Magnolol Inhibits High Fructose-Induced Podocyte Inflammation via Downregulation of TKFC/Sp1/HDAC4/Notch1 Activation
Abstract
1. Introduction
2. Results
2.1. Magnolol Attenuated Glomerular Inflammatory Injury in High Fructose-Fed Rats with Decreased TNF-α and NICD1
2.2. Magnolol Mitigated Inflammatory Injury in Podocytes with Downregulation of TNF-α and NICD1
2.3. High Sp1 Expression Promoted HDAC4 Expression and Then Drove Notch1 Signaling Pathway in High Fructose-Exposed Podocytes
2.4. Knockdown of TKFC Decreased HDAC4 Expression and Notch1 Pathway Activation to Alleviate Podocyte Inflammatory Response
2.5. Magnolol Attenuated High Fructose-Induced Inflammatory Injury Possibly by Inhibiting TKFC/Sp1/HDAC4/Notch1 Pathway in Glomeruli of Rats and HPCs
3. Discussion
4. Materials and Methods
4.1. Animal Treatment
4.2. Serum and Kidney Sample Collection
4.3. Cell Culture and Treatment
4.4. Quantitative Real-Time PCR (qRT-PCR) Assay
4.5. Western Blot Analysis
4.6. TKFC Knockdown by Small Interfering RNA (siRNA)
4.7. Immunofluorescence Assay
4.8. Chromatin Immunoprecipitation (ChIP) Assay
4.9. CCK-8 Assay
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shoham, D.A.; Durazo-Arvizu, R.; Kramer, H.; Luke, A.; Vupputuri, S.; Kshirsagar, A.; Cooper, R.S. Sugary soda consumption and albuminuria: Results from the National Health and Nutrition Examination Survey, 1999–2004. PLoS ONE 2008, 3, e3431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saldana, T.M.; Basso, O.; Darden, R.; Sandler, D.P. Carbonated beverages and chronic kidney disease. Epidemiology 2007, 18, 501–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakagawa, T.; Tuttle, K.R.; Short, R.A.; Johnson, R.J. Hypothesis: Fructose-induced hyperuricemia as a causal mechanism for the epidemic of the metabolic syndrome. Nat. Clin. Pract. Nephrol. 2005, 1, 80–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Liu, Q.; Meng, X.; Zhao, L.; Zheng, X.; Feng, W. Catalpol ameliorates fructose-induced renal inflammation by inhibiting TLR4/MyD88 signaling and uric acid reabsorption. Eur. J. Pharmacol. 2024, 967, 176356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oudot, C.; Lajoix, A.D.; Jover, B.; Rugale, C. Dietary sodium restriction prevents kidney damage in high fructose-fed rats. Kidney Int. 2013, 83, 674–683. [Google Scholar] [CrossRef] [Scilit]
- Daehn, I.S.; Duffield, J.S. The glomerular filtration barrier: A structural target for novel kidney therapies. Nat. Rev. Drug Discov. 2021, 20, 770–788. [Google Scholar] [CrossRef] [Scilit]
- Nagata, M. Podocyte injury and its consequences. Kidney Int. 2016, 89, 1221–1230. [Google Scholar] [CrossRef] [Scilit]
- Reidy, K.; Kang, H.M.; Hostetter, T.; Susztak, K. Molecular mechanisms of diabetic kidney disease. J. Clin. Investig. 2014, 124, 2333–2340. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.F.; Zhou, Z.Y.; Liu, Y.Z.; Wu, L.; Nie, B.B.; Huang, L.; Zhang, C. Role of Sp1 in atherosclerosis. Mol. Biol. Rep. 2022, 49, 9893–9902. [Google Scholar] [CrossRef] [Scilit]
- Wei, L.A.; Gou, X.L.; Su, B.N.; Han, H.Q.; Guo, T.T.; Liu, L.; Wang, L.; Zhang, L.A.; Chen, W.B. Mahuang Decoction Attenuates Airway Inflammation and Remodeling in Asthma via Suppression of the SP1/FGFR3/PI3K/AKT Axis. Drug Des. Dev. Ther. 2022, 16, 2833–2850. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.X.; Li, Y.Q.; Huang, X.R.; Wei, L.H.; Chen, H.Y.; Shi, Y.J.; Heuchel, R.L.; Lan, H.Y. Disruption of Smad7 Promotes ANG II-Mediated Renal Inflammation and Fibrosis via Sp1-TGF-β/Smad3-NF.κB-Dependent Mechanisms in Mice. PLoS ONE 2013, 8, e53573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, Q.P.; Dong, Z. HDAC4 blocks autophagy to trigger podocyte injury: Non-epigenetic action in diabetic nephropathy. Kidney Int. 2014, 86, 666–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Liu, J.; Zhen, J.; Zhang, C.; Wan, Q.; Liu, G.; Wei, X.; Zhang, Y.; Wang, Z.; Han, H.; et al. Histone deacetylase 4 selectively contributes to podocyte injury in diabetic nephropathy. Kidney Int. 2014, 86, 712–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, C.L.; Lee, P.H.; Hsu, Y.C.; Lei, C.C.; Ko, J.Y.; Chuang, P.C.; Huang, Y.T.; Wang, S.Y.; Wu, S.L.; Chen, Y.S.; et al. MicroRNA-29a Promotion of Nephrin Acetylation Ameliorates Hyperglycemia-Induced Podocyte Dysfunction. J. Am. Soc. Nephrol. 2014, 25, 1698–1709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.M.; Wang, X.; Li, C.X.; Liu, X.Y.; Guo, X.J.; Li, Y.; Chen, Y.L.; Ye, H.X.; Chen, H.S. SP1 Promotes HDAC4 Expression and Inhibits HMGB1 Expression to Reduce Intestinal Barrier Dysfunction, Oxidative Stress, and Inflammatory Response after Sepsis. J. Innate Immun. 2022, 14, 366–379. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Zhang, Q.; Liu, S.; Chen, Y.; Li, R.; Lin, T.; Yu, C.; Zhang, H.; Huang, Z.; Zhao, X.; et al. DNA methyltransferase 1 may be a therapy target for attenuating diabetic nephropathy and podocyte injury. Kidney Int. 2017, 92, 140–153. [Google Scholar] [CrossRef] [Scilit]
- Asanuma, K.; Trejo, J.A.O.; Tanaka, E. The role of Notch signaling in kidney podocytes. Clin. Exp. Nephrol. 2017, 21, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Zhou, B.H.; Lin, W.L.; Long, Y.L.; Yang, Y.K.; Zhang, H.; Wu, K.M.; Chu, Q. Notch signaling pathway: Architecture, disease, and therapeutics. Signal Transduct. Target. Ther. 2022, 7, 95. [Google Scholar] [CrossRef] [Scilit]
- Murea, M.; Park, J.K.; Sharma, S.; Kato, H.; Gruenwald, A.; Niranjan, T.; Si, H.; Thomas, D.B.; Pullman, J.M.; Melamed, M.L.; et al. Expression of Notch pathway proteins correlates with albuminuria, glomerulosclerosis, and renal function. Kidney Int. 2010, 78, 514–522. [Google Scholar] [CrossRef] [Scilit]
- Niranjan, T.; Bielesz, B.; Gruenwald, A.; Ponda, M.P.; Kopp, J.B.; Thomas, D.B.; Susztak, K. The Notch pathway in podocytes plays a role in the development of glomerular disease. Nat. Med. 2008, 14, 290–298. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.; Jiang, T.; Zhang, S.; Huang, M.; Zhu, Y.; Chen, L.; Zheng, Y.; Zhang, D.; Yu, H.; Yao, G.; et al. Blockade of Notch1 Signaling Alleviated Podocyte Injury in Lupus Nephritis via Inhibition of NLRP3 Inflammasome Activation. Inflammation 2024, 47, 649–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheng, X.; Zuo, X.; Liu, X.; Zhou, Y.; Sun, X. Crosstalk between TLR4 and Notch1 signaling in the IgA nephropathy during inflammatory response. Int. Urol. Nephrol. 2018, 50, 779–785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hannou, S.A.; Haslam, D.E.; McKeown, N.M.; Herman, M.A. Fructose metabolism and metabolic disease. J. Clin. Investig. 2018, 128, 545–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Li, T.; Liao, Y.; Wang, Y.; Gao, Y.; Hu, H.; Huang, H.; Wu, F.; Chen, Y.G.; Xu, S.; et al. Triose Kinase Controls the Lipogenic Potential of Fructose and Dietary Tolerance. Cell Metab. 2020, 32, 605–618.e607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, C.; Douard, V.; Yu, S.; Tharabenjasin, P.; Gao, N.; Ferraris, R.P. Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2015, 309, R499–R509. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Li, Y.; Zeng, Y.; Tian, B.; Qu, X.; Yuan, Q.; Song, Y. Pharmacology, Toxicity, Bioavailability, and Formulation of Magnolol: An Update. Front. Pharmacol. 2021, 12, 632767. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Fu, W.; Chen, H.; You, S.; Liu, X.; Yang, Y.; Wei, Y.; Huang, J.; Rui, W. Magnolol attenuates the inflammation and enhances phagocytosis through the activation of MAPK, NF-κB signal pathways in vitro and in vivo. Mol. Immunol. 2019, 105, 96–106. [Google Scholar] [CrossRef] [Scilit]
- Sohn, E.J.; Kim, C.S.; Kim, Y.S.; Jung, D.H.; Jang, D.S.; Lee, Y.M.; Kim, J.S. Effects of magnolol (5,5′-diallyl-2,2′-dihydroxybiphenyl) on diabetic nephropathy in type 2 diabetic Goto-Kakizaki rats. Life Sci. 2007, 80, 468–475. [Google Scholar] [CrossRef] [Scilit]
- Garg, P. A Review of Podocyte Biology. Am. J. Nephrol. 2018, 47 (Suppl. S1), 3–13. [Google Scholar] [CrossRef] [Scilit]
- Perysinaki, G.S.; Moysiadis, D.K.; Bertsias, G.; Giannopoulou, I.; Kyriacou, K.; Nakopoulou, L.; Boumpas, D.T.; Daphnis, E. Podocyte main slit diaphragm proteins, nephrin and podocin, are affected at early stages of lupus nephritis and correlate with disease histology. Lupus 2011, 20, 781–791. [Google Scholar] [CrossRef] [Scilit]
- Ren, Z.; Liang, W.; Chen, C.; Yang, H.; Singhal, P.C.; Ding, G. Angiotensin II induces nephrin dephosphorylation and podocyte injury: Role of caveolin-1. Cell. Signal. 2012, 24, 443–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salemkour, Y.; Yildiz, D.; Dionet, L.; t Hart, D.C.; Verheijden, K.A.T.; Saito, R.; Mahtal, N.; Delbet, J.D.; Letavernier, E.; Rabant, M.; et al. Podocyte Injury in Diabetic Kidney Disease in Mouse Models Involves TRPC6-mediated Calpain Activation Impairing Autophagy. J. Am. Soc. Nephrol. 2023, 34, 1823–1842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, L.; Tan, W.; Pan, X.; Tian, E.; Wu, Z.; Yang, J. Metabolic Syndrome-Related Kidney Injury: A Review and Update. Front. Endocrinol. 2022, 13, 904001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, H.; Tang, C.; Wang, W.; Pan, Y.; Jiao, R.; Kong, L. Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway. Pharmaceutics 2022, 14, 2202. [Google Scholar] [CrossRef] [Scilit]
- Li, T.S.; Chen, L.; Wang, S.C.; Yang, Y.Z.; Xu, H.J.; Gu, H.M.; Zhao, X.J.; Dong, P.; Pan, Y.; Shang, Z.Q.; et al. Magnesium isoglycyrrhizinate ameliorates fructose-induced podocyte apoptosis through downregulation of miR-193a to increase WT1. Biochem. Pharmacol. 2019, 166, 139–152. [Google Scholar] [CrossRef] [Scilit]
- Wortmann, S.B.; Meunier, B.; Mestek-Boukhibar, L.; van den Broek, F.; Maldonado, E.M.; Clement, E.; Weghuber, D.; Spenger, J.; Jaros, Z.; Taha, F.; et al. Bi-allelic Variants in TKFC Encoding Triokinase/FMN Cyclase Are Associated with Cataracts and Multisystem Disease. Am. J. Hum. Genet. 2020, 106, 256–263. [Google Scholar] [CrossRef] [Scilit]
- Cohen, H.T.; Bossone, S.A.; Zhu, G.; McDonald, G.A.; Sukhatme, V.P. Sp1 is a critical regulator of the Wilms’ tumor-1 gene. J. Biol. Chem. 1997, 272, 2901–2913. [Google Scholar] [CrossRef] [Scilit]
- Kassimatis, T.I.; Nomikos, A.; Giannopoulou, I.; Lymperopoulos, A.; Moutzouris, D.A.; Varakis, I.; Nakopoulou, L. Transcription factor Sp1 expression is upregulated in human glomerulonephritis: Correlation with pSmad2/3 and p300 expression and renal injury. Ren. Fail. 2010, 32, 243–253. [Google Scholar] [CrossRef] [Scilit]
- Ha, Z.L.; Yu, Z.Y. Downregulation of miR-29b-3p aggravates podocyte injury by targeting HDAC4 in LPS-induced acute kidney injury. Kaohsiung J. Med. Sci. 2021, 37, 1069–1076. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.L.; Wang, F.S.; Hsu, Y.C.; Chen, C.N.; Tseng, M.J.; Saleem, M.A.; Chang, P.J.; Wang, J.Y. Modulation of notch-1 signaling alleviates vascular endothelial growth factor-mediated diabetic nephropathy. Diabetes 2010, 59, 1915–1925. [Google Scholar] [CrossRef] [Scilit]
- Lavoz, C.; Poveda, J.; Marquez-Exposito, L.; Rayego-Mateos, S.; Rodrigues-Diez, R.R.; Ortiz, A.; Egido, J.; Mezzano, S.; Ruiz-Ortega, M. Gremlin activates the Notch pathway linked to renal inflammation. Clin. Sci. 2018, 132, 1097–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hyndman, K.A. Histone Deacetylases in Kidney Physiology and Acute Kidney Injury. Semin. Nephrol. 2020, 40, 138–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noh, H.; Oh, E.Y.; Seo, J.Y.; Yu, M.R.; Kim, Y.O.; Ha, H.; Lee, H.B. Histone deacetylase-2 is a key regulator of diabetes- and transforming growth factor-β1-induced renal injury. Am. J. Physiol. Renal Physiol. 2009, 297, F729–F739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, L.; Ni, Z.; Qian, J.; Tomino, Y. Pravastatin inhibits carboxymethyllysine-induced monocyte chemoattractant protein 1 expression in podocytes via prevention of signalling events. Nephron Exp. Nephrol. 2007, 106, e1-10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabrini, G.; Bezzerri, V.; Mancini, I.; Nicolis, E.; Dechecchi, M.C.; Tamanini, A.; Lampronti, I.; Piccagli, L.; Bianchi, N.; Borgatti, M.; et al. Targeting transcription factor activity as a strategy to inhibit pro-inflammatory genes involved in cystic fibrosis: Decoy oligonucleotides and low-molecular weight compounds. Curr. Med. Chem. 2010, 17, 4392–4404. [Google Scholar] [CrossRef] [Scilit]
- Tang, Y.; Yan, J.H.; Ge, Z.W.; Fei, A.H.; Zhang, Y.C. LncRNA Gaplinc promotes the pyroptosis of vascular endothelial cells through SP1 binding to enhance NLRP3 transcription in atherosclerosis. Cell. Signal. 2022, 99, 110420. [Google Scholar] [CrossRef] [Scilit]
- Wu, M.; Yang, Z.; Zhang, C.; Shi, Y.; Han, W.; Song, S.; Mu, L.; Du, C.; Shi, Y. Inhibition of NLRP3 inflammasome ameliorates podocyte damage by suppressing lipid accumulation in diabetic nephropathy. Metabolism 2021, 118, 154748. [Google Scholar] [CrossRef] [Scilit]
- Usui, T.; Okada, M.; Mizuno, W.; Oda, M.; Ide, N.; Morita, T.; Hara, Y.; Yamawaki, H. HDAC4 mediates development of hypertension via vascular inflammation in spontaneous hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H1894–H1904. [Google Scholar] [CrossRef] [Scilit]
- Cui, W.P.; Wang, Y.W.; Chen, Q.; Sun, W.X.; Cai, L.; Tan, Y.; Kim, K.S.; Kim, K.H.; Kim, Y.H. Extract (BL153) Ameliorates Kidney Damage in a High Fat Diet-Induced Obesity Mouse Model. Oxidative Med. Cell. Longev. 2013, 2013, 367040. [Google Scholar] [CrossRef] [Scilit]
- Tang, C.Y.; Lai, C.C.; Huang, P.H.; Yang, A.H.; Chiang, S.C.; Huang, P.C.; Tseng, K.W.; Huang, C.H. Magnolol Reduces Renal Ischemia and Reperfusion Injury via Inhibition of Apoptosis. Am. J. Chin. Med. 2017, 45, 1421–1439. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Zhang, R.Y.; Song, L. Beneficial effect of magnolol on lupus nephritis in MRL/lpr mice by attenuating the NLRP3 inflammasome and NF-κB signaling pathway: A mechanistic analysis. Mol. Med. Rep. 2017, 16, 4817–4822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.C.; Chang, Y.L.; Wang, D.L.; Cheng, J.J. Herbal remedy magnolol suppresses IL-6-induced STAT3 activation and gene expression in endothelial cells. Br. J. Pharmacol. 2006, 148, 226–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, Y.; Liu, B.; Zhang, N.; Liu, Z.; Liang, D.; Li, F.; Cao, Y.; Feng, X.; Zhang, X.; Yang, Z. Magnolol inhibits lipopolysaccharide-induced inflammatory response by interfering with TLR4 mediated NF-κB and MAPKs signaling pathways. J. Ethnopharmacol. 2013, 145, 193–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Wang, Y.; Wu, D.; Li, S.; Wang, C.; Han, Z.; Wang, J.; Wang, K.; Yang, Z.; Wei, Z. Magnolol Prevents Acute Alcoholic Liver Damage by Activating PI3K/Nrf2/PPARγ and Inhibiting NLRP3 Signaling Pathway. Front. Pharmacol. 2019, 10, 1459. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.M.; Chen, S.H.; Liao, Y.W.; Yu, C.H.; Yu, C.C.; Hsieh, P.L. Magnolol ameliorates the accumulation of reactive oxidative stress and inflammation in diabetic periodontitis. J. Formos. Med. Assoc. 2021, 120, 1452–1458. [Google Scholar] [CrossRef] [Scilit]
- Goicoechea, M.; de Vinuesa, S.G.; Verdalles, U.; Ruiz-Caro, C.; Ampuero, J.; Rincon, A.; Arroyo, D.; Luno, J. Effect of allopurinol in chronic kidney disease progression and cardiovascular risk. Clin. J. Am. Soc. Nephrol. 2010, 5, 1388–1393. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.H.; Kang, L.L.; Ren, H.M.; Zhang, D.M.; Kong, L.D. Simiao pill ameliorates renal glomerular injury via increasing Sirt1 expression and suppressing NF-κB/NLRP3 inflammasome activation in high fructose-fed rats. J. Ethnopharmacol. 2015, 172, 108–117. [Google Scholar] [CrossRef] [Scilit]
- Saleem, M.A.; O’Hare, M.J.; Reiser, J.; Coward, R.J.; Inward, C.D.; Farren, T.; Xing, C.Y.; Ni, L.; Mathieson, P.W.; Mundel, P. A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J. Am. Soc. Nephrol. 2002, 13, 630–638. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Tang, Y.L.; Liu, Z.H.; Pan, Y.; Jiao, R.Q.; Kong, L.D. Atractylodin inhibits fructose-induced human podocyte hypermotility via anti-oxidant to down-regulate TRPC6/p-CaMK4 signaling. Eur. J. Pharmacol. 2021, 913, 174616. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Yang, J.; Wang, Y.M.; Ding, H.; Li, T.S.; Liu, Z.H.; Chen, L.; Jiao, R.Q.; Zhang, D.M.; Kong, L.D. IL-6/STAT3 signaling activation exacerbates high fructose-induced podocyte hypertrophy by ketohexokinase-A-mediated tristetraprolin down-regulation. Cell. Signal. 2021, 86, 110082. [Google Scholar] [CrossRef] [Scilit]








| Gene | Sequences (5′~3′) |
|---|---|
| TKFC | Forward: ACTGGGATCGGCTCAACT Reverse: CACCTTGTGTATAAGCACCGT |
| TNF-α | Forward: CCTGCTGCACTTTGGAGTGA Reverse: GAGGGTTTGCTACAACATGGG |
| HDAC4-promoter | Forward: TCCAGCAGCCAATGAGGTCC Reverse: TTCTCCCCACTCCAGCGTCG |
| β-actin | Forward: CTACCTCATGAAGATCCTCACCGA Reverse: TTCTCCTTAATGTCACGCACGATT |
| siRNA | Sequences (5′~3′) |
|---|---|
| TKFC siRNA | Forward: CCUUCACUGUCCUGAAGAAdTdT Reverse: UUCUUCAGGACAGUGAAGGdTdT |
| Control siRNA | Forward: UUCUCCGAACGUGUCACGUdTdT Reverse: ACGUGACACGUUCGGAGAAdTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Z.; Wang, Y.; Xing, Y.; Pan, S.; Wang, W.; Yang, J.; Wu, W.; Zhou, J.; Huang, L.; Liang, Q.; et al. Magnolol Inhibits High Fructose-Induced Podocyte Inflammation via Downregulation of TKFC/Sp1/HDAC4/Notch1 Activation. Pharmaceuticals 2024, 17, 1416. https://doi.org/10.3390/ph17111416
Zhou Z, Wang Y, Xing Y, Pan S, Wang W, Yang J, Wu W, Zhou J, Huang L, Liang Q, et al. Magnolol Inhibits High Fructose-Induced Podocyte Inflammation via Downregulation of TKFC/Sp1/HDAC4/Notch1 Activation. Pharmaceuticals. 2024; 17(11):1416. https://doi.org/10.3390/ph17111416
Chicago/Turabian StyleZhou, Ziang, Yumeng Wang, Yu Xing, Shuman Pan, Wanru Wang, Jie Yang, Wenyuan Wu, Jie Zhou, Luyi Huang, Qiongdan Liang, and et al. 2024. "Magnolol Inhibits High Fructose-Induced Podocyte Inflammation via Downregulation of TKFC/Sp1/HDAC4/Notch1 Activation" Pharmaceuticals 17, no. 11: 1416. https://doi.org/10.3390/ph17111416
APA StyleZhou, Z., Wang, Y., Xing, Y., Pan, S., Wang, W., Yang, J., Wu, W., Zhou, J., Huang, L., Liang, Q., Zhang, D., & Kong, L. (2024). Magnolol Inhibits High Fructose-Induced Podocyte Inflammation via Downregulation of TKFC/Sp1/HDAC4/Notch1 Activation. Pharmaceuticals, 17(11), 1416. https://doi.org/10.3390/ph17111416

