Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells
Abstract
1. Introduction
2. Results
2.1. Quantification of Gallic Acid and Quercetin
2.2. Selection of CM Extract Concentration
2.3. Effects of CM Extract on Neurite Outgrowth Activity
2.4. APP Expression in Neuro2a and Neuro2a/APPSwe Cells
2.5. Effects of CM Extract on GAP-43 Gene Expression
2.6. Effects of and CM Extract on Ten-4 Gene Expression
2.7. Effects of CM Extract on Lingo-1 Gene Expression
2.8. Effects of CM Extract on NgR Gene Expression
2.9. Effects of CM Extract on BACE1 Gene Expression
2.10. Effects of CM Extract on BACE1 Activity
2.11. In Silico Virtual Screening of Binding Affinity between CM-Phytochemical Compounds and BACE1
2.12. ADMET Properties of CM-Phytochemical Compounds
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Cell Culture
4.3. Plant Extract Preparation
4.4. HPLC Analysis
4.5. MTT Assay
4.6. Neurite Outgrowth Assay
4.7. RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
4.8. Quantitative Real-Time PCR Analysis
4.9. Western Blot Analysis
4.10. Determination of BACE1 Activity
4.11. In Silico Virtual Screening of Binding Affinity between Candidate Ligands and BACE1
4.11.1. Protein Preparation
4.11.2. Ligand Preparation
4.11.3. Molecular Docking
4.11.4. Protein–Ligand Interaction
4.12. ADMET Analysis
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Murphy, M.P.; LeVine, H., 3rd. Alzheimer’s disease and the amyloid-beta peptide. J. Alzheimer’s Dis. 2010, 19, 311–323. [Google Scholar] [CrossRef]
- De-Paula, V.J.; Radanovic, M.; Diniz, B.S.; Forlenza, O.V. Alzheimer’s disease. Sub-Cell. Biochem. 2012, 65, 329–352. [Google Scholar]
- Hamano, T.; Gendron, T.F.; Causevic, E.; Yen, S.H.; Lin, W.L.; Isidoro, C.; Deture, M.; Ko, L.W. Autophagic-lysosomal perturbation enhances tau aggregation in transfectants with induced wild-type tau expression. Eur. J. Neurosci. 2008, 27, 1119–1130. [Google Scholar] [CrossRef]
- Tiraboschi, P.; Hansen, L.A.; Thal, L.J.; Corey-Bloom, J. The importance of neuritic plaques and tangles to the development and evolution of AD. Neurology 2004, 62, 1984–1989. [Google Scholar] [CrossRef]
- Serrano-Pozo, A.; Frosch, M.P.; Masliah, E.; Hyman, B.T. Neuropathological alterations in Alzheimer disease. Cold Spring Harb. Perspect. Med. 2011, 1, a006189. [Google Scholar] [CrossRef]
- Gong, C.X.; Iqbal, K. Hyperphosphorylation of microtubule-associated protein tau: A promising therapeutic target for Alzheimer disease. Curr. Med. Chem. 2008, 15, 2321–2328. [Google Scholar] [CrossRef]
- Prasansuklab, A.; Tencomnao, T. Amyloidosis in Alzheimer’s Disease: The Toxicity of Amyloid Beta (A beta), Mechanisms of Its Accumulation and Implications of Medicinal Plants for Therapy. Evid.-Based Complementary Altern. Med. 2013, 2013, 413808. [Google Scholar] [CrossRef] [PubMed]
- Luu, L.; Ciccotosto, G.D.; Vella, L.J.; Cheng, L.; Roisman, L.C.; Multhaup, G.; Hill, A.F.; Munter, L.M.; Cappai, R. Amyloid Precursor Protein Dimerisation Reduces Neurite Outgrowth. Mol. Neurobiol. 2019, 56, 13–28. [Google Scholar] [CrossRef] [PubMed]
- Thinakaran, G.; Koo, E.H. Amyloid precursor protein trafficking, processing, and function. J. Biol. Chem. 2008, 283, 29615–29619. [Google Scholar] [CrossRef] [PubMed]
- Mullan, M.; Houlden, H.; Windelspecht, M.; Fidani, L.; Lombardi, C.; Diaz, P.; Rossor, M.; Crook, R.; Hardy, J.; Duff, K.; et al. A locus for familial early-onset Alzheimer’s disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nat. Genet. 1992, 2, 340–342. [Google Scholar] [CrossRef]
- Scheuner, D.; Eckman, C.; Jensen, M.; Song, X.; Citron, M.; Suzuki, N.; Bird, T.D.; Hardy, J.; Hutton, M.; Kukull, W.; et al. Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nat. Med. 1996, 2, 864–870. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.P.; Wang, Z.F.; Zhang, Y.C.; Tian, Q.; Wang, J.Z. Effect of amyloid peptides on serum withdrawal-induced cell differentiation and cell viability. Cell Res. 2004, 14, 467–472. [Google Scholar] [CrossRef] [PubMed]
- Kiryushko, D.; Berezin, V.; Bock, E. Regulators of neurite outgrowth: Role of cell adhesion molecules. Ann. N. Y. Acad. Sci. 2004, 1014, 140–154. [Google Scholar] [CrossRef]
- Read, D.E.; Gorman, A.M. Involvement of Akt in neurite outgrowth. Cell. Mol. Life Sci. 2009, 66, 2975–2984. [Google Scholar] [CrossRef]
- Li, H.L.; Roch, J.M.; Sundsmo, M.; Otero, D.; Sisodia, S.; Thomas, R.; Saitoh, T. Defective neurite extension is caused by a mutation in amyloid beta/A4 (A beta) protein precursor found in familial Alzheimer’s disease. J. Neurobiol. 1997, 32, 469–480. [Google Scholar] [CrossRef]
- Bai, Y.; Markham, K.; Chen, F.; Weerasekera, R.; Watts, J.; Horne, P.; Wakutani, Y.; Bagshaw, R.; Mathews, P.M.; Fraser, P.E.; et al. The in vivo brain interactome of the amyloid precursor protein. Mol. Cell. Proteom. 2008, 7, 15–34. [Google Scholar] [CrossRef] [PubMed]
- Andrews, J.L.; Fernandez-Enright, F. A decade from discovery to therapy: Lingo-1, the dark horse in neurological and psychiatric disorders. Neurosci. Biobehav. Rev. 2015, 56, 97–114. [Google Scholar] [CrossRef]
- Fernandez-Enright, F.; Andrews, J.L. Lingo-1: A novel target in therapy for Alzheimer’s disease? Neural Regen. Res. 2016, 11, 88–89. [Google Scholar] [CrossRef] [PubMed]
- Shao, Z.; Browning, J.L.; Lee, X.; Scott, M.L.; Shulga-Morskaya, S.; Allaire, N.; Thill, G.; Levesque, M.; Sah, D.; McCoy, J.M.; et al. TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration. Neuron 2005, 45, 353–359. [Google Scholar] [CrossRef]
- Wang, K.C.; Kim, J.A.; Sivasankaran, R.; Segal, R.; He, Z. P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 2002, 420, 74–78. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, E.J. Enhancing and regulating neurite outgrowth. Crit. Rev. Toxicol. 2008, 38, 391–418. [Google Scholar] [CrossRef] [PubMed]
- Huang, E.J.; Reichardt, L.F. Neurotrophins: Roles in neuronal development and function. Annu. Rev. Neurosci. 2001, 24, 677–736. [Google Scholar] [CrossRef]
- Larkfors, L.; Ebendal, T.; Whittemore, S.R.; Persson, H.; Hoffer, B.; Olson, L. Decreased level of nerve growth factor (NGF) and its messenger RNA in the aged rat brain. Brain Res. 1987, 427, 55–60. [Google Scholar] [CrossRef]
- Bartus, R.T. On neurodegenerative diseases, models, and treatment strategies: Lessons learned and lessons forgotten a generation following the cholinergic hypothesis. Exp. Neurol. 2000, 163, 495–529. [Google Scholar] [CrossRef]
- Budni, J.; Bellettini-Santos, T.; Mina, F.; Garcez, M.L.; Zugno, A.I. The involvement of BDNF, NGF and GDNF in aging and Alzheimer’s disease. Aging Dis. 2015, 6, 331–341. [Google Scholar] [CrossRef] [PubMed]
- Granholm, A.C.; Albeck, D.; Backman, C.; Curtis, M.; Ebendal, T.; Friden, P.; Henry, M.; Hoffer, B.; Kordower, J.; Rose, G.M.; et al. A non-invasive system for delivering neural growth factors across the blood-brain barrier: A review. Rev. Neurosci. 1998, 9, 31–55. [Google Scholar] [CrossRef]
- Pardridge, W.M. Neurotrophins, neuroprotection and the blood-brain barrier. Curr. Opin. Investig. Drugs 2002, 3, 1753–1757. [Google Scholar]
- Nitta, A.; Murakami, Y.; Furukawa, Y.; Kawatsura, W.; Hayashi, K.; Yamada, K.; Hasegawa, T.; Nabeshima, T. Oral administration of idebenone induces nerve growth factor in the brain and improves learning and memory in basal forebrain-lesioned rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 1994, 349, 401–407. [Google Scholar] [CrossRef]
- Tohda, C.; Kuboyama, T.; Komatsu, K. Search for natural products related to regeneration of the neuronal network. Neuro-Signals 2005, 14, 34–45. [Google Scholar] [CrossRef]
- More, S.V.; Koppula, S.; Kim, I.S.; Kumar, H.; Kim, B.W.; Choi, D.K. The role of bioactive compounds on the promotion of neurite outgrowth. Molecules 2012, 17, 6728–6753. [Google Scholar] [CrossRef]
- Duangjan, C.; Rangsinth, P.; Zhang, S.; Wink, M.; Tencomnao, T. Anacardium Occidentale, L. Leaf Extracts Protect Against Glutamate/H2O2-Induced Oxidative Toxicity and Induce Neurite Outgrowth: The Involvement of SIRT1/Nrf2 Signaling Pathway and Teneurin 4 Transmembrane Protein. Front. Pharmacol. 2021, 12, 627738. [Google Scholar] [CrossRef] [PubMed]
- Chanwitheesuk, A.; Teerawutgulrag, A.; Rakariyatham, N. Screening of antioxidant activity and antioxidant compounds of some edible plants of Thailand. Food Chem. 2005, 92, 491–497. [Google Scholar] [CrossRef]
- Rangsinth, P.; Prasansuklab, A.; Duangjan, C.; Gu, X.; Meemon, K.; Wink, M.; Tencomnao, T. Leaf extract of Caesalpinia mimosoides enhances oxidative stress resistance and prolongs lifespan in Caenorhabditis elegans. BMC Complementary Altern. Med. 2019, 19, 164. [Google Scholar] [CrossRef]
- Yodsaoue, O.; Karalai, C.; Ponglimanont, C.; Tewtrakul, S.; Chantrapromma, S. Potential anti-inflammatory diterpenoids from the roots of Caesalpinia mimosoides Lamk. Phytochemistry 2010, 71, 1756–1764. [Google Scholar] [CrossRef]
- Rattanata, N.; Klaynongsruang, S.; Daduang, S.; Tavichakorntrakool, R.; Limpaiboon, T.; Lekphrom, R.; Boonsiri, P.; Daduang, J. Inhibitory Effects of Gallic Acid Isolated from Caesalpinia mimosoides Lamk on Cholangiocarcinoma Cell Lines and Foodborne Pathogenic Bacteria. Asian Pac. J. Cancer Prev. 2016, 17, 1341–1345. [Google Scholar] [CrossRef]
- Tangsaengvit, N.; Kitphati, W.; Tadtong, S.; Bunyapraphatsara, N.; Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk. on Cultured P19-Derived Neurons. Evid.-Based Complementary Altern. Med. 2013, 2013, 838051. [Google Scholar] [CrossRef]
- Pervin, M.; Unno, K.; Ohishi, T.; Tanabe, H.; Miyoshi, N.; Nakamura, Y. Beneficial Effects of Green Tea Catechins on Neurodegenerative Diseases. Molecules 2018, 23, 1297. [Google Scholar] [CrossRef]
- Nakajima, K.-I.; Niisato, N.; Marunaka, Y. Quercetin stimulates NGF-induced neurite outgrowth in PC12 cells via activation of Na+/K+/2Cl− cotransporter. Cell. Physiol. Biochem. 2011, 28, 147–156. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.-M.; Yin, Z.-Q.; Zhang, L.-Y.; Liao, H. Quercetin promotes neurite growth through enhancing intracellular cAMP level and GAP-43 expression. Chin. J. Nat. Med. 2015, 13, 667–672. [Google Scholar] [CrossRef]
- Cagnin, M.; Ozzano, M.; Bellio, N.; Fiorentino, I.; Follo, C.; Isidoro, C. Dopamine induces apoptosis in APPswe-expressing Neuro2A cells following Pepstatin-sensitive proteolysis of APP in acid compartments. Brain Res. 2012, 1471, 102–117. [Google Scholar] [CrossRef] [PubMed]
- Resende, R.; Ferreira-Marques, M.; Moreira, P.; Coimbra, J.R.M.; Baptista, S.J.; Isidoro, C.; Salvador, J.A.R.; Dinis, T.C.P.; Pereira, C.F.; Santos, A.E. New BACE1 Chimeric Peptide Inhibitors Selectively Prevent AβPP-β Cleavage Decreasing Amyloid-β Production and Accumulation in Alzheimer’s Disease Models. J. Alzheimer’s Dis. 2020, 76, 1317–1337. [Google Scholar] [CrossRef] [PubMed]
- Shigeta, M.; Shibukawa, Y.; Ihara, H.; Miyoshi, E.; Taniguchi, N.; Gu, J. Beta1,4-N-Acetylglucosaminyltransferase III potentiates beta1 integrin-mediated neuritogenesis induced by serum deprivation in Neuro2a cells. Glycobiology 2006, 16, 564–571. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Suzuki, N.; Numakawa, T.; Chou, J.; de Vega, S.; Mizuniwa, C.; Sekimoto, K.; Adachi, N.; Kunugi, H.; Arikawa-Hirasawa, E.; Yamada, Y.; et al. Teneurin-4 promotes cellular protrusion formation and neurite outgrowth through focal adhesion kinase signaling. FASEB J. 2014, 28, 1386–1397. [Google Scholar] [CrossRef] [PubMed]
- Gohlke, H.; Hendlich, M.; Klebe, G. Knowledge-based scoring function to predict protein-ligand interactions. J. Mol. Biol. 2000, 295, 337–356. [Google Scholar] [CrossRef]
- Ramírez, D.; Caballero, J. Is It Reliable to Take the Molecular Docking Top Scoring Position as the Best Solution without Considering Available Structural Data? Molecules 2018, 23, 1038. [Google Scholar] [CrossRef]
- Shimmyo, Y.; Kihara, T.; Akaike, A.; Niidome, T.; Sugimoto, H. Flavonols and flavones as BACE-1 inhibitors: Structure–activity relationship in cell-free, cell-based and in silico studies reveal novel pharmacophore features. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2008, 1780, 819–825. [Google Scholar] [CrossRef] [PubMed]
- Mphahlele, M.J.; Agbo, E.N.; More, G.K.; Gildenhuys, S. In Vitro Enzymatic and Kinetic Studies, and In Silico Drug-Receptor Interactions, and Drug-Like Profiling of the 5-Styrylbenzamide Derivatives as Potential Cholinesterase and β-Secretase Inhibitors with Antioxidant Properties. Antioxidants 2021, 10, 647. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Liu, Q.; Yu, Q. Quercetin enrich diet during the early-middle not middle-late stage of alzheimer’s disease ameliorates cognitive dysfunction. Am. J. Transl. Res. 2018, 10, 1237–1246. [Google Scholar] [PubMed]
- Pires, D.E.V.; Blundell, T.L.; Ascher, D.B. pkCSM: Predicting Small-Molecule Pharmacokinetic and Toxicity Properties Using Graph-Based Signatures. J. Med. Chem. 2015, 58, 4066–4072. [Google Scholar] [CrossRef]
- Lipinski, C.A.; Lombardo, F.; Dominy, B.W.; Feeney, P.J. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv. Drug Deliv. Rev. 2001, 46, 3–26. [Google Scholar] [CrossRef]
- Schachter, S.C. Botanicals and herbs: A traditional approach to treating epilepsy. Neurotherapeutics 2009, 6, 415–420. [Google Scholar] [CrossRef] [PubMed]
- Benowitz, L.I.; Routtenberg, A. GAP-43: An intrinsic determinant of neuronal development and plasticity. Trends Neurosci. 1997, 20, 84–91. [Google Scholar] [CrossRef]
- Aarts, L.H.; Schotman, P.; Verhaagen, J.; Schrama, L.H.; Gispen, W.H. The role of the neural growth associated protein B-50/GAP-43 in morphogenesis. Adv. Exp. Med. Biol. 1998, 446, 85–106. [Google Scholar] [PubMed]
- Gundimeda, U.; McNeill, T.H.; Schiffman, J.E.; Hinton, D.R.; Gopalakrishna, R. Green tea polyphenols potentiate the action of nerve growth factor to induce neuritogenesis: Possible role of reactive oxygen species. J. Neurosci. Res. 2010, 88, 3644–3655. [Google Scholar] [CrossRef]
- Lai, H.C.; Wu, M.J.; Chen, P.Y.; Sheu, T.T.; Chiu, S.P.; Lin, M.H.; Ho, C.T.; Yen, J.H. Neurotrophic effect of citrus 5-hydroxy-3,6,7,8,3′,4′-hexamethoxyflavone: Promotion of neurite outgrowth via cAMP/PKA/CREB pathway in PC12 cells. PLoS ONE 2011, 6, e28280. [Google Scholar] [CrossRef] [PubMed]
- Phan, C.W.; David, P.; Wong, K.H.; Naidu, M.; Sabaratnam, V. Uridine from Pleurotus giganteus and Its Neurite Outgrowth Stimulatory Effects with Underlying Mechanism. PLoS ONE 2015, 10, e0143004. [Google Scholar] [CrossRef]
- Wansawat, S.; Mani Iyer, P.; Isidoro, C.; Tencomnao, T. Mucuna pruriens Seed Extract Promotes Neurite Outgrowth via TEN-4 Dependent and Independent Mechanisms in NEURO2A Cells. Sains Malays. 2018, 47, 3009–3015. [Google Scholar] [CrossRef]
- Duangjan, C.; Rangsinth, P.; Zhang, S.; Gu, X.; Wink, M.; Tencomnao, T. Neuroprotective Effects of Glochidion zeylanicum Leaf Extract against H2O2/Glutamate-Induced Toxicity in Cultured Neuronal Cells and Aβ-Induced Toxicity in Caenorhabditis elegans. Biology 2021, 10, 800. [Google Scholar] [CrossRef] [PubMed]
- Duangjan, C.; Rangsinth, P.; Zhang, S.; Gu, X.; Wink, M.; Tencomnao, T. Vitis Vinifera Leaf Extract Protects Against Glutamate-Induced Oxidative Toxicity in HT22 Hippocampal Neuronal Cells and Increases Stress Resistance Properties in Caenorhabditis Elegans. Front. Nutr. 2021, 8, 250. [Google Scholar]
- Zhang, S.; Duangjan, C.; Tencomnao, T.; Liu, J.; Lin, J.; Wink, M.J.F. Function, Neuroprotective effects of oolong tea extracts against glutamate-induced toxicity in cultured neuronal cells and β-amyloid-induced toxicity in Caenorhabditis elegans. Food Funct. 2020, 11, 8179–8192. [Google Scholar] [CrossRef] [PubMed]
- de Laat, R.; Meabon, J.S.; Wiley, J.C.; Hudson, M.P.; Montine, T.J.; Bothwell, M. LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor. Pathobiol. Aging Age Relat. Dis. 2015, 5, 25796. [Google Scholar] [CrossRef] [PubMed]
- Fan, T.K.; Gundimeda, U.; Mack, W.J.; Gopalakrishna, R. Counteraction of Nogo-A and axonal growth inhibitors by green tea polyphenols and other natural products. Neural Regen. Res. 2016, 11, 545–546. [Google Scholar]
- Liu, W.; Zhou, Y.; Jia, Q.; Han, B.; Zhang, G. Effects of Fujian tablet on Nogo-A mRNA expression and plasticity of the corticospinal tract in a rat model of focal cerebral ischemia. Neural Regen. Res. 2011, 6, 2577–2581. [Google Scholar]
- Qin, X.D.; Kang, L.Y.; Liu, Y.; Huang, Y.; Wang, S.; Zhu, J.Q. Chinese Medicine’s Intervention Effect on Nogo-A/NgR. Evid.-Based Complementary Altern. Med. 2012, 2012, 528482. [Google Scholar] [CrossRef] [PubMed]
- Palazzolo, G.; Horvath, P.; Zenobi-Wong, M. The flavonoid isoquercitrin promotes neurite elongation by reducing RhoA activity. PLoS ONE 2012, 7, e49979. [Google Scholar] [CrossRef]
- Jung, H.A.; Karki, S.; Kim, J.H.; Choi, J.S. BACE1 and cholinesterase inhibitory activities of Nelumbo nucifera embryos. Arch. Pharmacal Res. 2015, 38, 1178–1187. [Google Scholar] [CrossRef]
- Yang, M.; Zhou, K.Y.; Li, F.F.; Yang, H.Y.; Yin, M.; Zhang, L.H.; Wang, F.S. Effects of Gentiana delavayi Flower Extract on APP Processing in APP/PS1 CHO Cells. Biol. Pharm. Bull. 2020, 43, 767–773. [Google Scholar] [CrossRef]
- Song, Y.; Kim, H.D.; Lee, M.K.; Kim, M.K.; Kang, S.N.; Ko, Y.G.; Won, C.K.; Kim, G.S.; Lee, S.S.; Bai, H.W.; et al. Protective effect of centipedegrass against Aβ oligomerization and Aβ-mediated cell death in PC12 cells. Pharm. Biol. 2015, 53, 1260–1266. [Google Scholar] [CrossRef]
- Khan, M.I.; Shin, J.H.; Kim, M.Y.; Shin, T.S.; Kim, J.D. Green Tea Seed Isolated Theasaponin E1 Ameliorates AD Promoting Neurotoxic Pathogenesis by Attenuating Aβ Peptide Levels in SweAPP N2a Cells. Molecules 2020, 25, 2334. [Google Scholar] [CrossRef]
- Cao, G.; Su, P.; Zhang, S.; Guo, L.; Zhang, H.; Liang, Y.; Qin, C.; Zhang, W. Ginsenoside Re reduces Aβ production by activating PPARγ to inhibit BACE1 in N2a/APP695 cells. Eur. J. Pharmacol. 2016, 793, 101–108. [Google Scholar] [CrossRef]
- Di Meo, F.; Valentino, A.; Petillo, O.; Peluso, G.; Filosa, S.; Crispi, S. Bioactive Polyphenols and Neuromodulation: Molecular Mechanisms in Neurodegeneration. Int. J. Mol. Sci. 2020, 21, 2564. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.J.; Qu, C.Q.; Zhang, J.; Fu, P.C.; Guo, S.G.; Tang, R.H. Lingo-1 inhibited by RNA interference promotes functional recovery of experimental autoimmune encephalomyelitis. Anat. Rec. 2014, 297, 2356–2363. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Li, M.J.; Greenblatt, H.; Chen, W.; Paz, A.; Dym, O.; Peleg, Y.; Chen, T.; Shen, X.; He, J.; et al. Flexibility of the flap in the active site of BACE1 as revealed by crystal structures and molecular dynamics simulations. Acta Crystallogr. Sect. D Biol. Crystallogr. 2012, 68 Pt 1, 13–25. [Google Scholar] [CrossRef]
- Rangsinth, P.; Sillapachaiyaporn, C.; Nilkhet, S.; Tencomnao, T.; Ung, A.T.; Chuchawankul, S. Mushroom-derived bioactive compounds potentially serve as the inhibitors of SARS-CoV-2 main protease: An in silico approach. J. Tradit. Complementary Med. 2021, 11, 158–172. [Google Scholar] [CrossRef] [PubMed]











| Ligand | RMSD (Å) | Binding Energy (kcal/mol) | Amino Acid Interaction | ||
|---|---|---|---|---|---|
| Hydrogen Bond | Hydrophobic Bond | Electrostatic Bond | |||
5HA (crystal structure)![]() | Not determined | Not determined | ASP32 GLY34 SER35 THR72 (2) GLN73 (2) ASP228 GLY230 (2) THR231 THR232 (2) ASN233 | LEU30 TYR71 ILE110 TRP115 (2) TYR198 ILE226 THR231 (2) THR232 (2) ALA335 | - |
| 5HA (re-docking run #1) | 1.03 | −13.32 | ASP32 THR72 (3) GLN73 (2) ASP228 GLY230 THR231 THR232 | GLN12 GLY13 TYR71 THR231 THR232 ALA335 | - |
| 5HA (re-docking run #2) | 0.73 | −13.60 | ASP32 GLY34 THR72 (2) GLN73 (2) GLY230 THR232 ASN233 (2) SER325 | LEU30 TYR71 TRP115 TYR198 ILE226 THR231 THR232 VAL332 ALA335 | - |
| 5HA (re-docking run #3) | 0.79 | −13.94 | GLY34 SER35 THR72 GLN73 (2) ASP228 GLY230 (2) THR232 ASN233 ARG235 SER325 | LEU30 TYR71 PHE108 TRP115 (2) THR231 (2) THR232 ALA335 | - |
| Ligand | Binding Energy (kcal/mol) | Inhibition Constant | Amino Acid Interaction | ||
|---|---|---|---|---|---|
| Hydrogen Bond | Hydrophobic Bond | Electrostatic Bond | |||
Quercetin (reference inhibitor)![]() | −8.78 | 365.72 µM | VAL31 GLN73 (2) PHE108 (2) | LEU30 (2) TRP115 | - |
3-O-Methylgallate![]() | −5.20 | 154.27 µM | THR72 GLN73 (3) PHE108 THR232 (2) | PHE108 | - |
4-Aminomethylindole![]() | −6.49 | 17.63 µM | - | TYR71 (2) GLY230 THR231 | - |
Bergenin![]() | −8.52 | 572.8 nM | TYR71 THR72 GLN73 THR232 | - | - |
Clausarinol![]() | −9.96 | 50.27 nM | THR72 (2) GLN73 (2) THR232 (2) ASN233 | LEU30 PHE108 (2) ILE118 ARG235 | - |
Emmotin A![]() | −7.90 | 1.62 µM | THR72 (3) THR232 THR231 | TYR71 PHE108 ILE118 | - |
Gallic acid![]() | −5.09 | 186.3 µM | THR72 GLN73 (2) THR232 (2) | - | - |
N-D-Glucosylarylamine![]() | −7.10 | 6.29 µM | GLN73 (2) PHE108 GLY230 THR231 (2) THR232 (2) | - | ASP228 |
Quercetin-3′-glucuronide![]() | −10.74 | 13.45 nM | TYR71 THR72 GLN73 (3) ASP228 ARG235 (2) | LEU30 (2) ALA335 | - |
Quercetin-3-O-glucoside![]() | −10.43 | 22.54 nM | GLY34 GLN73 PHE108 (2) THR232 (3) ARG235 | ASP228 | TYR71 |
Theogallin![]() | −8.97 | 266.1 nM | THR72 (3) GLN73 (3) ASP32 SER35 LYS107 PHE108 (2) THR231 | TYR71 PHE108 | - |
| Compound | MW (g/mol) (≤500 g/mol) | Num. H-Bond Acceptors (≤10) | Num. H-Bond Donors (≤5) | Log Po/w (≤5) | Violation (≤1) |
|---|---|---|---|---|---|
| 3-O-Methylgallate | 183.139 | 4 | 2 | 0.1726 | 0 |
| 4-Aminomethylindole | 146.193 | 1 | 2 | 1.6266 | 0 |
| Bergenin | 328.273 | 9 | 5 | -1.2006 | 0 |
| Clausarinol | 414.498 | 6 | 3 | 3.9911 | 0 |
| Emmotin A | 278.348 | 4 | 2 | 1.62822 | 0 |
| Gallic acid | 170.120 | 4 | 4 | 0.5016 | 0 |
| N-D-Glucosylarylamine | 255.270 | 6 | 5 | −1.1016 | 0 |
| Quercetin | 302.238 | 7 | 5 | 1.988 | 0 |
| Quercetin-3′-glucuronide | 478.362 | 12 | 8 | −0.4466 | 2 |
| Quercetin-3-O-glucoside | 464.379 | 12 | 8 | −0.5389 | 2 |
| Theogallin | 344.272 | 9 | 7 | −1.3399 | 1 |
| Compound | Water Solubility (log mol/L) | Intestinal Absorption (% Absorbed) | BBB Permeability (log BB) | CNS Permeability (log PS) | CYP2D6 Substrate | CYP2D6 Inhibitor | Total Clearance (log mL/min/kg) | AMES Toxicity | Max. Tolerated Dose in Human (log mg/kg/day) |
|---|---|---|---|---|---|---|---|---|---|
| 3-O-Methylgallate | −2.094 | 73.513 | −0.198 | −2.807 | No | No | 0.694 | No | 1.169 |
| 4-Aminomethylindole | −1.847 | 91.463 | 0.352 | −2.091 | No | No | 0.991 | No | −0.323 |
| Bergenin | −1.853 | 63.774 | −1.091 | −3.903 | No | No | 0.427 | No | −0.013 |
| Clausarinol | −3.641 | 79.297 | −0.982 | −2.136 | No | No | 0.394 | No | −0.151 |
| Emmotin A | −2.886 | 95.021 | −0.113 | −2.903 | No | No | 1.051 | No | 0.536 |
| Gallic acid | −2.560 | 43.374 | −1.102 | −1.102 | No | No | 0.518 | No | 0.700 |
| N-D-Glucosylarylamine | −1.628 | 42.217 | −0.671 | −3.486 | No | No | 0.217 | No | 0.788 |
| Quercetin | −2.925 | 77.207 | −1.098 | −3.065 | No | No | 0.407 | No | 0.499 |
| Quercetin-3′-glucuronide | −2.894 | 0.999 | −1.656 | −4.117 | No | No | 0.429 | No | 0.432 |
| Quercetin-3-O-glucoside | −2.925 | 47.999 | −1.688 | −4.093 | No | No | 0.394 | No | 0.569 |
| Theogallin | −2.589 | 22.529 | −1.679 | −4.166 | No | No | 0.594 | No | 0.246 |
| Primer | Sequence (Forward and Reverse) | Product Size (bp) | Annealing Temperature (°C) |
|---|---|---|---|
| GAP-43 | 5′- AGCCTAAACAAGCCGATGTG -3′ 5′- GGTTTGGCTTCGTCTACAGC -3′ | 157 | 62 |
| Ten-4 [43] | 5′- GTGGACAAGTTTGGGCTCATTTA -3′ 5′- GGGTTGATGGCTAAGTCTGTGG -3′ | 185 | 62 |
| Lingo-1 [72] | 5′- TCTATCACGCACTGCAACCTGAC -3′ 5′- AGCATGGAGCCCTCGATTGTA -3′ | 116 | 56 |
| NgR | 5′- CCTGCAGAGGTCCTAATGCC -3′ 5′- GAGGCGCTTAAGATCACGGT -3′ | 180 | 60 |
| BACE1 | 5′- CCAGGGCTACTATGTGGAGATGA -3′ 5′- GTGTCCACCAGGATGTTGAGC -3′ | 66 | 58 |
| β-actin | 5′- GGCTGTATTCCCCTCCATCG -3′ 5′- CCAGTTGGTAACAATGCCATGT -3′ | 154 | 62 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rangsinth, P.; Duangjan, C.; Sillapachaiyaporn, C.; Isidoro, C.; Prasansuklab, A.; Tencomnao, T. Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells. Pharmaceuticals 2021, 14, 901. https://doi.org/10.3390/ph14090901
Rangsinth P, Duangjan C, Sillapachaiyaporn C, Isidoro C, Prasansuklab A, Tencomnao T. Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells. Pharmaceuticals. 2021; 14(9):901. https://doi.org/10.3390/ph14090901
Chicago/Turabian StyleRangsinth, Panthakarn, Chatrawee Duangjan, Chanin Sillapachaiyaporn, Ciro Isidoro, Anchalee Prasansuklab, and Tewin Tencomnao. 2021. "Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells" Pharmaceuticals 14, no. 9: 901. https://doi.org/10.3390/ph14090901
APA StyleRangsinth, P., Duangjan, C., Sillapachaiyaporn, C., Isidoro, C., Prasansuklab, A., & Tencomnao, T. (2021). Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells. Pharmaceuticals, 14(9), 901. https://doi.org/10.3390/ph14090901













