Does Combined Treatment with Tranexamic Acid and Vancomycin Affect Human Chondrocytes In Vitro?
Abstract
:1. Introduction
2. Results
2.1. ATP Assays of Chondrocytes
2.2. Annexin 5 Assays of Chondrocytes
2.3. Expression of Chondrogenic Marker Genes
3. Discussion
4. Materials and Methods
4.1. Isolation and Culture of Chondrocytes
4.2. Treatment of Human Chondrocytes with Tranexamic Acid and Vancomycin Powder
4.3. Biochemical Assays
4.4. Annexin 5 Assay
4.5. RNA Isolation and Semiquantitative RT-PCR
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Health at a Glance 2019 OECD Indicators: OECD Indicators; OECD Publishing: Paris, France, 2019.
- Culliford, D.J.; Maskell, J.; Kiran, A.; Judge, A.; Javaid, M.K.; Cooper, C.; Arden, N.K. The lifetime risk of total hip and knee arthroplasty: Results from the UK general practice research database. Osteoarthr. Cartil. 2012, 20, 519–524. [Google Scholar] [CrossRef] [PubMed]
- Jonsson, H.; Olafsdottir, S.; Sigurdardottir, S.; Aspelund, T.; Eiriksdottir, G.; Sigurdsson, S.; Harris, T.B.; Launer, L.; Gudnason, V. Incidence and prevalence of total joint replacements due to osteoarthritis in the elderly: Risk factors and factors associated with late life prevalence in the AGES-Reykjavik Study. BMC Musculoskelet. Disord. 2016, 17, 14. [Google Scholar] [CrossRef] [PubMed]
- Klug, A.; Gramlich, Y.; Rudert, M.; Drees, P.; Hoffmann, R.; Weißenberger, M.; Kutzner, K.P. The projected volume of primary and revision total knee arthroplasty will place an immense burden on future health care systems over the next 30 years. Knee Surg. Sports Traumatol. Arthrosc. 2020, 29, 3287–3298. [Google Scholar] [CrossRef] [PubMed]
- Wilczyński, M.; Bieniek, M.; Krakowski, P.; Karpiński, R. Cemented vs. Cementless Fixation in Primary Knee Replacement: A Narrative Review. Materials 2024, 17, 1136. [Google Scholar] [CrossRef] [PubMed]
- Karpiński, R.; Szabelski, J.; Krakowski, P.; Jonak, J.; Falkowicz, K.; Jojczuk, M.; Nogalski, A.; Przekora, A. Effect of various admixtures on selected mechanical properties of medium viscosity bone cements: Part 3—Glassy carbon. Compos. Struct. 2024, 343, 118307. [Google Scholar] [CrossRef]
- Postler, A.; Lützner, C.; Beyer, F.; Tille, E.; Lützner, J. Analysis of Total Knee Arthroplasty revision causes. BMC Musculoskelet. Disord. 2018, 19, 55. [Google Scholar] [CrossRef]
- Klasan, A.; Gerber, F.; Schermuksnies, A.; Putnis, S.E.; Neri, T.; Heyse, T.J. Blood loss after revision knee arthroplasty is 1.38- to 2.17-fold higher than after primary knee arthroplasty: A retrospective analysis of 898 cases. Orthop. Traumatol. Surg. Res. 2021, 107, 102856. [Google Scholar] [CrossRef]
- Evangelopoulos, D.S.; Ahmad, S.S.; Krismer, A.M.; Albers, C.E.; Hoppe, S.; Kleer, B.; Kohl, S.; Ateschrang, A. Periprosthetic Infection: Major Cause of Early Failure of Primary and Revision Total Knee Arthroplasty. J. Knee Surg. 2019, 32, 941–946. [Google Scholar] [CrossRef]
- Zhang, H.; Chen, J.; Chen, F.; Que, W. The effect of tranexamic acid on blood loss and use of blood products in total knee arthroplasty: A meta-analysis. Knee Surg. Sports Traumatol. Arthrosc. 2012, 20, 1742–1752. [Google Scholar] [CrossRef]
- Sassoon, A.; Nam, D.; Jackups, R.; Johnson, S.R.; Nunley, R.M.; Barrack, R.L. Tranexamic acid: Optimal blood loss management in surface replacement arthroplasty. Bone Jt. J. 2016, 98, 173–178. [Google Scholar] [CrossRef]
- Jacob, B.; Kloss, N.; Böhle, S.; Kirschberg, J.; Zippelius, T.; Heinecke, M.; Matziolis, G.; Röhner, E. Tranexamic acid is toxic on human chondrocytes, in vitro. J. Orthop. 2020, 20, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Yang, Z.; Li, X.; Chen, J.; Liu, J.G. Effects of different doses of vancomycin powder in total knee and hip arthroplasty on the periprosthetic joint infection rate: A systematic review and meta-analysis. J. Orthop. Surg. Res. 2022, 17, 546. [Google Scholar] [CrossRef] [PubMed]
- Peng, Z.; Lin, X.; Kuang, X.; Teng, Z.; Lu, S. The application of topical vancomycin powder for the prevention of surgical site infections in primary total hip and knee arthroplasty: A meta-analysis. Orthop. Traumatol. Surg. Res. 2021, 107, 102741. [Google Scholar] [CrossRef] [PubMed]
- Iarikov, D.; Demian, H.; Rubin, D.; Alexander, J.; Nambiar, S. Choice and doses of antibacterial agents for cement spacers in treatment of prosthetic joint infections: Review of published studies. Clin. Infect. Dis. 2012, 55, 1474–1480. [Google Scholar] [CrossRef] [PubMed]
- Bolam, S.M.; O’Regan-Brown, A.; Paul Monk, A.; Musson, D.S.; Cornish, J.; Munro, J.T. Toxicity of tranexamic acid (TXA) to intra-articular tissue in orthopaedic surgery: A scoping review. Knee Surg. Sports Traumatol. Arthrosc. 2020, 29, 1862–1871. [Google Scholar] [CrossRef]
- Parker, J.D.; Lim, K.S.; Kieser, D.C.; Woodfield, T.B.F.; Hooper, G.J. Is tranexamic acid toxic to articular cartilage when administered topically? What is the safe dose? Bone Jt. J. 2018, 100, 404–412. [Google Scholar] [CrossRef]
- Braun, J.; Eckes, S.; Rommens, P.M.; Schmitz, K.; Nickel, D.; Ritz, U. Toxic Effect of Vancomycin on Viability and Functionality of Different Cells Involved in Tissue Regeneration. Antibiotics 2020, 9, 238. [Google Scholar] [CrossRef]
- Koutalos, A.A.; Drakos, A.; Fyllos, A.; Doxariotis, N.; Varitimidis, S.; Malizos, K.N. Does Intra-Wound Vancomycin Powder Affect the Action of Intra-Articular Tranexamic Acid in Total Joint Replacement? Microorganisms 2020, 8, 671. [Google Scholar] [CrossRef]
- Benjumea, A.; Díaz-Navarro, M.; Hafian, R.; Cercenado, E.; Sánchez-Somolinos, M.; Vaquero, J.; Chana, F.; Muñoz, P.; Guembe, M. Tranexamic Acid in Combination With Vancomycin or Gentamicin Has a Synergistic Effect Against Staphylococci. Front. Microbiol. 2022, 13, 935646. [Google Scholar] [CrossRef]
- Pajarinen, J.; Lin, T.H.; Nabeshima, A.; Jämsen, E.; Lu, L.; Nathan, K.; Yao, Z.; Goodman, S.B. Mesenchymal stem cells in the aseptic loosening of total joint replacements. J. Biomed. Mater. Res. Part A 2017, 105, 1195–1207. [Google Scholar] [CrossRef]
- Alshryda, S.; Sukeik, M.; Sarda, P.; Blenkinsopp, J.; Haddad, F.S.; Mason, J.M. A systematic review and meta-analysis of the topical administration of tranexamic acid in total hip and knee replacement. Bone Jt. J. 2014, 96, 1005–1015. [Google Scholar] [CrossRef] [PubMed]
- Ambra, L.F.; de Girolamo, L.; Niu, W.; Phan, A.; Spector, M.; Gomoll, A.H. No effect of topical application of tranexamic acid on articular cartilage. Knee Surg. Sports Traumatol. Arthrosc. 2019, 27, 931–935. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.K.; Chang, C.B.; Koh, I.J. Practical issues for the use of tranexamic acid in total knee arthroplasty: A systematic review. Knee Surg. Sports Traumatol. Arthrosc. 2014, 22, 1849–1858. [Google Scholar] [CrossRef]
- Goderecci, R.; Giusti, I.; Necozione, S.; Cinque, B.; D’Ascenzo, S.; Dolo, V.; Calvisi, V. Short exposure to tranexamic acid does not affect, in vitro, the viability of human chondrocytes. Eur. J. Med. Res. 2019, 24, 15. [Google Scholar] [CrossRef]
- Lawrie, C.M.; Kazarian, G.S.; Barrack, T.; Nunley, R.M.; Barrack, R.L. Intra-articular administration of vancomycin and tobramycin during primary cementless total knee arthroplasty: Determination of intra-articular and serum elution profiles. Bone Jt. J. 2021, 103, 1702–1708. [Google Scholar] [CrossRef]
- Wagenbrenner, M.; Heinz, T.; Horas, K.; Jakuscheit, A.; Arnholdt, J.; Mayer-Wagner, S.; Rudert, M.; Holzapfel, B.M.; Weißenberger, M. Impact of Tranexamic Acid on Chondrocytes and Osteogenically Differentiated Human Mesenchymal Stromal Cells (hMSCs) In Vitro. J. Clin. Med. 2020, 9, 3880. [Google Scholar] [CrossRef] [PubMed]
- Tuttle, J.R.; Feltman, P.R.; Ritterman, S.A.; Ehrlich, M.G. Effects of Tranexamic Acid Cytotoxicity on In Vitro Chondrocytes. Am. J. Orthop. 2015, 44, E497–E502. [Google Scholar]
- Marmotti, A.; Mattia, S.; Mangiavini, L.; Bonasia, D.E.; Bruzzone, M.; Dettoni, F.; Rosso, F.; Blonna, D.; Rossi, R.; Castoldi, F.; et al. Tranexamic acid effects on cartilage and synovial tissue: An in vitro study for a possible safe intra-articular use. J. Biol. Regul. Homeost. Agents 2016, 30, 33–40. [Google Scholar]
- Bīrīsīk, F., Sr.; Bayram, S.; Çakmak, M.; Apaydın, E.; Erşen, A. Investigation of the Effects of Intra-articular Tranexamic Acid on Intact Cartilage Tissue and Cartilage Formation in Osteochondral Defects of the Rabbit Knee: An Experimental Study. Cureus 2021, 13, e14873. [Google Scholar] [CrossRef]
- Degirmenci, E.; Ozturan, K.E.; Sahin, A.A.; Yilmaz, F.; Kaya, Y.E. Effects of tranexamic acid on the recovery of osteochondral defects treated by microfracture and acellular matrix scaffold: An experimental study. J. Orthop. Surg. Res. 2019, 14, 105. [Google Scholar] [CrossRef]
- McLean, M.; McCall, K.; Smith, I.D.M.; Blyth, M.; Kitson, S.M.; Crowe, L.A.N.; Leach, W.J.; Rooney, B.P.; Spencer, S.J.; Mullen, M.; et al. Tranexamic acid toxicity in human periarticular tissues. Bone Jt. Res. 2019, 8, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Pimenta, F.S.; de Oliveira Campos, T.V.; de Abreu, E.S.G.M.; Buzelin, M.A.; Nunes, C.B.; de Andrade, M.A.P. Chondrotoxic effects of tranexamic acid and povidone-iodine on the articular cartilage of rabbits. Int. Orthop. 2023, 47, 2429–2437. [Google Scholar] [CrossRef] [PubMed]
- Röhner, E.; Zippelius, T.; Böhle, S.; Rohe, S.; Matziolis, G.; Jacob, B. Vancomycin is toxic to human chondrocytes in vitro. Arch. Orthop. Trauma Surg. 2021, 141, 375–381. [Google Scholar] [CrossRef]
- Shaw, K.A.; Eichinger, J.K.; Nadig, N.; Parada, S.A. In Vitro Effect of Vancomycin on the Viability of Articular Chondrocytes. J. Orthop. Trauma 2018, 32, 148–153. [Google Scholar] [CrossRef]
- Yang, K.G.; Saris, D.B.; Geuze, R.E.; van Rijen, M.H.; van der Helm, Y.J.; Verbout, A.J.; Creemers, L.B.; Dhert, W.J. Altered in vitro chondrogenic properties of chondrocytes harvested from unaffected cartilage in osteoarthritic joints. Osteoarthr. Cartil. 2006, 14, 561–570. [Google Scholar] [CrossRef]
- Noth, U.; Tuli, R.; Osyczka, A.M.; Danielson, K.G.; Tuan, R.S. In vitro engineered cartilage constructs produced by press-coating biodegradable polymer with human mesenchymal stem cells. Tissue Eng. 2002, 8, 131–144. [Google Scholar] [CrossRef]
- Steinert, A.F.; Proffen, B.; Kunz, M.; Hendrich, C.; Ghivizzani, S.C.; Noth, U.; Rethwilm, A.; Eulert, J.; Evans, C.H. Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer. Arthritis Res. Ther. 2009, 11, R148. [Google Scholar] [CrossRef] [PubMed]
- Steinert, A.F.; Weissenberger, M.; Kunz, M.; Gilbert, F.; Ghivizzani, S.C.; Gobel, S.; Jakob, F.; Noth, U.; Rudert, M. Indian hedgehog gene transfer is a chondrogenic inducer of human mesenchymal stem cells. Arthritis Res. Ther. 2012, 14, R168. [Google Scholar] [CrossRef] [PubMed]
- Weissenberger, M.; Weissenberger, M.H.; Gilbert, F.; Groll, J.; Evans, C.H.; Steinert, A.F. Reduced hypertrophy in vitro after chondrogenic differentiation of adult human mesenchymal stem cells following adenoviral SOX9 gene delivery. BMC Musculoskelet. Disord. 2020, 21, 109. [Google Scholar] [CrossRef]
- Steinert, A.F.; Kunz, M.; Prager, P.; Barthel, T.; Jakob, F.; Noth, U.; Murray, M.M.; Evans, C.H.; Porter, R.M. Mesenchymal stem cell characteristics of human anterior cruciate ligament outgrowth cells. Tissue Eng. Part A 2011, 17, 1375–1388. [Google Scholar] [CrossRef]
Gene | Primer Sequences (5′-3′) | Annealing Temperature (°C) | Product Size (Base Pairs) | Cycles | MgCl2 |
---|---|---|---|---|---|
Housekeeping gene | |||||
EEF1A1 | Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC | 54.0 | 234 | 21 | 1× |
Chondrogenic marker genes | |||||
ACAN | Sense: GCCTTGAGCAGTTCACCTTC Antisense: CTCTTCTACGGGGACAGCAG | 54.0 | 400 | 35 | 1× |
COL2A1 | Sense: TTTCCCAGGTCAAGATGGTC Antisense: CTTCAGCACCTGTCCACCA | 51.0 | 155 | 31 | 1× |
SOX9 | Sense: ATCTGAAGAAGGAGAGCGAG Antisense: TCAGAAGTCTCCAGAGCTTG | 60.0 | 263 | 31 | 1× |
COMP | Sense: CAGGACGACTTTGATGCAGA Antisense: AAGCTGGAGCTGTCTGGTA | 54.0 | 312 | 32 | 1× |
VP Concentration (mg/mL) | TXA Concentration (mg/mL) | Abbreviation |
---|---|---|
3 | 10 | VP3TXA10 |
12 | 10 | VP12TXA10 |
50 | 10 | VP50TXA10 |
3 | 50 | VP3TXA50 |
12 | 50 | VP12TXA50 |
50 | 50 | VP50TXA50 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wagenbrenner, M.; Heinz, T.; Anderson, P.M.; Stratos, I.; Arnholdt, J.; Mayer-Wagner, S.; Horas, K.; Docheva, D.; Holzapfel, B.M.; Rudert, M.; et al. Does Combined Treatment with Tranexamic Acid and Vancomycin Affect Human Chondrocytes In Vitro? Pharmaceuticals 2024, 17, 1576. https://doi.org/10.3390/ph17121576
Wagenbrenner M, Heinz T, Anderson PM, Stratos I, Arnholdt J, Mayer-Wagner S, Horas K, Docheva D, Holzapfel BM, Rudert M, et al. Does Combined Treatment with Tranexamic Acid and Vancomycin Affect Human Chondrocytes In Vitro? Pharmaceuticals. 2024; 17(12):1576. https://doi.org/10.3390/ph17121576
Chicago/Turabian StyleWagenbrenner, Mike, Tizian Heinz, Philip M. Anderson, Ioannis Stratos, Joerg Arnholdt, Susanne Mayer-Wagner, Konstantin Horas, Denitsa Docheva, Boris M. Holzapfel, Maximilian Rudert, and et al. 2024. "Does Combined Treatment with Tranexamic Acid and Vancomycin Affect Human Chondrocytes In Vitro?" Pharmaceuticals 17, no. 12: 1576. https://doi.org/10.3390/ph17121576
APA StyleWagenbrenner, M., Heinz, T., Anderson, P. M., Stratos, I., Arnholdt, J., Mayer-Wagner, S., Horas, K., Docheva, D., Holzapfel, B. M., Rudert, M., & Weißenberger, M. (2024). Does Combined Treatment with Tranexamic Acid and Vancomycin Affect Human Chondrocytes In Vitro? Pharmaceuticals, 17(12), 1576. https://doi.org/10.3390/ph17121576