ACEK Biosensor for the Minute-Scale Quantification of Breast Cancer ctDNA
Abstract
:1. Introduction
2. Experimental Section
2.1. Materials and Reagents
2.2. Chips Pre-Processing
2.3. Surface Modification and Hybridization
2.4. Characterization of ACEK Biosensors
2.5. Electrochemical Measurements
3. Results and Discussion
3.1. Surface Properties of the Functionalized Electrodes
3.2. Working Principle of the ACEK Biosensor
3.3. Characterization of the Dominant Effect in ACEK
3.4. Detection and Sensitivity of the ACEK Biosensor
3.5. Specificity of the ACEK Biosensor
3.6. Repeatability
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jiang, Y.; Jiang, Z.; Wang, M.; Ma, L. Current Understandings and Clinical Translation of Nanomedicines for Breast Cancer Therapy. Adv. Drug Deliv. Rev. 2022, 180, 114034. [Google Scholar] [CrossRef] [PubMed]
- Keraite, I.; Alvarez-Garcia, V.; Garcia-Murillas, I.; Beaney, M.; Turner, N.C.; Bartos, C.; Oikonomidou, O.; Kersaudy-Kerhoas, M.; Leslie, N.R. PIK3CA Mutation Enrichment and Quantitation from Blood and Tissue. Sci. Rep. 2020, 10, 17082. [Google Scholar] [CrossRef] [PubMed]
- Gerlinger, M.; Endesfelder, D.; Stewart, A.; Tarpey, P.; McDonald, N.Q.; Santos, C.R.; Clark, G.; Pickering, L.; Downward, J. Intratumor Heterogeneity and Branched Evolution Revealed by Multiregion Sequencing. N. Engl. J. Med. 2012, 366, 883–892. [Google Scholar] [CrossRef] [PubMed]
- Yong, E. DNA Circulating in the Bloodstream Could Guide Cancer Treatment—If Researchers Can Work out How Best to Use It. Nature 2014, 511, 524. [Google Scholar] [CrossRef] [PubMed]
- Siravegna, G.; Marsoni, S.; Siena, S.; Bardelli, A. Integrating Liquid Biopsies into the Management of Cancer. Nat. Rev. Clin. Oncol. 2017, 14, 531–548. [Google Scholar] [CrossRef] [PubMed]
- Sorrells, R.B. Synovioanalysis (“liquid biopsy”). J. Ark. Med. Soc. 1974, 71, 59–62. [Google Scholar] [PubMed]
- Yap, T.A.; Lorente, D.; Omlin, A.; Olmos, D.; De Bono, J.S. Circulating Tumor Cells: A Multifunctional Biomarker. Clin. Cancer Res. 2014, 20, 2553–2568. [Google Scholar] [CrossRef]
- Casciano, I.; Di Vinci, A.; Banelli, B.; Brigati, C.; Forlani, A.; Allemanni, G.; Romani, M. Circulating Tumor Nucleic Acids: Perspective in Breast Cancer. Breast Care 2010, 5, 75–80. [Google Scholar] [CrossRef]
- Kalluri, R. The Biology and Function of Exosomes in Cancer. J. Clin. Investig. 2016, 126, 1208–1215. [Google Scholar] [CrossRef]
- Xu, S.; Lou, F.; Wu, Y.; Sun, D.-Q.; Zhang, J.-B.; Chen, W.; Ye, H.; Liu, J.-H.; Wei, S.; Zhao, M.-Y.; et al. Circulating Tumor DNA Identified by Targeted Sequencing in Advanced-Stage Non-Small Cell Lung Cancer Patients. Cancer Lett. 2016, 370, 324–331. [Google Scholar] [CrossRef]
- Bettegowda, C.; Sausen, M.; Leary, R.J.; Kinde, I.; Wang, Y.; Agrawal, N.; Bartlett, B.R.; Wang, H.; Luber, B.; Alani, R.M.; et al. Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Sci. Transl. Med. 2014, 6, 224ra24. [Google Scholar] [CrossRef] [PubMed]
- Gormally, E.; Caboux, E.; Vineis, P.; Hainaut, P. Circulating Free DNA in Plasma or Serum as Biomarker of Carcinogenesis: Practical Aspects and Biological Significance. Mutat. Res./Rev. Mutat. Res. 2007, 635, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Wan, J.C.M.; Massie, C.; Garcia-Corbacho, J.; Mouliere, F.; Brenton, J.D.; Caldas, C.; Pacey, S.; Baird, R.; Rosenfeld, N. Liquid Biopsies Come of Age: Towards Implementation of Circulating Tumour DNA. Nat. Rev. Cancer 2017, 17, 223–238. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Chen, H.; Fan, K.; Labunov, V.; Lazarouk, S.; Yue, X.; Liu, C.; Yang, X.; Dong, L.; Wang, G. A Supersensitive Silicon Nanowire Array Biosensor for Quantitating Tumor Marker ctDNA. Biosens. Bioelectron. 2021, 181, 113147. [Google Scholar] [CrossRef]
- Fleischhacker, M.; Schmidt, B. Circulating Nucleic Acids (CNAs) and Cancer—A Survey. Biochim. Biophys. Acta (BBA)—Rev. Cancer 2007, 1775, 181–232. [Google Scholar] [CrossRef] [PubMed]
- Diehl, F.; Schmidt, K.; Choti, M.A.; Romans, K.; Goodman, S.; Li, M.; Thornton, K.; Agrawal, N.; Sokoll, L.; Szabo, S.A.; et al. Circulating Mutant DNA to Assess Tumor Dynamics. Nat. Med. 2008, 14, 985–990. [Google Scholar] [CrossRef]
- Takegawa, N.; Yonesaka, K.; Sakai, K.; Ueda, H.; Watanabe, S.; Nonagase, Y.; Okuno, T.; Takeda, M.; Maenishi, O.; Tsurutani, J.; et al. HER2 Genomic Amplification in Circulating Tumor DNA from Patients with Cetuximab-Resistant Colorectal Cancer. Oncotarget 2016, 7, 3453–3460. [Google Scholar] [CrossRef]
- Forthun, R.B.; Hovland, R.; Schuster, C.; Puntervoll, H.; Brodal, H.P.; Namløs, H.M.; Aasheim, L.B.; Meza-Zepeda, L.A.; Gjertsen, B.T.; Knappskog, S.; et al. ctDNA Detected by ddPCR Reveals Changes in Tumour Load in Metastatic Malignant Melanoma Treated with Bevacizumab. Sci. Rep. 2019, 9, 17471. [Google Scholar] [CrossRef]
- Gale, D.; Plagnol, V.; Lawson, A.; Pugh, M.; Smalley, S.; Howarth, K.; Madi, M.; Durham, B.; Kumanduri, V.; Lo, K.; et al. Analytical performance and validation of an enhanced TAm-Seq circulating tumor DNA sequencing assay. Cancer Res. 2016, 76, 3639. [Google Scholar] [CrossRef]
- Newman, A.M.; Bratman, S.V.; To, J.; Wynne, J.F.; Eclov, N.C.W.; Modlin, L.A.; Liu, C.L.; Neal, J.W.; Wakelee, H.A.; Merritt, R.E.; et al. An Ultrasensitive Method for Quantitating Circulating Tumor DNA with Broad Patient Coverage. Nat. Med. 2014, 20, 548–554. [Google Scholar] [CrossRef]
- Phallen, J.; Sausen, M.; Adleff, V.; Leal, A.; Hruban, C.; White, J.; Anagnostou, V.; Fiksel, J.; Cristiano, S.; Papp, E.; et al. Direct Detection of Early-Stage Cancers Using Circulating Tumor DNA. Sci. Transl. Med. 2017, 9, eaan2415. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Wu, Y.; Hoque, S.; Tilley, R.D.; Gooding, J.J. Rapid and Ultrasensitive Electrochemical Detection of Circulating Tumor DNA by Hybridization on the Network of Gold-Coated Magnetic Nanoparticles. Chem. Sci. 2021, 12, 5196–5201. [Google Scholar] [CrossRef] [PubMed]
- Uygun, Z.O.; Yeniay, L.; Sağın, F.G. CRISPR-dCas9 Powered Impedimetric Biosensor for Label-Free Detection of Circulating Tu mor DNAs. Anal. Chim. Acta 2020, 1121, 35–41. [Google Scholar] [CrossRef]
- Rahman, M.; Cui, D.; Zhou, S.; Zhang, A.; Chen, D. A Graphene Oxide Coated Gold Nanostar Based Sensing Platform for Ultrasensitive Electrochemical Detection of Circulating Tumor DNA. Anal. Methods 2020, 12, 440–447. [Google Scholar] [CrossRef]
- Park, C.; Yu, Y.; Jung, H.; Jang, K.; Na, S. Detection and Discrimination of Single Nucleotide Polymorphisms by Exploiting Metal Ion-Mediated DNA Duplex. Sens. Actuators B Chem. 2020, 305, 127493. [Google Scholar] [CrossRef]
- Khodaei, R.; Ahmady, A.; Khoshfetrat, S.M.; Kashanian, S.; Tavangar, S.M.; Omidfar, K. Voltammetric Immunosensor for E-Cadherin Promoter DNA Methylation Using a Fe3O4-Citric Acid Nanocomposite and a Screen-Printed Carbon Electrode Modified with Poly (Vinyl Alcohol) and Reduced Graphene Oxide. Microchim. Acta 2019, 186, 170. [Google Scholar] [CrossRef] [PubMed]
- Bahadır, E.B.; Sezgintürk, M.K. Electrochemical biosensors for hormone analyses. Biosens. Bioelectron. 2015, 68, 62–71. [Google Scholar] [CrossRef]
- Li, X.; Ye, M.; Zhang, W.; Tan, D.; Jaffrezic-Renault, N.; Yang, X.; Guo, Z. Liquid Biopsy of Circulating Tumor DNA and Biosensor Ap-plications. Biosens. Bioelectron. 2019, 126, 596–607. [Google Scholar] [CrossRef]
- Lu, Y.; Liu, T.; Lamanda, A.C.; Sin, M.L.Y.; Gau, V.; Liao, J.C.; Wong, P.K. AC Electrokinetics of Physiological Fluids for Biomedical Applications. J. Lab. Autom. 2015, 20, 611–620. [Google Scholar] [CrossRef]
- Lin, X.; Cheng, C.; Terry, P.; Chen, J.; Cui, H.; Wu, J. Rapid and Sensitive Detection of Bisphenol a from Serum Matrix. Biosens. Bioelectron. 2017, 91, 104–109. [Google Scholar] [CrossRef]
- Herbert, J.; Stacey, P.M.; Thorpe, D.H. Recurrent breeding seasons in pinealectomized or optic-nerve-sectioned ferrets. J. Endocrinol. 1978, 78, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Gielen, F.; deMello, A.J.; Cass, T.; Edel, J.B. Increasing the Trapping Efficiency of Particles in Microfluidic Planar Platforms by Means of Negative Dielectrophoresis. J. Phys. Chem. B 2009, 113, 1493–1500. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Lian, M.; Yang, K. Micropumping of Biofluids by Alternating Current Electrothermal Effects. Appl. Phys. Lett. 2007, 90, 234103. [Google Scholar] [CrossRef]
- Lian, M.; Islam, N.; Wu, J. AC Electrothermal Manipulation of Conductive Fluids and Particles for Lab-Chip Applications. IET Nanobiotechnol. 2007, 1, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Hart, R.; Lec, R.; Noh, H. “Moses.” Enhancement of Heterogeneous Immunoassays Using AC Electroosmosis. Sens. Actuators B Chem. 2010, 147, 366–375. [Google Scholar] [CrossRef]
- Yang, K.; Wu, J. Numerical Study of in Situ Preconcentration for Rapid and Sensitive Nanoparticle Detection. Biomicrofluidics 2010, 4, 034106. [Google Scholar] [CrossRef] [PubMed]
- Qian, C.; Huang, H.; Chen, L.; Li, X.; Ge, Z.; Chen, T.; Yang, Z.; Sun, L. Dielectrophoresis for Bioparticle Manipulation. Int. J. Mol. Sci. 2014, 15, 18281–18309. [Google Scholar] [CrossRef]
- Kramers, H.A. Brownian motion in a field of force and the diffusion model of chemical reactions. Physica 1940, 7, 284–304. [Google Scholar] [CrossRef]
- Song, M.; Lin, X.; Peng, Z.; Xu, S.; Jin, L.; Zheng, X.; Luo, H. Materials and Methods of Biosensor Interfaces with Stability. Front. Mater. 2021, 7, 583739. [Google Scholar] [CrossRef]
- Rahman, S.F.A.; Yusof, N.A.; Hashim, U.; Hushiarian, R.; Nuzaihan, M.; Hamidon, M.N.; Zawawi, R.M.; Fathil, M.F.M. Enhanced Sensing of Dengue Virus DNA Detection Using O2 Plasma Treated-Silicon Nanowire Based Electrical Biosensor. Anal. Chim. Acta 2016, 942, 74–85. [Google Scholar] [CrossRef]
- Cai, C.; Guo, Z.; Cao, Y.; Zhang, W.; Chen, Y. A dual biomarker detection platform for quantitating circulating tumor DNA (ctDNA). Nanotheranostics 2018, 2, 12–20. [Google Scholar] [CrossRef]
- Huang, Y.; Tao, M.; Luo, S.; Zhang, Y.; Situ, B.; Ye, X.; Chen, P.; Jiang, X.; Wang, Q.; Zheng, L. A Novel Nest Hybridization Chain Reaction Based Electrochemical Assay for Sensitive Detection of Circulating Tumor DNA. Anal. Chim. Acta 2020, 1107, 40–47. [Google Scholar] [CrossRef]
- Luo, S.; Zhang, Y.; Huang, G.; Situ, B.; Ye, X.; Tao, M.; Huang, Y.; Li, B.; Jiang, X.; Wang, Q.; et al. An Enzyme-Free Amplification Strategy for Sensitive Assay of Circulating Tumor DNA Based on Wheel-like Catalytic Hairpin Assembly and Frame Hybridization Chain Reaction. Sens. Actuators B Chem. 2021, 338, 129857. [Google Scholar] [CrossRef]
Nucleic Acid | Sequences (5′-3′) |
---|---|
Thiol-modified probe | HS-C6-AGTGATTTCAGAGAG |
Amino-modified probe | NH2-C6-AGTGATTTCAGAGAG |
ctDNA | AACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTC |
Wild-type DNA | AACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTAAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTC |
Completely non-complementary DNA | AGATCCAATCCATTTTTGTTGTCCAGCCACCATGATGCGCATCATTCATTTGTTTCATGAAATACTCC |
Sample | Temperature/°C | Test Value 1 | Test Value 2 | Test Value 3 | Average Value |
---|---|---|---|---|---|
0.05 × PBS | 18.9 °C | 0.0988 S/m | 0.0988 S/m | 0.0989 S/m | 0.0988 S/m |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.; Lin, X.; Zhang, M.; Yang, M.; Shi, X.; Xie, M.; Luo, Y. ACEK Biosensor for the Minute-Scale Quantification of Breast Cancer ctDNA. Sensors 2024, 24, 547. https://doi.org/10.3390/s24020547
Wang K, Lin X, Zhang M, Yang M, Shi X, Xie M, Luo Y. ACEK Biosensor for the Minute-Scale Quantification of Breast Cancer ctDNA. Sensors. 2024; 24(2):547. https://doi.org/10.3390/s24020547
Chicago/Turabian StyleWang, Ke, Xiaogang Lin, Maoxiao Zhang, Mengjie Yang, Xiang Shi, Mingna Xie, and Yang Luo. 2024. "ACEK Biosensor for the Minute-Scale Quantification of Breast Cancer ctDNA" Sensors 24, no. 2: 547. https://doi.org/10.3390/s24020547
APA StyleWang, K., Lin, X., Zhang, M., Yang, M., Shi, X., Xie, M., & Luo, Y. (2024). ACEK Biosensor for the Minute-Scale Quantification of Breast Cancer ctDNA. Sensors, 24(2), 547. https://doi.org/10.3390/s24020547