Combination Treatment of Resistant Acute Promyelocytic Leukemia Cells with Arsenic Trioxide and Anti-Apoptotic Gene Inhibitors
Abstract
1. Introduction
2. Results
2.1. Comparative Expression Pattern of Apoptotic Genes in ATO-Sensitive and ATO-Resistant APL Cells
2.2. High Expression of BCL2 in APL Cells Directly Correlates with Venetoclax Sensitivity
2.3. Synergistic Cytotoxic Effects of ATO with Venetoclax
2.4. SMAC Mimetics Induce Growth Inhibitory Effects in CL1-R
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Cell Culture Conditions
4.2. Drug Treatment and Survival Assay
4.3. PCR Array Profiling and RNA Expression Analysis
4.4. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
FW | RV | |
---|---|---|
APAF1 | AAGCTCTCCAAATTGAAAGG | CCTTCTAAAAGGGAATGATCTC |
BCL2 | GATTGTGGCCTTCTTTGAG | GTTCCACAAAGGCATCC |
BCL2A1 | CAAGAAACTTCTACGACAGC | AAGCCATTTTCCTCTTCTTG |
BIRC2 | CCAACAGAAGATGTTTCAGG | ATTATACCCCTGCAAATAGGG |
BIRC3 | ACAAGCAAGAGAACTGATTG | GATCTGAAACATCTTCTGTGG |
CD70 | AATCACACAGGACCTCAG | GTCACCTGGATGTGTACC |
GAPDH | TCGGAGTCAACGGATTTG | CAACAATATCCACTTTACCAGAG |
NOL3 | GTAGACAAGGGAACATTTGAG | ATCTACTCTTATGCCTCTGG |
IL10 | GCCTTTAATAAGCTCCAAGAG | ATCTTCATTGTCATGTAGGC |
XIAP | AGTGTCTGGTAAGAACTACTG | CCCATTCGTATAGCTTCTTG |
BCL2 | ABL1 | |
---|---|---|
FW | ACCTGCACACCTGGATCCA | TGGAGATAACACTCTAAGCATAATAAAGGT |
Probe | ATAACGGAGGCTGGGATG | CCATTTTTGGTTTGGGCTTCACACCATT |
RV | GGGCCGTACAGTTCCACAAA | GATGTAGTTGCTTGGGACCCA |
References
- Noguera, N.I.; Catalano, G.; Banella, C.; Divona, M.; Faraoni, I.; Ottone, T.; Arcese, W.; Voso, M.T. Acute Promyelocytic Leukemia: Update on the Mechanisms of Leukemogenesis, Resistance and on Innovative Treatment Strategies. Cancers 2019, 11, 1591. [Google Scholar] [CrossRef]
- Sanz, M.A.; Fenaux, P.; Tallman, M.S.; Estey, E.H.; Löwenberg, B.; Naoe, T.; Lengfelder, E.; Döhner, H.; Burnett, A.K.; Chen, S.-J.; et al. Management of acute promyelocytic leukemia: Updated recommendations from an expert panel of the European LeukemiaNet. Blood 2019, 133, 1630–1643. [Google Scholar] [CrossRef]
- Pollyea, D.A.; Bixby, D.; Perl, A.; Bhatt, V.R.; Altman, J.K.; Appelbaum, F.R.; De Lima, M.; Fathi, A.T.; Foran, J.M.; Gojo, I.; et al. Acute Myeloid Leukemia, Version 2.2021 Featured Updates to the NCCN Guidelines. JNCCN J. Natl. Compr. Cancer Netw. 2021, 19, 16–27. [Google Scholar] [CrossRef]
- Lo-Coco, F.; Avvisati, G.; Vignetti, M.; Thiede, C.; Orlando, S.M.; Iacobelli, S.; Ferrara, F.; Fazi, P.; Cicconi, L.; Di Bona, E.; et al. Retinoic Acid and Arsenic Trioxide for Acute Promyelocytic Leukemia. N. Engl. J. Med. 2013, 369, 111–121. [Google Scholar] [CrossRef]
- Efficace, F.; Platzbecker, U.; Breccia, M.; Cottone, F.; Carluccio, P.; Salutari, P.; Di Bona, E.; Borlenghi, E.; Autore, F.; Levato, L.; et al. Long-term quality of life of patients with acute promyelocytic leukemia treated with arsenic trioxide vs chemotherapy. Blood Adv. 2021, 5, 4370–4379. [Google Scholar] [CrossRef]
- Chen, G.; Zhu, J.; Shi, X.; Ni, J.; Zhong, H.; Si, G.; Jin, X.; Tang, W.; Li, X.; Xong, S.; et al. In vitro studies on cellular and molecular mechanisms of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with downregulation of Bcl-2 expression and modulation of PML-RAR alpha/PML proteins. Blood 1996, 88, 1052–1061. [Google Scholar] [CrossRef]
- Giansanti, M.; De Gabrieli, A.; Prete, S.P.; Ottone, T.; Divona, M.D.; Karimi, T.; Ciccarone, F.; Voso, M.T.; Graziani, G.; Faraoni, I. Poly(ADP-Ribose) Polymerase Inhibitors for Arsenic Trioxide–Resistant Acute Promyelocytic Leukemia: Synergistic In Vitro Antitumor Effects with Hypomethylating Agents or High-Dose Vitamin C. J. Pharmacol. Exp. Ther. 2021, 377, 385–397. [Google Scholar] [CrossRef]
- Maimaitiyiming, Y.; Wang, Q.Q.; Hsu, C.H.; Naranmandura, H. Arsenic induced epigenetic changes and relevance to treatment of acute promyelocytic leukemia and beyond. Toxicol. Appl. Pharmacol. 2020, 406, 115212. [Google Scholar] [CrossRef]
- Gurnari, C.; De Bellis, E.; DIvona, M.; Ottone, T.; Lavorgna, S.; Voso, M.T. When Poisons Cure: The Case of Arsenic in Acute Promyelocytic Leukemia. Chemotherapy 2020, 64, 238–247. [Google Scholar] [CrossRef]
- Chen, Z.; Guidez, F.; Rousselot, P.; Agadir, A.; Chen, S.J.; Wang, Z.Y.; Degos, L.; Zelent, A.; Waxman, S.; Chomienne, C. PLZF-RAR alpha fusion proteins generated from the variant t(11;17)(q23;q21) translocation in acute promyelocytic leukemia inhibit ligand-dependent transactivation of wild-type retinoic acid receptors. Proc. Natl. Acad. Sci. USA 1994, 91, 1178–1182. [Google Scholar] [CrossRef]
- Ciangola, G.; Gurnari, C.; Paterno, G.; Mirabile, M.; Angelini, M.; Lavorgna, S.; Ottone, T.; Travaglini, S.; Cicconi, L.; LoCoco, F. STAT5b-RARa-positive acute myeloid leukemia: Diagnostic and therapeutic challenges of a rare AML subtype. Leuk. Res. 2019, 78, 21–23. [Google Scholar] [CrossRef] [PubMed]
- Goto, E.; Tomita, A.; Hayakawa, F.; Atsumi, A.; Kiyoi, H.; Naoe, T. Missense mutations in PML-RARA are critical for the lack of responsiveness to arsenic trioxide treatment. Blood 2011, 118, 1600–1609. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.-H.; Qin, Y.-Z.; Huang, X.-J. Resistance to Arsenic Therapy in Acute Promyelocytic Leukemia. N. Engl. J. Med. 2014, 370, 1864–1866. [Google Scholar] [CrossRef]
- Fulda, S. Inhibitor of Apoptosis (IAP) proteins in hematological malignancies: Molecular mechanisms and therapeutic opportunities. Leukemia 2014, 28, 1414–1422. [Google Scholar] [CrossRef]
- Ferrarini, I.; Rigo, A.; Visco, C. The mitochondrial anti-apoptotic dependencies of hematologic malignancies: From disease biology to advances in precision medicine. Haematologica 2022, 107, 790–802. [Google Scholar] [CrossRef]
- Garciaz, S.; Miller, T.; Collette, Y.; Vey, N. Targeting regulated cell death pathways in acute myeloid leukemia. Cancer Drug Resist. 2023, 6, 151–168. [Google Scholar] [CrossRef]
- Newton, K.; Strasser, A.; Kayagaki, N.; Dixit, V.M. Cell death. Cell 2024, 187, 235–256. [Google Scholar] [CrossRef]
- Hallek, M.; Al-Sawaf, O. Chronic lymphocytic leukemia: 2022 update on diagnostic and therapeutic procedures. Am. J. Hematol. 2021, 96, 1679–1705. [Google Scholar] [CrossRef]
- LaCasse, E.C.; Mahoney, D.J.; Cheung, H.H.; Plenchette, S.; Baird, S.; Korneluk, R.G. IAP-targeted therapies for cancer. Oncogene 2008, 27, 6252–6275. [Google Scholar] [CrossRef]
- Roberts, A.W.; Davids, M.S.; Pagel, J.M.; Kahl, B.S.; Puvvada, S.D.; Gerecitano, J.F.; Kipps, T.J.; Anderson, M.A.; Brown, J.R.; Gressick, L.; et al. Targeting BCL2 with Venetoclax in Relapsed Chronic Lymphocytic Leukemia. N. Engl. J. Med. 2016, 374, 311–322. [Google Scholar] [CrossRef]
- Davids, M.S.; Roberts, A.W.; Seymour, J.F.; Pagel, J.M.; Kahl, B.S.; Wierda, W.G.; Puvvada, S.; Kipps, T.J.; Anderson, M.A.; Salem, A.H.; et al. Phase i first-in-human study of venetoclax in patients with relapsed or refractory non-hodgkin lymphoma. J. Clin. Oncol. 2017, 35, 826–833. [Google Scholar] [CrossRef] [PubMed]
- Chou, T.-C. Drug Combination Studies and Their Synergy Quantification Using the Chou-Talalay Method. Cancer Res. 2010, 70, 440–446. [Google Scholar] [CrossRef] [PubMed]
- Salvesen, G.S.; Duckett, C.S. IAP proteins: Blocking the road to death’s door. Nat. Rev. Mol. Cell Biol. 2002, 3, 401–410. [Google Scholar] [CrossRef] [PubMed]
- Kikuchi, S.; Sugama, Y.; Takada, K.; Kamihara, Y.; Wada, A.; Arihara, Y.; Nakamura, H.; Sato, T. Simultaneous XIAP and cIAP1/2 inhibition by a dimeric SMAC mimetic AZD5582 induces apoptosis in multiple myeloma. J. Pharmacol. Sci. 2024, 154, 30–36. [Google Scholar] [CrossRef]
- Kumar, S.; Yedjou, C.G.; Tchounwou, P.B. Arsenic trioxide induces oxidative stress, DNA damage, and mitochondrial pathway of apoptosis in human leukemia (HL-60) cells. J. Exp. Clin. Cancer Res. 2014, 33, 42. [Google Scholar] [CrossRef]
- Saraiva, M.; Vieira, P.; O’Garra, A. Biology and therapeutic potential of interleukin-10. J. Exp. Med. 2020, 217, e20190418. [Google Scholar] [CrossRef]
- Zhou, J.-H.; Broussard, S.R.; Strle, K.; Freund, G.G.; Johnson, R.W.; Dantzer, R.; Kelley, K.W. IL-10 Inhibits Apoptosis of Promyeloid Cells by Activating Insulin Receptor Substrate-2 and Phosphatidylinositol 3′-Kinase. J. Immunol. 2001, 167, 4436–4442. [Google Scholar] [CrossRef]
- Flieswasser, T.; Van den Eynde, A.; Van Audenaerde, J.; De Waele, J.; Lardon, F.; Riether, C.; de Haard, H.; Smits, E.; Pauwels, P.; Jacobs, J. The CD70-CD27 axis in oncology: The new kids on the block. J. Exp. Clin. Cancer Res. 2022, 41, 12. [Google Scholar] [CrossRef]
- Riether, C.; Schürch, C.M.; Bührer, E.D.; Hinterbrandner, M.; Huguenin, A.L.; Hoepner, S.; Zlobec, I.; Pabst, T.; Radpour, R.; Ochsenbein, A.F. CD70/CD27 signaling promotes blast stemness and is a viable therapeutic target in acute myeloid leukemia. J. Exp. Med. 2017, 214, 359–380. [Google Scholar] [CrossRef]
- Riether, C.; Pabst, T.; Höpner, S.; Bacher, U.; Hinterbrandner, M.; Banz, Y.; Müller, R.; Manz, M.G.; Gharib, W.H.; Francisco, D.; et al. Targeting CD70 with cusatuzumab eliminates acute myeloid leukemia stem cells in patients treated with hypomethylating agents. Nat. Med. 2020, 26, 1459–1467. [Google Scholar] [CrossRef]
- Ansell, S.M.; Flinn, I.; Taylor, M.H.; Sikic, B.I.; Brody, J.; Nemunaitis, J.; Feldman, A.; Hawthorne, T.R.; Rawls, T.; Keler, T.; et al. Safety and activity of varlilumab, a novel and first-in-class agonist anti-CD27 antibody, for hematologic malignancies. Blood Adv. 2020, 4, 1917–1926. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Li, Q.; An, Y.; Chen, X.; Liu, Z.; Li, Z.; Gao, J.; Aung, L.H.H.; Li, P. Role of apoptosis repressor with caspase recruitment domain (ARC) in cancer (Review). Oncol. Lett. 2019, 18, 5691–5698. [Google Scholar] [CrossRef] [PubMed]
- Carter, B.Z.; Qiu, Y.H.; Zhang, N.; Coombes, K.R.; Mak, D.H.; Thomas, D.A.; Ravandi, F.; Kantarjian, H.M.; Koller, E.; Andreeff, M.; et al. Expression of ARC (apoptosis repressor with caspase recruitment domain), an antiapoptotic protein, is strongly prognostic in AML. Blood 2011, 117, 780–787. [Google Scholar] [CrossRef] [PubMed]
- Mousa, N.O.; Gado, M.; Assem, M.M.; Dawood, K.M.; Osman, A. Expression profiling of some Acute Myeloid Leukemia—Associated markers to assess their diagnostic / prognostic potential. Genet. Mol. Biol. 2021, 44, 1–9. [Google Scholar] [CrossRef]
- Medina-Ramirez, C.M.; Goswami, S.; Smirnova, T.; Bamira, D.; Benson, B.; Ferrick, N.; Segall, J.; Pollard, J.W.; Kitsis, R.N. Apoptosis Inhibitor ARC Promotes Breast Tumorigenesis, Metastasis, and Chemoresistance. Cancer Res. 2011, 71, 7705–7715. [Google Scholar] [CrossRef]
- Shakeri, R.; Kheirollahi, A.; Davoodi, J. Apaf-1: Regulation and function in cell death. Biochimie 2017, 135, 111–125. [Google Scholar] [CrossRef]
- Di Pasqua, L.G.; Abdallah, M.M.; Feletti, F.; Vairetti, M.; Ferrigno, A. Venetoclax-Related Neutropenia in Leukemic Patients: A Comprehensive Review of the Underlying Causes, Risk Factors, and Management. Pharmaceuticals 2024, 17, 484. [Google Scholar] [CrossRef]
- Bensi, L.; Longo, R.; Vecchi, A.; Messora, C.; Garagnani, L.; Bernardi, S.; Grazia Tamassia, M.; Sacchi, S. BCL-2 oncoprotein expression in acute myeloid leukemia. Haematologica 1995, 80, 98–102. [Google Scholar]
- Lauria, F.; Raspadori, D.; Rondelli, D.; Ventura, M.; Fiacchini, M.; Visani, G.; Forconi, F.; Tura, S. High bcl-2 expression in acute myeloid leukemia cells correlates with CD34 positivity and complete remission rate. Leukemia 1997, 11, 2075–2078. [Google Scholar] [CrossRef]
- Bhatt, S.; Pioso, M.S.; Olesinski, E.A.; Yilma, B.; Ryan, J.A.; Mashaka, T.; Leutz, B.; Adamia, S.; Zhu, H.; Kuang, Y.; et al. Reduced Mitochondrial Apoptotic Priming Drives Resistance to BH3 Mimetics in Acute Myeloid Leukemia. Cancer Cell 2020, 38, 872–890.e6. [Google Scholar] [CrossRef]
- Touzeau, C.; Ryan, J.; Guerriero, J.; Moreau, P.; Chonghaile, T.N.; Le Gouill, S.; Richardson, P.; Anderson, K.; Amiot, M.; Letai, A. BH3 profiling identifies heterogeneous dependency on Bcl-2 family members in multiple myeloma and predicts sensitivity to BH3 mimetics. Leukemia 2016, 30, 761–764. [Google Scholar] [CrossRef] [PubMed]
- de Jong, M.R.W.; Langendonk, M.; Reitsma, B.; Nijland, M.; van den Berg, A.; Ammatuna, E.; Visser, L.; van Meerten, T. Heterogeneous Pattern of Dependence on Anti-Apoptotic BCL-2 Family Proteins upon CHOP Treatment in Diffuse Large B-Cell Lymphoma. Int. J. Mol. Sci. 2019, 20, 6036. [Google Scholar] [CrossRef] [PubMed]
- DiNardo, C.D.; Pratz, K.; Pullarkat, V.; Jonas, B.A.; Arellano, M.; Becker, P.S.; Frankfurt, O.; Konopleva, M.; Wei, A.H.; Kantarjian, H.M.; et al. Venetoclax combined with decitabine or azacitidine in treatment-naive, elderly patients with acute myeloid leukemia. Blood 2019, 133, 7–17. [Google Scholar] [CrossRef] [PubMed]
- DiNardo, C.D.; Jonas, B.A.; Pullarkat, V.; Thirman, M.J.; Garcia, J.S.; Wei, A.H.; Konopleva, M.; Döhner, H.; Letai, A.; Fenaux, P.; et al. Azacitidine and Venetoclax in Previously Untreated Acute Myeloid Leukemia. N. Engl. J. Med. 2020, 383, 617–629. [Google Scholar] [CrossRef]
- Wei, A.H.; Montesinos, P.; Ivanov, V.; DiNardo, C.D.; Novak, J.; Laribi, K.; Kim, I.; Stevens, D.A.; Fiedler, W.; Pagoni, M.; et al. Venetoclax plus LDAC for newly diagnosed AML ineligible for intensive chemotherapy: A phase 3 randomized placebo-controlled trial. Blood 2020, 135, 2137–2145. [Google Scholar] [CrossRef]
- Gangat, N.; Ilyas, R.; Johnson, I.M.; McCullough, K.; Al-Kali, A.; Alkhateeb, H.B.; Begna, K.H.; Mangaonkar, A.; Litzow, M.R.; Hogan, W.; et al. Outcome of patients with acute myeloid leukemia following failure of frontline venetoclax plus hypomethylating agent therapy. Haematologica 2023, 108, 3170–3174. [Google Scholar] [CrossRef]
- Li, Y.; Yu, J.; Xu, Q.; Zhang, K. Relapsed/refractory acute promyelocytic leukemia with RARA-LBD region mutation was salvaged by venetoclax: A case report. Medicine 2021, 100, e28076. [Google Scholar] [CrossRef]
- Li, H.; Xiang, X.; Ding, H.; Yu, J.; Xu, J.; Yuan, Y.; Wu, Y. Differentiation therapy using low-dose venetoclax in a variant acute promyelocytic leukaemia carrying ZBTB16-RARA. Br. J. Haematol. 2022, 199, 768–771. [Google Scholar] [CrossRef]
- Zhang, G.; Song, Y.; Wan, L.; Liu, K.; Qiu, S.; Wang, J.; Mi, Y. Treatment of STAT5b-RARA positive acute promyelocytic leukemia by Venetoclax combining with homoharringtonine, cytarabine: A case report and literature review. Blood Sci. 2022, 4, 93–96. [Google Scholar] [CrossRef]
- Xu, J.; Li, H.; Wang, Z.; Wang, M.; Li, Q.; Hang, X.; Xu, J.; Ji, J.; Chen, C.; Liu, Y.; et al. Venetoclax overcomes resistance to all-trans retinoic acid in a variant acute promyelocytic leukemia with TNRC18::RARA fusion. Mol. Carcinog. 2024, 63, 553–557. [Google Scholar] [CrossRef]
- Wang, Q.Q.; Wang, H.F.; Zhao, J.Z.; Naranmandura, H.; Jin, J.; Zhu, H.H. Venetoclax for arsenic-resistant acute promyelocytic leukaemia. Br. J. Haematol. 2022, 197, e58–e60. [Google Scholar] [CrossRef] [PubMed]
- Qi, P.; Wang, L.; Li, H.; Wu, Y.; Fan, J.; Huang, P.; Hou, B.; Liu, M.; Yang, J.; Liu, H.; et al. Venetoclax as a cytoreduction therapy for acute promyelocytic leukaemia: A single-centre experience. Br. J. Haematol. 2023, 203, 892–895. [Google Scholar] [CrossRef] [PubMed]
- Varfolomeev, E.; Blankenship, J.W.; Wayson, S.M.; Fedorova, A.V.; Kayagaki, N.; Garg, P.; Zobel, K.; Dynek, J.N.; Elliott, L.O.; Wallweber, H.J.A.; et al. IAP Antagonists Induce Autoubiquitination of c-IAPs, NF-κB Activation, and TNFα-Dependent Apoptosis. Cell 2007, 131, 669–681. [Google Scholar] [CrossRef] [PubMed]
- Cetraro, P.; Plaza-Diaz, J.; Mackenzie, A.; Abadía-Molina, F. A Review of the Current Impact of Inhibitors of Apoptosis Proteins and Their Repression in Cancer. Cancers 2022, 14, 1671. [Google Scholar] [CrossRef]
- Raponi, S.; Del Giudice, I.; Ilari, C.; Cafforio, L.; Messina, M.; Cappelli, L.V.; Bonina, S.; Piciocchi, A.; Marinelli, M.; Peragine, N.; et al. Biallelic BIRC3 inactivation in chronic lymphocytic leukaemia patients with 11q deletion identifies a subgroup with very aggressive disease. Br. J. Haematol. 2019, 185, 156–159. [Google Scholar] [CrossRef]
- Rossi, D.; Fangazio, M.; Rasi, S.; Vaisitti, T.; Monti, S.; Cresta, S.; Chiaretti, S.; Del Giudice, I.; Fabbri, G.; Bruscaggin, A.; et al. Disruption of BIRC3 associates with fludarabine chemorefractoriness in TP53 wild-type chronic lymphocytic leukemia. Blood 2012, 119, 2854–2862. [Google Scholar] [CrossRef]
- Frazzi, R. BIRC3 and BIRC5: Multi-faceted inhibitors in cancer. Cell Biosci. 2021, 11, 8. [Google Scholar] [CrossRef]
- Hess, C.J.; Berkhof, J.; Denkers, F.; Ossenkoppele, G.J.; Schouten, J.P.; Oudejans, J.J.; Waisfisz, Q.; Schuurhuis, G.J. Activated Intrinsic Apoptosis Pathway Is a Key Related Prognostic Parameter in Acute Myeloid Leukemia. J. Clin. Oncol. 2007, 25, 1209–1215. [Google Scholar] [CrossRef]
- Iaccarino, L.; Ottone, T.; Alfonso, V.; Cicconi, L.; Divona, M.; Lavorgna, S.; Travaglini, S.; Ferrantini, A.; Falconi, G.; Baer, C.; et al. Mutational landscape of patients with acute promyelocytic leukemia at diagnosis and relapse. Am. J. Hematol. 2019, 94, 1091–1097. [Google Scholar] [CrossRef]
- Gabert, J.; Beillard, E.; van der Velden, V.H.J.; Bi, W.; Grimwade, D.; Pallisgaard, N.; Barbany, G.; Cazzaniga, G.; Cayuela, J.M.; Cavé, H.; et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia–A Europe Against Cancer Program. Leukemia 2003, 17, 2318–2357. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Giansanti, M.; Ottone, T.; Travaglini, S.; Voso, M.T.; Graziani, G.; Faraoni, I. Combination Treatment of Resistant Acute Promyelocytic Leukemia Cells with Arsenic Trioxide and Anti-Apoptotic Gene Inhibitors. Pharmaceuticals 2024, 17, 1529. https://doi.org/10.3390/ph17111529
Giansanti M, Ottone T, Travaglini S, Voso MT, Graziani G, Faraoni I. Combination Treatment of Resistant Acute Promyelocytic Leukemia Cells with Arsenic Trioxide and Anti-Apoptotic Gene Inhibitors. Pharmaceuticals. 2024; 17(11):1529. https://doi.org/10.3390/ph17111529
Chicago/Turabian StyleGiansanti, Manuela, Tiziana Ottone, Serena Travaglini, Maria Teresa Voso, Grazia Graziani, and Isabella Faraoni. 2024. "Combination Treatment of Resistant Acute Promyelocytic Leukemia Cells with Arsenic Trioxide and Anti-Apoptotic Gene Inhibitors" Pharmaceuticals 17, no. 11: 1529. https://doi.org/10.3390/ph17111529
APA StyleGiansanti, M., Ottone, T., Travaglini, S., Voso, M. T., Graziani, G., & Faraoni, I. (2024). Combination Treatment of Resistant Acute Promyelocytic Leukemia Cells with Arsenic Trioxide and Anti-Apoptotic Gene Inhibitors. Pharmaceuticals, 17(11), 1529. https://doi.org/10.3390/ph17111529