(R,R)-BD-AcAc2 Mitigates Chronic Colitis in Rats: A Promising Multi-Pronged Approach Modulating Inflammasome Activity, Autophagy, and Pyroptosis
Abstract
:1. Introduction
2. Results
2.1. The Impact of KE Ingestion and Intermittent Fasting on the Microscopic Characteristics of Chronic Colitis Induced by DSS
2.2. The Impact of KE Ingestion and Intermittent Fasting on the Mean Percentage Body Weight Change and Colon Weight/Length Ratio
2.3. The Impact of KE Ingestion and Intermittent Fasting on the Disease Activity Index and Macroscopic Damage Index
2.4. The Impact of KE Ingestion and Intermittent Fasting on the Survival Property
2.5. The Impact of KE Ingestion and Intermittent Fasting on Oxidative Stress Parameters
2.6. The Impact of KE Ingestion and Intermittent Fasting on the Plasma Levels of Β-Hydroxybutyrate
2.7. The Impact of KE Ingestion and Intermittent Fasting on Different Cytokines as Inflammation Markers
2.8. The Impact of KE Ingestion and Intermittent Fasting on the Activities of Each Mpo, Nfκb Dna Binding, Caspase-1, and the Levels of Active Caspase-3
2.9. The Impact of KE Ingestion and Intermittent Fasting on the mRNA Expression of ASC and NLRP3
2.10. The Impact of KE Ingestion and Intermittent Fasting on the Levels of NLRP3 and NGSDMD
2.11. The Impact of KE Ingestion and Intermittent Fasting on the Macroautophagy Markers
2.12. The Impact of KE Ingestion and Intermittent Fasting on Tight Junction Proteins
2.13. Correlation Analysis of the Measured Parameters
2.14. The Impact of KE Ingestion and Intermittent Fasting on Microbiome Composition
3. Discussion
4. Materials and Methods
4.1. Drugs and Chemicals
4.2. Animals
4.3. Induction of Chronic Colitis in Rats
4.4. Experimental Design
4.5. Rational of KE Dosing and Fasting Protocol
4.6. Assessment of the Weight/Length Colonic Ratio
4.7. Assessment of the Disease Activity Score (DAI)
4.8. Assessment of the Macroscopic Damage Index (MDI)
4.9. Sample Collection and Preparation
4.10. Histological Examination
4.11. Determination of ROS, Malondialdehyde (MDA), Superoxide Dismutase (SOD), and Reduced Glutathione (GSH)
4.12. Determination of Plasma β-Hydroxybutyrate
4.13. Determination of Tumor Necrosis Factor-Alpha (TNF-α), IL-6, IL-1β, IL-18, IL-10, and IL-4 Levels in Colon Tissue
4.14. Determination of Myeloperoxidase (MPO) Activity, NFκB DNA Binding Activity, Caspase-1 Activity, and Active Caspase-3
4.15. qRT-PCR Analysis for the mRNA Expression of Apoptosis-Associated Speck-like Protein Containing a CARD (ASC) and NLRP3
4.16. Determination of NLRP3 and NGSDMD
4.17. Determination of Beclin-1 (BECN1) and Sequestosome-1 (p62)
4.18. Determination of Zonula Occludens-1 (ZO-1), Occludin (OCLN), and Claudin-5 (CLDN5)
4.19. Detection of Gut Microbiota Using Conventional PCR
4.20. qRT-PCR for the Detection of the Relative Abundance of Fusobacteria, Bifidobacteria, Bacteroides, Clostridium, and Lactobacillus
4.21. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Wang, R.; Li, Z.; Liu, S.; Zhang, D. Global, regional and national burden of inflammatory bowel disease in 204 countries and territories from 1990 to 2019: A systematic analysis based on the Global Burden of Disease Study 2019. BMJ Open 2023, 13, e065186. [Google Scholar] [CrossRef]
- Jairath, V.; Feagan, B.G. Global burden of inflammatory bowel disease. Lancet. Gastroenterol. Hepatol. 2020, 5, 2–3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eaden, J.A.; Abrams, K.R.; Mayberry, J.F. The risk of colorectal cancer in ulcerative colitis: A meta-analysis. Gut 2001, 48, 526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weimers, P.; Vedel Ankersen, D.; Lophaven, S.; Bonderup, O.K.; Münch, A.; Løkkegaard, E.C.L.; Munkholm, P.; Burisch, J. Disease Activity Patterns, Mortality, and Colorectal Cancer Risk in Microscopic Colitis: A Danish Nationwide Cohort Study, 2001 to 2016. J. Crohn’s Colitis 2020, 15, 594–602. [Google Scholar] [CrossRef] [PubMed]
- Ramos, L.; Teo-Loy, J.; Barreiro-de Acosta, M. Disease clearance in ulcerative colitis: Setting the therapeutic goals for future in the treatment of ulcerative colitis. Front. Med. 2022, 9, 1102420. [Google Scholar] [CrossRef]
- Cavalu, S.; Sharaf, H.; Saber, S.; Youssef, M.E.; Abdelhamid, A.M.; Mourad, A.A.E.; Ibrahim, S.; Allam, S.; Elgharabawy, R.M.; El-Ahwany, E.; et al. Ambroxol, a mucolytic agent, boosts HO-1, suppresses NF-κB, and decreases the susceptibility of the inflamed rat colon to apoptosis: A new treatment option for treating ulcerative colitis. FASEB J. 2022, 36, e22496. [Google Scholar] [CrossRef]
- Liu, L.; Dong, Y.; Ye, M.; Jin, S.; Yang, J.; Joosse, M.E.; Sun, Y.; Zhang, J.; Lazarev, M.; Brant, S.R.; et al. The Pathogenic Role of NLRP3 Inflammasome Activation in Inflammatory Bowel Diseases of Both Mice and Humans. J. Crohn’s Colitis 2017, 11, 737–750. [Google Scholar] [CrossRef]
- Franchi, L.; Muñoz-Planillo, R.; Núñez, G. Sensing and reacting to microbes through the inflammasomes. Nat. Immunol. 2012, 13, 325–332. [Google Scholar] [CrossRef] [Green Version]
- Zhou, R.; Tardivel, A.; Thorens, B.; Choi, I.; Tschopp, J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat. Immunol. 2010, 11, 136–140. [Google Scholar] [CrossRef]
- Kayagaki, N.; Stowe, I.B.; Lee, B.L.; O’Rourke, K.; Anderson, K.; Warming, S.; Cuellar, T.; Haley, B.; Roose-Girma, M.; Phung, Q.T.; et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature 2015, 526, 666–671. [Google Scholar] [CrossRef]
- Shi, J.; Zhao, Y.; Wang, K.; Shi, X.; Wang, Y.; Huang, H.; Zhuang, Y.; Cai, T.; Wang, F.; Shao, F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 2015, 526, 660–665. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Wang, Z.; Chen, Y.; Guo, Q.; Dong, Y. Interactions between gut microbes and NLRP3 inflammasome in the gut-brain axis. Comput. Struct. Biotechnol. J. 2023, 21, 2215–2227. [Google Scholar] [CrossRef]
- Saber, S.; Abd El-Fattah, E.E.; Yahya, G.; Gobba, N.A.; Maghmomeh, A.O.; Khodir, A.E.; Mourad, A.A.E.; Saad, A.S.; Mohammed, H.G.; Nouh, N.A.; et al. A Novel Combination Therapy Using Rosuvastatin and Lactobacillus Combats Dextran Sodium Sulfate-Induced Colitis in High-Fat Diet-Fed Rats by Targeting the TXNIP/NLRP3 Interaction and Influencing Gut Microbiome Composition. Pharmaceuticals 2021, 14, 341. [Google Scholar] [CrossRef]
- Kobayashi, S. Choose Delicately and Reuse Adequately: The Newly Revealed Process of Autophagy. Biol. Pharm. Bull. 2015, 38, 1098–1103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abd El-Fattah, E.E.; Saber, S.; Youssef, M.E.; Eissa, H.; El-Ahwany, E.; Amin, N.A.; Alqarni, M.; Batiha, G.E.-S.; Obaidullah, A.J.; Kaddah, M.M.Y.; et al. AKT-AMPKα-mTOR-dependent HIF-1α Activation is a New Therapeutic Target for Cancer Treatment: A Novel Approach to Repositioning the Antidiabetic Drug Sitagliptin for the Management of Hepatocellular Carcinoma. Front. Pharmacol. 2022, 12, 4018. [Google Scholar] [CrossRef] [PubMed]
- Macias-Ceja, D.C.; Barrachina, M.D.; Ortiz-Masià, D. Autophagy in intestinal fibrosis: Relevance in inflammatory bowel disease. Front. Pharmacol. 2023, 14, 1170436. [Google Scholar] [CrossRef]
- Youssef, M.E.; Abd El-Fattah, E.E.; Abdelhamid, A.M.; Eissa, H.; El-Ahwany, E.; Amin, N.A.; Hetta, H.F.; Mahmoud, M.H.; Batiha, G.E.-S.; Gobba, N.; et al. Interference With the AMPKα/mTOR/NLRP3 Signaling and the IL-23/IL-17 Axis Effectively Protects Against the Dextran Sulfate Sodium Intoxication in Rats: A New Paradigm in Empagliflozin and Metformin Reprofiling for the Management of Ulcerative Colitis. Front. Pharmacol. 2021, 12, 719984. [Google Scholar] [CrossRef]
- Nasr, M.; Cavalu, S.; Saber, S.; Youssef, M.E.; Abdelhamid, A.M.; Elagamy, H.I.; Kamal, I.; Gaafar, A.G.A.; El-Ahwany, E.; Amin, N.A.; et al. Canagliflozin-loaded chitosan-hyaluronic acid microspheres modulate AMPK/NF-κB/NLRP3 axis: A new paradigm in the rectal therapy of ulcerative colitis. Biomed. Pharmacother. 2022, 153, 113409. [Google Scholar] [CrossRef]
- Devenport, S.N.; Shah, Y.M. Functions and Implications of Autophagy in Colon Cancer. Cells 2019, 8, 1349. [Google Scholar] [CrossRef] [Green Version]
- Sheng, Y.H.; Giri, R.; Davies, J.; Schreiber, V.; Alabbas, S.; Movva, R.; He, Y.; Wu, A.; Hooper, J.; McWhinney, B.; et al. A Nucleotide Analog Prevents Colitis-Associated Cancer via Beta-Catenin Independently of Inflammation and Autophagy. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 33–53. [Google Scholar] [CrossRef]
- Pott, J.; Maloy, K.J. Epithelial autophagy controls chronic colitis by reducing TNF-induced apoptosis. Autophagy 2018, 14, 1460–1461. [Google Scholar] [CrossRef] [Green Version]
- Youm, Y.-H.; Nguyen, K.Y.; Grant, R.W.; Goldberg, E.L.; Bodogai, M.; Kim, D.; D’Agostino, D.; Planavsky, N.; Lupfer, C.; Kanneganti, T.D.; et al. The ketone metabolite β-hydroxybutyrate blocks NLRP3 inflammasome–mediated inflammatory disease. Nat. Med. 2015, 21, 263–269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, S.-P.; Wang, J.-F.; Xue, W.-J.; Liu, H.-M.; Liu, B.-r.; Zeng, Y.-L.; Li, S.-N.; Huang, B.-X.; Lv, Q.-K.; Wang, W.; et al. Anti-inflammatory effects of BHBA in both in vivo and in vitro Parkinson’s disease models are mediated by GPR109A-dependent mechanisms. J. Neuroinflamm. 2015, 12, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vasconcelos, A.R.; Yshii, L.M.; Viel, T.A.; Buck, H.S.; Mattson, M.P.; Scavone, C.; Kawamoto, E.M. Intermittent fasting attenuates lipopolysaccharide-induced neuroinflammation and memory impairment. J. Neuroinflamm. 2014, 11, 85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MacDonald, L.; Hazi, A.; Paolini, A.G.; Kent, S. Calorie restriction dose-dependently abates lipopolysaccharide-induced fever, sickness behavior, and circulating interleukin-6 while increasing corticosterone. Brain Behav. Immun. 2014, 40, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Ruskin, D.N.; Kawamura, M.; Masino, S.A. Reduced pain and inflammation in juvenile and adult rats fed a ketogenic diet. PLoS ONE 2009, 4, e8349. [Google Scholar] [CrossRef] [Green Version]
- Plecko, B.; Stoeckler-Ipsiroglu, S.; Schober, E.; Harrer, G.; Mlynarik, V.; Gruber, S.; Moser, E.; Moeslinger, D.; Silgoner, H.; Ipsiroglu, O. Oral β-Hydroxybutyrate Supplementation in Two Patients with Hyperinsulinemic Hypoglycemia: Monitoring of β-Hydroxybutyrate Levels in Blood and Cerebrospinal Fluid, and in the Brain by In Vivo Magnetic Resonance Spectroscopy. Pediatr. Res. 2002, 52, 301–306. [Google Scholar] [CrossRef] [Green Version]
- Poff, A.M.; Rho, J.M.; D’Agostino, D.P. Ketone Administration for Seizure Disorders: History and Rationale for Ketone Esters and Metabolic Alternatives. Front. Neurosci. 2019, 13, 1041. [Google Scholar] [CrossRef] [Green Version]
- Pawlosky, R.J.; Kashiwaya, Y.; King, M.T.; Veech, R.L. A Dietary Ketone Ester Normalizes Abnormal Behavior in a Mouse Model of Alzheimer’s Disease. Int. J. Mol. Sci. 2020, 21, 1044. [Google Scholar] [CrossRef] [Green Version]
- Cabrera-Mulero, A.; Tinahones, A.; Bandera, B.; Moreno-Indias, I.; Macías-González, M.; Tinahones, F.J. Keto microbiota: A powerful contributor to host disease recovery. Rev. Endocr. Metab. Disord. 2019, 20, 415–425. [Google Scholar] [CrossRef] [Green Version]
- Qi, J.; Gan, L.; Fang, J.; Zhang, J.; Yu, X.; Guo, H.; Cai, D.; Cui, H.; Gou, L.; Deng, J.; et al. Beta-Hydroxybutyrate: A Dual Function Molecular and Immunological Barrier Function Regulator. Front. Immunol. 2022, 13, 805881. [Google Scholar] [CrossRef]
- Hoffmann, M.; Schwertassek, U.; Seydel, A.; Weber, K.; Falk, W.; Hauschildt, S.; Lehmann, J. A refined and translationally relevant model of chronic DSS colitis in BALB/c mice. Lab. Anim. 2017, 52, 240–252. [Google Scholar] [CrossRef]
- Poff, A.M.; Ari, C.; Arnold, P.; Seyfried, T.N.; D’Agostino, D.P. Ketone supplementation decreases tumor cell viability and prolongs survival of mice with metastatic cancer. Int. J. Cancer 2014, 135, 1711–1720. [Google Scholar] [CrossRef] [Green Version]
- Abdelhamid, A.M.; Youssef, M.E.; Abd El-Fattah, E.E.; Gobba, N.A.; Gaafar, A.G.A.; Girgis, S.; Shata, A.; Hafez, A.-M.; El-Ahwany, E.; Amin, N.A.; et al. Blunting p38 MAPKα and ERK1/2 activities by empagliflozin enhances the antifibrotic effect of metformin and augments its AMPK-induced NF-κB inactivation in mice intoxicated with carbon tetrachloride. Life Sci. 2021, 286, 120070. [Google Scholar] [CrossRef]
- Saber, S.; Nasr, M.; Saad, A.S.; Mourad, A.A.E.; Gobba, N.A.; Shata, A.; Hafez, A.-M.; Elsergany, R.N.; Elagamy, H.I.; El-Ahwany, E.; et al. Albendazole-loaded cubosomes interrupt the ERK1/2-HIF-1α-p300/CREB axis in mice intoxicated with diethylnitrosamine: A new paradigm in drug repurposing for the inhibition of hepatocellular carcinoma progression. Biomed. Pharmacother. 2021, 142, 112029. [Google Scholar] [CrossRef]
Exp. Groups | Days 1–7 | Days 8–17 | Days 18–24 | Day 25 |
---|---|---|---|---|
N group (n = 8) | Non-fasting | Non-fasting | Non-fasting | Sacrifice day |
N/F (n = 8) | Fasting—16 h | Fasting—16 h | Fasting—16 h | |
N/KE (n = 8) | Non-fasting KE | Non-fasting KE | Non-fasting KE | |
CC (n = 20) | Non-fasting 2% DSS | Non-fasting 1% DSS | Non-fasting 2% DSS | |
CC/F (n = 15) | Fasting—16 h 2% DSS | Fasting—16 h 1% DSS | Fasting—16 h 2% DSS | |
CC/KE (n = 15) | Non-fasting 2% DSS KE | Non-fasting 1% DSS KE | Non-fasting 2% DSS KE |
Primer Name | Primer Sequence | Ta (°C) | bp | |
---|---|---|---|---|
(16S) | F | GAGTTTGATCCTGGCTCAG | 51 | 312 |
R | GCTGCCTCCCGTAGGAGT | |||
Fusobacterium | F | GGATTTATTGGGCGTAAAGC | 51.5 | 162 |
R | GGCATTCCTACAAATATCTACGAA | |||
Bacteroides spp. | F | AAGGGAGCGTAGATGGATGTTTA | 55 | 193 |
R | CGAGCCTCAATGTCAGTTGC | |||
Clostridium spp. | F | CGGTACCTGACTAAGAAGC | 50 | 429 |
R | AGTTTGATTCTTGCGAACG | |||
Bifidobacterium | F | CTCCTGGAAACGGGTGG | 51 | 551 |
R | GGTGTTCTTCCCGATATCTACA | |||
Lactobacillus spp. | F | AGCAGTAGGGAATCTTCCA | 50 | 334 |
R | CACCGCTACACATGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saber, S.; Alamri, M.M.S.; Alfaifi, J.; Saleh, L.A.; Abdel-Ghany, S.; Aboregela, A.M.; Farrag, A.A.; Almaeen, A.H.; Adam, M.I.E.; AlQahtani, A.A.J.; et al. (R,R)-BD-AcAc2 Mitigates Chronic Colitis in Rats: A Promising Multi-Pronged Approach Modulating Inflammasome Activity, Autophagy, and Pyroptosis. Pharmaceuticals 2023, 16, 953. https://doi.org/10.3390/ph16070953
Saber S, Alamri MMS, Alfaifi J, Saleh LA, Abdel-Ghany S, Aboregela AM, Farrag AA, Almaeen AH, Adam MIE, AlQahtani AAJ, et al. (R,R)-BD-AcAc2 Mitigates Chronic Colitis in Rats: A Promising Multi-Pronged Approach Modulating Inflammasome Activity, Autophagy, and Pyroptosis. Pharmaceuticals. 2023; 16(7):953. https://doi.org/10.3390/ph16070953
Chicago/Turabian StyleSaber, Sameh, Mohannad Mohammad S. Alamri, Jaber Alfaifi, Lobna A. Saleh, Sameh Abdel-Ghany, Adel Mohamed Aboregela, Alshaimaa A. Farrag, Abdulrahman H. Almaeen, Masoud I. E. Adam, AbdulElah Al Jarallah AlQahtani, and et al. 2023. "(R,R)-BD-AcAc2 Mitigates Chronic Colitis in Rats: A Promising Multi-Pronged Approach Modulating Inflammasome Activity, Autophagy, and Pyroptosis" Pharmaceuticals 16, no. 7: 953. https://doi.org/10.3390/ph16070953