HCC effect on HepG2 cells (IC50 = 55.03 μg·mL−1) and Bel-7404 cells (IC50 = 59.67 μg·mL−1). The inhibitory effect of the PEIM on HepG2 cells was better than that on Bel-7404 cells, so we chose HepG2 cells for further study. Significant scientific evidence shows the importance of TCM in the development of new drugs to treat HCC, which is a major disease that threatens human life and health, so research into anti-HCC drugs can’t wait. The current study aims to assess the potential beneficial effect of the PEIM in HCC therapy. We hypothesized that the PEIM would potentiate the anticancer effect by inhibiting cell proliferation, promoting cell death, and modulating the signaling pathways associated with the development of HCC, and that it will contribute to improving the quality of life of HCC patients and unraveling a new treatment strategy that is more effective with fewer or no side effects.

2. Results

2.1. LC-MS/MS Analyzed the Chemical Substances of PEIM

The chemical substances in the PEIM were analyzed by the LC-MS/MS analysis method. Compounds were identified by correlating the molecular ion peaks with MS fragmentation to that reported by previous researchers or online software programs, which are represented in Table 1, that displays the retention time (tR), m/z found in both modes (ESI+/ESI−), and a fragmentation pattern, along with the actual m/z of the identified compounds. A total of 64 compounds were tentatively identified in the PEIM by comparing the database with the literature. These compounds are listed in Table 1. Flavonoids, diterpenoids, triterpenoids, alkaloids, lignans, and sesquiterpenoids were the identified classes of constituents in the PEIM. Flavonoids were the major class of the identified active constituents. Compounds with anti-HCC effects include glabridin [15], baohuoside I [16], kaempferol [17], isorhamnetin [18], morin hydrate [19], kaempferitrin [20], genistein [21], pectolinarigenin [22], quercetin [23], luteolin [24], tangeretin [25], calycosin [26], and hyperin [27]. The total ion mass spectrometry is shown in Figure 1, and the structure of the most abundant flavonoid in the PEIM is shown in Figure 2.

2.2. PEIM Affected the Proliferation and Morphology in HepG2 Cells

The MTT method was used to analyze the effect of the PEIM on the proliferation of HepG2 cells after 48 h (Figure 3A). Hoechst33342 staining was used to observe the morphology of apoptosis after the HepG2 cells were treated with the PEIM. In this experiment, with the increase in drug concentration, the amount of cell debris increased, and the apoptotic cells showed a clear, bright blue, round or condensed, clumpy structure (Figure 3B).

2.3. PEIM Decreased the Content of TNF-α, IL-1β and IL-6 in HepG2 Cells

ELISA assay was used to analyze the effect of the PEIM on the content of TNF-α, IL-1β, and IL-6 in the cell supernatant. After treatment with different concentrations of the PEIM, the contents of TNF-α (Figure 4A), IL-1β (Figure 4B) and IL-6 (Figure 4C) in the supernatant of HepG2 cells decreased gradually compared to the control group (p < 0.05 or p < 0.01).

2.4. PEIM Promoted Apoptosis in HepG2 Cells

The apoptotic effect of the PEIM was dose-dependent. Whether the PEIM inhibited HepG2 cells through apoptosis was further determined by flow cytometry. As shown in Figure 4B and Figure 5A, the number of late apoptotic and total apoptotic HepG cells increased gradually after treatment with the PEIM (p < 0.05).

2.5. PEIM Increased the Expression of P53 mRNA and Caspase-3 mRNA in HepG2 Cells

RT-qPCR was used to analyze the effect of the PEIM on the expression of P53 mRNA and caspase-3 mRNA from a genetic perspective. The expression of P53 mRNA (Figure 6A) and caspase-3 mRNA (Figure 6B) in HepG2 cells was gradually increased, and showed a discernible dose-dependent pattern. Notably, the expression of p53 mRNA and caspase-3 mRNA showed a significant difference (p < 0.05) compared to the control group after treatment with different concentrations of 50 μg·mL−1 PEIM.

2.6. PEIM Affected the Expression of TLR4/MyD88/NF-κB, JAK2/STAT3, P53/P21/MDM2, and Mitochondrial Apoptosis Pathway-Related Proteins in HepG2 Cells

In order to further study the mechanism of the PEIM against HCC, Western blot assay was used to detect the expression of TLR4/MyD88/NF-κB, JAK2/STAT3, P53/P21/MDM2, and mitochondrial apoptosis pathway-related proteins. First, the results showed that the PEIM could down-regulate the expression of TLR4, MyD88, p-NF-κB p65, TNF-α, IL-1β, and INOS (Figure 7A). Second, the expression of IL-6, JAK2, and STAT3 were also down-regulated (Figure 7B). Third, we found that the expression of P53 and P21 were up-regulated, and the expression of CDK4, CyclinD1, and MDM2 were down-regulated (Figure 7C). Finally, the expression of Bax, cytochrome-C, caspase-9, and caspase-3 were up-regulated, and the expression of Bcl-2 protein was down-regulated (Figure 7D).

3. Discussion

This study analyzed the chemical constituents of the PEIM by LC-MS/MS and investigated the effect of the PEIM against HCC, showing that a total of 64 compounds were identified, including flavonoids, diterpenoids, triterpenoids, alkaloids, lignans, and sesquiterpenoids, which are believed to play a crucial role in treating HCC.
Based on the results of the MTT assay study, the PEIM showed cytotoxicity against HepG2 cells, and the IC50 value was 55.03 μg·mL−1. Moreover, the results also showed, by Hoechst33342 staining assay, that the PEIM could cause HepG2 cell lysis and death, which was used to verify whether the PEIM could affect the morphology of HepG2 cells.
It is well known that promoting tumor inflammation is one of the most important characteristics of malignant tumors and plays an important role in the development, invasion, and metastasis of tumors [28]. In addition, it is generally believed that TLR4/NF-κB/MyD88 and JAK2/STAT3 are the important signaling pathways related to inflammation [29,30]. For example, it has been reported that the TLR4/NF-κB/MyD88 signaling pathway can induce the transcription and expression of a variety of pro-inflammatory chemokines, such as IFN-γ and TNF-α, related to liver inflammation [31]. Additionally, down-regulation of IL-6, JAK2, and STAT3 could inhibit cell proliferation in HepG2 cells [32,33]. Therefore, the expression of proteins related to the TLR4/NF-κB/MyD88 and JAK2/STAT3 signaling pathways was also assessed by Western blot, and the content of inflammatory factors (TNF-α, IL-1β, and IL-6) was assessed using an ELISA kit. The results of this study demonstrate that the PEIM potentiates the anti-HCC effect by reducing inflammation due to down-regulating the expression of TLR4, MyD88, p-NF-κBp65, TNF-α, IL-1β, INOS, IL-6, JAK2, and STAT3, and reducing the content of TNF-α, IL-1β, and IL-6. It was noteworthy that the above-mentioned proteins showed significant differences when the concentration was at 50 μg·mL−1. Based on the above results, we believe that the PEIM may play an anti-HCC role from the perspective of increasing immunity.
Apoptosis inhibition is known to be one of the means by which cancer cells assure proliferation and survival. Furthermore, it is well known that P53/P21/MDM2 and the mitochondrial signaling pathway play a significant role in apoptosis. On one hand, p53 is a tumor suppressor gene and the upstream factor of P21, which can induce apoptosis via the inhibition of cyclinD1 and CDK4 of HCC cells [34,35]. On the other hand, Bcl-2 plays a tumor suppressor role in the mitochondrial apoptosis pathway by blocking the pro-apoptotic effect of Bax. Additionally, it will induce the release of cytochrome-C when the integrity of the mitochondria is destroyed, and then the expression of caspase proteins will be activated [36]. To further understand the mechanism by which the PEIM exerts its effects, apoptosis was detected by flow cytometry, showing that the PEIM induced apoptosis of HepG2 cells, and the total apoptosis rate was 75.5% at a concentration of 50 μg·mL−1. RT-qPCR results showed that the PEIM could promote the relative expression of P53 mRNA and caspase-3 mRNA, which was a noteworthy finding from our study. Moreover, Western blot results showed that the PEIM could induce apoptosis of HepG2 cells due to upregulation of P53, P21, cytochrome-C, caspase-9, and caspase-3, as well as downregulation of cyclinD1, CDK, MDM2, and Bcl-2 expression. It is noteworthy that caspase-9 and caspase-3 showed extremely significant differences when the concentration was at 50 μg·mL−1. We strongly believe that the development of strategies aimed at enhancing cell death will open the prospect of improving the success of cancer treatment by combining these natural TCM therapies with conventional chemotherapies. The summary figure for each pathway investigated is shown in Figure 8.

4. Materials and Methods

4.1. Drug Preparation

The ISM in this study was collected from Tongren, Guizhou. It was identified by Professor Ma Wenfang of Guangxi University of Traditional Chinese Medicine. The HepG2 cell directory number was TCHu 72, and they were purchased from the cell bank of the Chinese Academy of Sciences. After crushing, the medicinal materials were extracted three times with 95% ethanol by micro-boiling reflux for 2 h each time. The obtained liquid was concentrated by a rotary evaporator. After the extract was obtained, water and petroleum ether were added for extraction. Finally, the PEIM was obtained after concentration.

4.2. Liquid Chromatography-Mass Spectroscopy Study

A UPLC-Q Exactive quadrupole-electrostatic field orbitrap high-resolution mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) equipped with a HESI source was used to detect the chemical components of the PEIM. A volume of 3 μL of the sample was injected, and mass spectra were investigated in the range of 50–1000 Da by applying negative as well as positive ionization modes, where the spray voltage was 3.5 kV (+) and 3.2 kV (−), sheath gas volume flow was 30 μL·min−1, ion transport tube temperature was 320 °C, auxiliary gas flow rate was 10 μL·min−1, and auxiliary gas temperature was 300 °C. To conduct the HPLC analysis, a Waters Alliance 2695 HPLC Pump (Waters, Milford, MA, USA) was employed along with a Thermo Gold C18 column, of which the specification was 2.1 mm × 100 mm, 1.9 μm (Thermo Fisher Scientific, Waltham, MA, USA). The mobile phase comprised (A) 0.1% formic acid (95.0) (Fisher, Hampton, NH, USA) and (B) acetonitrile (5.0) (Fisher, Hampton, NH, USA). The gradient condition was: 0–20 min, gradient from 5% of B; 20–23 min, isocratic conditions at 95% of B; 23–24 min, gradient from 95% of B; 24–27 min, isocratic conditions at 5% of B. Flow rate: 0.4 mL·min−1. The identification of components was accomplished.

4.3. Cell Culture and Treatment

HepG2 cells were purchased from the Cell Bank of Chinese Academy of Sciences, and grown in the medium containing 10% DMEM (Gibco/Thermo Fisher Scientific, Waltham, MA, USA) and 1% FBS (VivaCell, Shanghai, China) at 37 °C in a cell incubator (Sanyo, Osaka, Japan). We observed cell morphology with an inverted microscope (Olympus Corporation, Tokyo, Japan) or fluorescence microscope (Carl Zeiss, Oberkochen, Germany).

4.4. Cell Viability Assay

An MTT assay was used to test the effect of the PEIM on the proliferation of HepG2 cells. MTT was diluted with phosphate-buffered saline (PBS) to a 5 mg·mL−1 solution. HepG2 cells were seeded in 96-well plates at a density of 1 × 104 cells/well, and then the plates were placed in a cell incubator and incubated at 37 °C with 5% CO2 for 24 h. PEIM was dissolved in dimethyl sulfoxide (DMSO), and different concentrations were set. In addition, the corresponding control group containing DMSO was set. Five duplicate wells were set for each concentration. After incubation for 24 h, 48 h, and 72 h, the supernatant was discarded, and 10 μL of 5 mg·mL−1 MTT solution was added to each well. After incubation for 4 h in the incubator, the supernatant was discarded, and 150 μL of dimethyl sulfoxide was added. The blue-purple formazan crystal was dissolved in a shaker for 10 min. Finally, the absorbance at 490 nm was detected by a microplate reader (Bio-Rad, Hercules, CA, USA).

4.5. Enzyme-Linked Immunosorbent Assay

The cell supernatant was collected and centrifuged at 2–8 °C, 1000× g for 20 min to remove impurities and cell debris. The levels of TNF-α, IL-1β, and IL-6 in the cell supernatant were detected by an ELISA kit (Elabscience, Wuhan, China).

4.6. Hoechst33342 Staining

HepG2 cells were treated with different concentrations of the PEIM for 24 h, 200 μL of 10 Hoechst33342 staining (Solarbio, Beijing, China) was added at a concentration of 10 μg·mL−1 and incubated for 10 min. The cell morphology was observed under a fluorescence microscope (Zeiss, Oberkochen, Germany) and photographed.

4.7. FACS Analysis

The HepG2 cells in the logarithmic growth phase were washed with PBS and digested with a 0.25% trypsin-EDTA digestive solution. The cells were collected by centrifugation, resuspended in PBS, and inoculated in 6-well plates at 1 × 106/well in a cell incubator for 24 h. The old medium was discarded, and different concentrations (50 μg·mL−1, 25 μg·mL−1, and 12.5 μg·mL−1) of drugs were added for intervention. After 48 h, the old medium was discarded and the cells were collected. After being washed twice with PBS, 500 μL 1×Binding Buffer was added to re-suspend the cells, and 5 μL Annexin V-FITC staining solution and 10 μL propidium iodide (PI) staining solution were added at room temperature for 5 min, detected by flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA).

4.8. RT-qPCR Assay

Trizol lysis buffer (TaKaRa, Kyoto, Japan) was used to lyse the cells. Carbon tetrachloride was added after standing at room temperature for 5 min. After shaking, the cells were allowed to stand at room temperature for 3 min, and then centrifuged at 4 °C and 12,000 rpm for 15 min. The upper water phase was transferred to the EP tube, and isopropanol with the same volume as water was added. After mixing, the mixture was allowed to stand at room temperature for 10 min, and then centrifuged at 4 °C at 12,000 rpm for 10 min. The supernatant was discarded, and 500 μL of 75% ethanol was added and centrifuged at 4 °C at 10,000 rpm for 5 min. The supernatant was discarded, and nuclease-free water was added to obtain the total RNA that was reverse transcribed into DNA using a reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) using a gradient PCR instrument (BIO-RAD, Hercules, CA, USA). Finally, a Roche 96 PCR instrument (Roche, Basel, Switzerland) was used for detection. The primers of RT-qPCR are shown in Table 2.

4.9. Western Blot Analysis

RIPA lysis buffer and a protease inhibitor were used to lyse the cells to extract the protein, and the protein concentration was determined. The extracted protein was separated by SDS-PAGE gel electrophoresis and transferred to the PVDF membrane. After blocking with a rapid blocking solution at room temperature for 10 min, the membranes were incubated with the primary antibodies at 4 °C overnight. After washing, the membranes were further incubated with secondary antibodies at room temperature for 1 h. Finally, the protein bands were visualized using an Omni-ECLTM ultrasensitive chemiluminescence detection kit (Epizyme, Shanghai, China) by an imaging system (Bio-Rad, Hercules, CA, USA). Primary antibodies for TLR4, MyD88, p-NF-κBp65, IL-1β, TNF-α, INOS, P53, MDM2, cyclinD1, CDK4, Bcl-2, Bax, caspase-9, and cytochrome-C were purchased from Proteintech (Wuhan, China). IL-6 was purchased from Beyotime (Shanghai, China). JAK2 and STAT3 were purchased from HUABIO (Hangzhou, China). P21 and caspase-3 were purchased from CST (Danvers, MA, USA).

4.10. Statistical Analysis

The results were analyzed by SPSS25.0 software and are shown as mean ± standard deviation. SPSS25.0 was used for one-way analysis of variance; Prism 8.0.2 and ImageJ 1.8.0 were used to analyze the statistical differences and draw. A p value of less than 0.05 was considered statistically significant.

5. Conclusions

In conclusion, the results of this study suggested that the PEIM showed a prominent anti-HCC activity and increased cell apoptosis in vitro. Such observations might be due to the presence of biologically functional compounds in the PEIM. Additionally, we demonstrated that the mechanism behind the effects of the PEIM is by acting on the TLR4/MyD88/NF-κB, IL-6/JAK2/STAT3, P53/P21/MDM2, and mitochondrial apoptosis pathways. These data suggested that PEIM could be a powerful new drug against HCC by modulating proliferation, cell death, and the above-mentioned signaling pathways. However, further studies are needed to better understand the molecular mechanisms and further investigate the signaling pathways involved in different HCC cells.

Author Contributions

Methodology and interpretation, S.Z.; data analysis, Y.W.; sample preparation, M.W.; methodology, J.L.; data proofreading, M.C.; writing—review and editing, J.Y.; super vision, writing—review and editing, B.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Sciences Foundation of China, grant numbers 82060700 and 82360960, and the Guangxi Key Laboratory of Efficacy Study on Chinese Materia Medica, grant number 20-065-38.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

Special thanks to Guangxi Scientific Research Centre of Traditional Chinese Medicine and Guangxi Key Laboratory of Efficacy Study on Chinese Materia Medica, Guangxi University of Chinese Medicine for technical support. All individuals have consented to the acknowledgement.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemalet, A. Global Cancer Statistics 2018: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
  2. Anwanwan, D.; Singh, S.K.; Singh, S.; Saikam, V.; Singh, R. Challenges in liver cancer and possible treatment approaches. Biochim. Biophys. Acta Rev. Cancer 2020, 1873, 188314. [Google Scholar] [CrossRef]
  3. Cheng, Z.; Lin, X.; Ding, J. Characteristics of hepatocellular carcinoma stem cells and clinical correlations. Cancer Lett. 2016, 379, 230. [Google Scholar] [CrossRef]
  4. Zhang, Z.; Zeng, P.H.; Gao, W.H.; Tian, X.F.; Tian, S.; Wu, R.X.; Huang, X.D.; Zheng, P.; Huang, Z.; Guo, Y.M. To explore the relationship between pyroptosis and hepatocellular carcinoma based on the theory of deficiency toxin and blood stasis pathogenesis. Chin. J. Basic Med. Tradit. Chin. Med. 2021, 27, 818–820+852. [Google Scholar]
  5. Jin, H.; Shi, L.Y. EGFR activation limits the response of liver cancer to lenvatinib. Nature 2021, 595, 730–734. [Google Scholar] [CrossRef]
  6. Miller, A.B.; Hoogstraten, B.; Staquet, M. Reporting results of cancer treatment. Cancer 1981, 47, 207–214. [Google Scholar] [CrossRef]
  7. Qin, M.R.; Chen, R.H.; Liu, L.H.; Xie, T.Z.; Wang, P.; Wang, X.W. Mechanism Exploration of Polyphyllin I in Inhibiting Proliferation, Invasion, Migration Hepatocellular Carcinoma via PI3K/AKT Signaling Pathway. Liaoning J. Tradit. Chin. Med. 2024, 51, 144–147+221. [Google Scholar]
  8. Yuan, Z.; Liang, Z.; Yi, J. Koumine Promotes ROS Production to Suppress Hepatocellular Carcinoma Cell Proliferation via NF-κB and ERK/p38 MAPK Signaling. Biomolecules 2019, 9, 559. [Google Scholar] [CrossRef]
  9. Wang, X.X.; Zhuang, P.y.; Gou, L.X.; Li, X.Q. Research on the chemical components of wild anise fruits. Chin. Patent Med. 2019, 41, 1867–1871. [Google Scholar] [CrossRef]
  10. Lin, Q. Medicinal plant resources of Illicium L. Chin. Tradit. Herb. Drugs 2021, 33, 81–84. [Google Scholar]
  11. Zhang, Q.Z.; Wang, J.; Liang, Z.C. Experimental study on anti-inflammatory and analgesic effects of illicium S.M. J. China Prescr. Drug 2018, 16, 39–40. [Google Scholar]
  12. Li, H.J.; Song, X.H.; Li, H.R.; Zhu, L.F.; Cao, S.B.; Liu, J.F. Sesquiterpenes and Monoterpenes from the Leaves and Stems of Illicium simonsii and Their Antibacterial Activity. Molecules 2022, 27, 1115. [Google Scholar] [CrossRef]
  13. Su, G.Z.; Li, M.; Wang, X.J.; Wang, R.B.; Ma, S.G.; Zhang, D.; Wang, X.L.; Li, L.; Liu, Y.B.; Qu, J.; et al. Chemical constituents from the fruits of Illicium simonsii and their antiviral activity and neuroprotective effect. Phytochemistry 2022, 202, 113323. [Google Scholar] [CrossRef]
  14. Yin, P.J.; Wang, J.S.; Wang, P.R.; Kong, L.Y. Sesquiterpenes and lignans from the fruits of Illicium simonsii and their cytotoxicities. Chin. J. Nat. Med. 2012, 10, 383–387. [Google Scholar] [CrossRef]
  15. Wang, Z.Y.; Luo, S.Q.; Wan, Z.; Chen, C.Y.; Zhang, X.N.; Li, B.B.; Huang, G.L.; Chen, L.Y.; He, Z.W.; Huang, Z.N. Glabridin arrests cell cycle and inhibits proliferation of hepatocellular carcinoma by suppressing braf/MEK signaling pathway. Tumor Biol. 2016, 37, 5837–5846. [Google Scholar] [CrossRef]
  16. Sun, Y.L.; Pang, B.; Wang, Y.Z.; Xiao, J.L.; Jiang, D.C. Baohuoside I Inhibits the Proliferation of Hepatocellular Carcinoma Cells via Apoptosis Signaling and NF-kB Pathway. Chem. Biodivers. 2021, 18, e2100063. [Google Scholar] [CrossRef]
  17. Nair, B.; Anto, R.J.; Sabitha, M.; Nath, L.R. Kaempferol-Mediated Sensitization Enhances Chemotherapeutic Efficacy of Sorafenib Against Hepatocellular Carcinoma: An In Silico and In Vitro Approach. Adv. Pharm. Bull. 2020, 10, 472–476. [Google Scholar] [CrossRef]
  18. Choi, Y.H. Isorhamnetin induces ROS-dependent cycle arrest at G2/M phase and apoptosis in human hepatocarcinoma Hep3B cells. Gen. Physiol. Biophys 2019, 38, 473–484. [Google Scholar] [CrossRef]
  19. Singh, M.P.; Cho, H.J.; Kim, J.T.; Baek, K.E.; Lee, H.G.; Kang, S.C. Morin Hydrate Reverses Cisplatin Resistance by Impairing PARP1/HMGB1-Dependent Autophagy in Hepatocellular Carcinoma. Cancers 2019, 11, 986. [Google Scholar] [CrossRef]
  20. Ku, W.C.; Sridharan, B.; Chen, J.Y.; Li, J.Y.; Yang, S.Y.; Lee, M.J. Kaempferitrin-Treated HepG2 Differentially Expressed Exosomal Markers and Affect Extracellular Vesicle Sizes in the Secretome. Biomolecules 2021, 11, 187. [Google Scholar] [CrossRef]
  21. Zhang, Q.; Bao, J.; Yang, J.H. Genistein-triggered anticancer activity against liver cancer cell line HepG2 involves ROS generation, mitochondrial apoptosis, G2/M cell cycle arrest and inhibition of cell migration. Arch. Med. Sci. 2019, 15, 1001–1009. [Google Scholar] [CrossRef]
  22. Liu, S.; Zhang, J.Z.; Yang, H.; Zhang, Q.L.; Chen, M.Z. Pectolinarigenin flavonoid exhibits selective anti-proliferative activity in cisplatin-resistant hepatocellular carcinoma, autophagy activation, inhibiting cell migration and invasion, G2/M phase cell cycle arrest and targeting ERK1/2 MAP kinases. J. BUON 2020, 25, 415–420. [Google Scholar]
  23. Liu, W.T.; Chen, D.Y.; Su, J.Y.; Zheng, R.L.; Kong, R.; Zhu, B.; Dong, H.; Li, Y.H. Quercetin induced HepG2 cells apoptosis through ATM/JNK/STAT3 signaling pathway. Biocell 2023, 47, 187–194. [Google Scholar] [CrossRef]
  24. Lee, Y.; Kwon, Y.H. Regulation of apoptosis and autophagy by luteolin in human hepatocellular cancer Hep3B cells. Biochem. Biophys. Res. Commun. 2019, 517, 617–622. [Google Scholar] [CrossRef]
  25. Lu, K.H.; Lee, H.Y.; Chu, Y.L.; Ho, C.T.; Sheen, L.Y. Bitter orange peel extract induces endoplasmic reticulum-mediated autophagy in human hepatoma cells. J. Funct. Foods 2019, 60, 103404. [Google Scholar] [CrossRef]
  26. Liu, Y.; Piao, X.J.; Xu, W.T.; Zhang, Y.; Zhang, T.; Xue, H.; Li, Y.N.; Zuo, W.B.; Sun, G.; Fu, Z.R.; et al. Calycosin induces mitochondrial-dependent apoptosis and cell cycle arrest, and inhibits cell migration through a ROS-mediated signaling pathway in HepG2 hepatocellular carcinoma cells. Toxicol. In Vitro 2021, 70, 105052. [Google Scholar] [CrossRef]
  27. Jiang, S.; Xiong, H.S.; Wu, H.K.; Wen, J.; Liang, L. Regulatory effect of hyperoside on proliferation and apoptosis of hepaticcarcinoma cell HepG2 via mitochondrial P53/Caspase signaling pathway. Chin. J. Immunol. 2018, 34, 1832–1836. [Google Scholar]
  28. Wei, S.; Zhou, H.; Wang, Q.; Zhou, S.; Li, C.; Liu, R.; Qiu, J.; Shi, C.; Lu, L. RIP3 deficiency alleviates liver fibrosis by inhibiting ROCK1-TLR4-NF-kB pathway in macrophages. FASEB J. 2019, 33, 11180–11193. [Google Scholar] [CrossRef]
  29. Pan, Z.Q.; Zhang, X.H.; Ai, Y.Q.; Wu, X.P.; Shi, J.S. Correlation analysis of TLR4/MyD88/NF-κB expression in hepatocellular carcinoma tissue and prognosis after radical resection. Clin. Exp. Med. 2022, 21, 1836–1840. [Google Scholar]
  30. Yang, J.; Wang, L.J.; Miu, X.; Yang, F. B-elemene inhibits the proliferation, migration and invasion of hepatocellular carcinoma cells through JAK2/STAT3 pathway. J. Harbin Med. Univ. 2023, 57, 594–598. [Google Scholar]
  31. Serrya, M.S.; Zaghloul, M.S. Mycophenolate mofetil attenuates concanavalin A-induced acute liver injury throughmodulation of TLR4/NF-kB and Nrf2HO-1 pathways. Pharmacol. Rep. 2020, 72, 945–955. [Google Scholar] [CrossRef]
  32. Hin Tang, J.J.; Hao Thng, D.K.; Lim, J.J.; Toh, T.B. JAK/STAT signaling in hepatocellular carcinoma. Hepat. Oncol. 2020, 7, HEP18. [Google Scholar] [CrossRef]
  33. Qiao, X.; Xu, S.H.; Wang, Y.W.; Feng, B.; Peng, P.K.; Shen, K.K. Da Chaihutang Inhibits Hepatocellular Carcinoma by Regulating p38MAPK/IL-6/STAT3 Signaling Pathway. Chin. J. Exp. Tradit. Med. Formul. 2022, 28, 19–31. [Google Scholar]
  34. Hu, C.; Chen, Z.; Wu, J.; Zhang, Y.; Xu, H.; Yang, W.M.; Ye, Z.Q. Up-regulation of Tumor Suppressor Gene p21WAF1/ClP1 in Human Cells by Small Double Strand RNA. J. Huazhong Univ. Sci. Technol. Med. Sci. 2012, 41, 60–64. [Google Scholar]
  35. Wang, Y.; Duan, H.C. Angelica Sinensis and Hedysarum Polysaccharides in human hepatoma SMMC-7721 cell radiation sensitizing effect and its molecular mechanis. Gansu Med. J. 2023, 42, 485–488+496. [Google Scholar]
  36. Shao, X.T.; Chen, Q.X.; Dou, X.X.; Lei, J.X.; Zhang, W. Lower range of molecular weight of xanthan gum inhibits cartilage matrixdestruction via intrinsic Bax-mitochondria cytochrome C-caspase pathway. Carbohydr. Polym. 2018, 198, 354–363. [Google Scholar] [CrossRef]
Pharmaceuticals 17 00806 g001
Figure 1. Total ion mass spectrometry of PEIM. (A) Total positive ion diagram. (B) Total negative ion diagram.
Figure 1. Total ion mass spectrometry of PEIM. (A) Total positive ion diagram. (B) Total negative ion diagram.
Pharmaceuticals 17 00806 g001
Pharmaceuticals 17 00806 g002aPharmaceuticals 17 00806 g002b
Figure 2. The structures of the most abundant flavonoids in the PEIM.
Figure 2. The structures of the most abundant flavonoids in the PEIM.
Pharmaceuticals 17 00806 g002aPharmaceuticals 17 00806 g002b
Pharmaceuticals 17 00806 g003
Figure 3. PEIM changed the growth and morphology of HepG2 cells. (A) The effect of PEIM on the viability of HepG2 cells was determined by MTT assay. (B) Apoptotic morphology of HepG2 cells after treatment with PEIM. Cells were stained with Hoechst 33342 solution for 15 min at room temperature (The magnification is 10×).
Figure 3. PEIM changed the growth and morphology of HepG2 cells. (A) The effect of PEIM on the viability of HepG2 cells was determined by MTT assay. (B) Apoptotic morphology of HepG2 cells after treatment with PEIM. Cells were stained with Hoechst 33342 solution for 15 min at room temperature (The magnification is 10×).
Pharmaceuticals 17 00806 g003
Pharmaceuticals 17 00806 g004
Figure 4. PEIM reduced the content of inflammatory factors. (A) The content of TNF-α after treatment with PEIM, ** p < 0.01 compared to the control group. (B) The content of IL-1β after treatment with PEIM, * p < 0.05 compared to the control group. (C) The content of IL-6 after treatment with PEIM, ** p < 0.01 compared to the control group.
Figure 4. PEIM reduced the content of inflammatory factors. (A) The content of TNF-α after treatment with PEIM, ** p < 0.01 compared to the control group. (B) The content of IL-1β after treatment with PEIM, * p < 0.05 compared to the control group. (C) The content of IL-6 after treatment with PEIM, ** p < 0.01 compared to the control group.
Pharmaceuticals 17 00806 g004
Pharmaceuticals 17 00806 g005
Figure 5. PEIM promoted apoptosis of HepG2 cells. (A) The apoptosis of HepG2 cells detected by flow cytometer after treatment with PEIM. (B) The apoptosis rate of HepG2 cells detected by flow cytometer after treatment with PEIM, * p < 0.05 compared to the control group.
Figure 5. PEIM promoted apoptosis of HepG2 cells. (A) The apoptosis of HepG2 cells detected by flow cytometer after treatment with PEIM. (B) The apoptosis rate of HepG2 cells detected by flow cytometer after treatment with PEIM, * p < 0.05 compared to the control group.
Pharmaceuticals 17 00806 g005
Pharmaceuticals 17 00806 g006
Figure 6. PEIM affected the expression of P53 mRNA and caspase-3 mRNA in HepG2 cells. (A) PEIM promoted the expression of P53 mRNA in HepG2 cells, * p < 0.05 compared to the control group. (B) PEIM promoted the expression of caspase-3 mRNA in HepG2 cells, * p < 0.05 compared to the control group.
Figure 6. PEIM affected the expression of P53 mRNA and caspase-3 mRNA in HepG2 cells. (A) PEIM promoted the expression of P53 mRNA in HepG2 cells, * p < 0.05 compared to the control group. (B) PEIM promoted the expression of caspase-3 mRNA in HepG2 cells, * p < 0.05 compared to the control group.
Pharmaceuticals 17 00806 g006
Pharmaceuticals 17 00806 g007aPharmaceuticals 17 00806 g007b
Figure 7. PEIM regulated the expression of TLR4/MyD88/NF-κB, JAK2/STAT3, P53/P21/MDM2, and mitochondrial apoptosis pathway-related proteins. (A) Expression of proteins involved TLR4/MyD88/NF-κB signaling pathway of HepG cells treated with PEIM. * p < 0.05 compared to the control group. (B) Expression of proteins involved JAK2/STAT3 signaling pathway of HepG cells treated with PEIM. * p < 0.05, ** p < 0.01 compared to the control group. (C) Expression of proteins involved P53/P21/MDM2 signaling pathway of HepG cells treated with PEIM. * p < 0.05 compared to the control group. (D) Expression of proteins involved mitochondrial apoptosis signaling pathway of HepG cells treated with PEIM. * p < 0.05, ** p < 0.01 compared to the control group.
Figure 7. PEIM regulated the expression of TLR4/MyD88/NF-κB, JAK2/STAT3, P53/P21/MDM2, and mitochondrial apoptosis pathway-related proteins. (A) Expression of proteins involved TLR4/MyD88/NF-κB signaling pathway of HepG cells treated with PEIM. * p < 0.05 compared to the control group. (B) Expression of proteins involved JAK2/STAT3 signaling pathway of HepG cells treated with PEIM. * p < 0.05, ** p < 0.01 compared to the control group. (C) Expression of proteins involved P53/P21/MDM2 signaling pathway of HepG cells treated with PEIM. * p < 0.05 compared to the control group. (D) Expression of proteins involved mitochondrial apoptosis signaling pathway of HepG cells treated with PEIM. * p < 0.05, ** p < 0.01 compared to the control group.
Pharmaceuticals 17 00806 g007aPharmaceuticals 17 00806 g007b
Pharmaceuticals 17 00806 g008
Figure 8. Mechanism of PEIM-induced HepG2 cells apoptosis and antiproliferation.
Figure 8. Mechanism of PEIM-induced HepG2 cells apoptosis and antiproliferation.
Pharmaceuticals 17 00806 g008
Table 1. Compounds identified by LC-MS/MS in the PEIM.
Table 1. Compounds identified by LC-MS/MS in the PEIM.
NO.RT
(min.)		Precursor m/zFragmentationMolecular FormulaPossible Compounds Identified
[M+H]+ [M−H]−
Flavonoids
111.36355.1180 355.1201, 135.0449C20H18O6Erythrinin C
214.05325.1432131.0511, 103.0567C20H20O4Glabridin
39.39323.1278323.1294, 161.0605, 135.0456C20H18O4Glabrene
45.76515.1910515.1897C27H30O10Baohuoside I
57.69287.0552287.0571, 153.0202C15H10O6Kaempferol
614.05325.1434131.0511, 103.0567C20H20O4Isobavachin
77.90317.0660317.0658, 302.0441, 153.0203, C16H12O7Isorhamnetin
86.62303.0500303.0498, 229.0508, 153.0200C15H10O7Morin hydrate
97.21577.1562369.0970, 346.9870, 297.1123, 108.0188C27H30O14Kaempferitrin
109.80269.0820269.1349, 225.0925, 149.0614C16H14O4Alpinetin
115.01593.1510593.1449, 285.0322C27H30O15Aempferol-3-O-rutinoside
124.52609.1464609.1445, 300.0280, 255.0291, 179.0019, 151.0070C27H30O16Kaempferol-3-gentiobioside
137.14371.1140371.1179, 327.1230, 297.1129, 267.0613, 160.0536C20H20O7Isosinensetin
146.61301.0351301.0355, 178.9978, 151.0025, 107.0136C15H10O7Quercetin
157.54269.0458269.0475, 228.9901, 151.0048, 117.0352C15H10O5Genistein
1610.48313.0719313.1500, 283.0253, 255.0330, 216.9912, 145.0307C17H14O6Pectolinarigenin
175.13 623.1620623.1631, 315.0606, 299.0172, 259.0542C28H32O16Isorhamnetin-3-O-neohespeidoside
185.19447.0932447.0894, 284.0345, 227.0324, 174.9554, 146.9589C21H20O11Quercitrin
197.67285.0401285.0390, 257.0452, 229.0486, 151.0040C15H10O6Luteolin
207.14371.1139371.1179, 327.1230, 282.0891, 267.0653, 160.0536C20H20O7Tangeretin
219.93283.0610283.0603, 268.0371, 242.9949, 152.9947C16H12O5Calycosin
224.70463.0881463.0875, 300.0278, 271.0220, 174.9579C21H20O12Hyperin
Diterpenoids
236.60557.1960111.3465, 81.0746C36H28O6Neoprzewaquine A
2416.58351.2170351.1984, 207.1384, 161.1346, 105.0723C20H30O5Andrographolide
2517.49533.2384533.3047, 356.1428, 135.1185, 107.0874C28H36O10Butanedioicacid
2612.86297.1487297.1535, 279.2671, 256.1101, 227.0734C19H20O3Cryptotanshinone
2712.93331.1900313.2739, 271.2097, 149.0977, 133.1014C20H26O4Carnosol
2812.13333.2059333.2167, 315.1934, 269.1915, 119.0892C20H28O4Carnosic acid
297.58357.1342357.1323, 342.1085, 232.9816, 137.0604, 83.0139C20H22O6Triptonide
306.11359.1496326.1166, 300.1245, 269.0821, 208.0739, 180.0745C20H24O6Triptolide
Triterpenoids
3116.78439.3571439.3638, 191.1792, 135.1175C30H46O2Ganoderiol A
3219.09455.3521455.3567, 437.3455, 237.2719, 161.1372C30H46O3Betulonicacid
3312.82537.2980537.3027C30H4lO6Senegenin
3412.82517.3166517.3328, 365.2006, 347.1898C30H46O7Ganoderic acid C2
3516.73467.3167467.3342, 423.3413, 399.1739, 125.0998C30H44O4Ganoderic acid DM
3613.76471.3478471.3559C30H48O4Ganodermanontriol
3716.77469.3323469.3325, 451.3229, 425.3417C30H46O4Glycyrrhetinic Acid
3816.77455.3530455.3522, 407.3415, 155.0367C30H48O3Betulinic acid
3911.28487.3430487.3406, 229.0074C30H48O5Asiatic acid
Alkaloids
407.07308.2221308.2257, 290.2117, 136.0786, 122.0184C18H29NO3Dihydrocapsaicin
4114.16213.1021213.1322, 183.0993, 172.0899, 129.0718C13H12N2OHarmine
420.61272.1282148.9876, 126.0561, 108.0458C16H17NO3Higenamine
4313.66457.2334457.2371, 123.1173C25H32N2O6Vindoline
4420.19623.3131623.3101, 563.2927C38H42N2O6Tetrandrine
453.38286.1440286.1455, 256.0915, 226.0412C17H19NO3Piperine
464.13326.1595326.1576, 182.9536C16H23NO6Monocrotaline
478.71286.1082286.0996, 196.0750, 168.0871, 107.0369C16H17NO4Lycorine
Lignans
489.81403.2116403.2069, 129.0178C23H30O6Schisanhenol
496.12539.2280367.1435, 343.1610, 163.0772C30H34O9Schisantherin E
509.52343.1540343.1588, 311.1283, 265.0868, 161.0607C20H22O5Arisantetralone A
5111.36355.1175355.1201, 337.1097, 135.0449C20H18O6Asarinin
5214.68399.1086399.1835, 381.1745C21H20O84′-Demethylepipodophyllotoxin
5311.77383.1500382.9986, 363.0072, 322.9807, 302.9933, 121.0280C22H24O6Schisandrin C
549.70535.1969535.1869, 341.1375, 193.0507, 134.0367C30H32O9Schisantherin A
Sesquiterpenoids
5513.53285.1768285.2242, 125.0979, 107.0864, 81.0711C15H24O5Dihydroartemisinin
568.78233.1536233.1522, 175.1139, 147.1192C15H20O2Alantolactone
578.36251.1641251.1280, 147.1217, 95.0863C15H22O3Nardosinone
5812.67237.1850237.2203, 201.1652, 149.1349, 71.0517C15H24O2Curdione
5913.29235.1694235.1711, 179.1091, 57.0713C15H22O2Curcumenol
Others:
607.69287.0552287.0571, 153.0202C15H10O63-Hydroxymorindone
619.76177.0545149.0246, 65.0400C10H8O3Hymecromone
624.27365.1443365.1316C15H24O10Harpagide
6320.42401.3775401.2042, 360.1636, 331.1258C28H48OCampesterol
6414.05337.1070131.0511, 103.0567C20H16O5Psoralidin
Table 2. Primer Sequences.
Table 2. Primer Sequences.
GeneSenseAntisense
P53GCTTTCCACGACGGTGACGCTCGACGCTAGGATCTGAC
Caspase-3AGAGCTGGACTGCGCTATTGAGGAACCATGACCCGTCCCTTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zou, S.; Wu, Y.; Wen, M.; Liu, J.; Chen, M.; Yuan, J.; Zhou, B. Potential Molecular Mechanism of Illicium simonsii Maxim Petroleum Ether Fraction in the Treatment of Hepatocellular Carcinoma. Pharmaceuticals 2024, 17, 806. https://doi.org/10.3390/ph17060806

AMA Style

Zou S, Wu Y, Wen M, Liu J, Chen M, Yuan J, Zhou B. Potential Molecular Mechanism of Illicium simonsii Maxim Petroleum Ether Fraction in the Treatment of Hepatocellular Carcinoma. Pharmaceuticals. 2024; 17(6):806. https://doi.org/10.3390/ph17060806

Chicago/Turabian Style

Zou, Sihua, Yanchun Wu, Meiqi Wen, Jiao Liu, Minghui Chen, Jingquan Yuan, and Bei Zhou. 2024. "Potential Molecular Mechanism of Illicium simonsii Maxim Petroleum Ether Fraction in the Treatment of Hepatocellular Carcinoma" Pharmaceuticals 17, no. 6: 806. https://doi.org/10.3390/ph17060806

APA Style

Zou, S., Wu, Y., Wen, M., Liu, J., Chen, M., Yuan, J., & Zhou, B. (2024). Potential Molecular Mechanism of Illicium simonsii Maxim Petroleum Ether Fraction in the Treatment of Hepatocellular Carcinoma. Pharmaceuticals, 17(6), 806. https://doi.org/10.3390/ph17060806

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop