Electrochemical DNA Biosensors with Dual-Signal Amplification Strategy for Highly Sensitive HPV 16 Detection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Instruments
2.2. Reagents
2.3. Pretreatment of Glassy Carbon Electrode
2.4. Glassy Carbon Electrodes Modified with APTES
2.5. Preparation of AuNPs
2.6. Preparation of CP-AuNPs-MCH via Freeze–Thaw Method
2.7. Preparation of Sensors
2.8. Electrochemical Measurements
3. Results and Discussion
3.1. Structure of the Sensor
3.2. Electrochemical Characterization
3.3. SEM Characterization of Electrodes
3.4. Characterization of AuNPs
3.5. Characterization of Capture-Probe-Modified AuNPs
3.6. Improving Experimental Conditions
3.7. Sensor Performance
3.8. Sensor Selectivity and Stability
3.9. Detection in Real Samples
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Allanson, E.R.; Schmeler, K.M. Preventing Cervical Cancer Globally: Are We Making Progress? Cancer Prev. Res. 2021, 14, 1055–1060. [Google Scholar] [CrossRef]
- Kovachev, S.; Slavov, V. Prevalence of human papillomavirus infection in women in Bulgaria: A 2017 update. J. Med. Virol. 2018, 90, 1142–1149. [Google Scholar] [CrossRef]
- Graham, S.V. Human Papillomavirus E2 Protein: Linking Replication, Transcription, and RNA Processing. J. Virol. 2016, 90, 8384–8388. [Google Scholar] [CrossRef]
- Han, K.H. Evaluation of human papillomavirus (HPV) genotyping assays using type-specific HPV L1 reference DNA. Genes Genom. 2021, 43, 775–781. [Google Scholar] [CrossRef]
- Brotherton, J.M.L.; Tabrizi, S.N.; Phillips, S.; Pyman, J.; Cornall, A.M.; Lambie, N.; Anderson, L.; Cummings, M.; Payton, D.; Scurry, J.P.; et al. Looking beyond human papillomavirus (HPV) genotype 16 and 18: Defining HPV genotype distribution in cervical cancers in Australia prior to vaccination. Int. J. Cancer 2017, 141, 1576–1584. [Google Scholar] [CrossRef]
- Xi, C.; Shen, J.J.; Burston, B.; Upadhyay, S.; Zhou, S. Epidemiological/Disease and Economic Burdens of Cervical Cancer in 2010–2014: Are Younger Women at Risk? Healthcare 2023, 11, 144. [Google Scholar] [CrossRef]
- Khan, M.J.R.; Bhuiyan, M.A.; Tabassum, S.; Munshi, S.U. Use of whole blood and dried blood spot for detection of HIV-1 nucleic acids using reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 2023, 312, 114642. [Google Scholar] [CrossRef]
- Wei, J.; Zhou, X.; Xing, D.; Wu, B. Rapid and sensitive detection of Vibrio parahaemolyticus in sea foods by electrochemiluminescence polymerase chain reaction method. Food Chem. 2010, 123, 852–858. [Google Scholar] [CrossRef]
- Xu, H.; Wu, D.; Zhang, Y.; Shi, H.; Ouyang, C.; Li, F.; Jia, L.; Yu, S.; Wu, Z.-S. RCA-enhanced multifunctional molecule beacon-based strand-displacement amplification for sensitive microRNA detection. Sens. Actuators B Chem. 2018, 258, 470–477. [Google Scholar] [CrossRef]
- Xia, Y.; Huang, Z.; Chen, T.; Xu, L.; Zhu, G.; Chen, W.; Chen, G.; Wu, S.; Lan, J.; Lin, X.; et al. Sensitive fluorescent detection of exosomal microRNA based on enzymes-assisted dual-signal amplification. Biosens. Bioelectron. 2022, 209, 114259. [Google Scholar] [CrossRef] [PubMed]
- Hai, X.; Li, Y.; Zhu, C.; Song, W.; Cao, J.; Bi, S. DNA-based label-free electrochemical biosensors: From principles to applications. TrAC Trends Anal. Chem. 2020, 133, 116098. [Google Scholar] [CrossRef]
- Liu, C.; Wu, T.; Zeng, W.; Liu, J.; Hu, B.; Wu, L. Dual-signal electrochemical aptasensor involving hybridization chain reaction amplification for aflatoxin B1 detection. Sens. Actuators B Chem. 2022, 371, 132494. [Google Scholar] [CrossRef]
- Li, S.; Fu, Z.; Wang, C.; Shang, X.; Zhao, Y.; Liu, C.; Pei, M. An ultrasensitive and specific electrochemical biosensor for DNA detection based on T7 exonuclease-assisted regulatory strand displacement amplification. Anal. Chim. Acta 2021, 1183, 338988. [Google Scholar] [CrossRef]
- Pei, Q.; Song, X.; Liu, S.; Wang, J.; Leng, X.; Cui, X.; Yu, J.; Wang, Y.; Huang, J. A facile signal-on electrochemical DNA sensing platform for ultrasensitive detection of pathogenic bacteria based on Exo III-assisted autonomous multiple-cycle amplification. Analyst 2019, 144, 3023–3029. [Google Scholar] [CrossRef]
- Qing, M.; Sun, Z.; Wang, L.; Du, S.Z.; Zhou, J.; Tang, Q.; Luo, H.Q.; Li, N.B. CRISPR/Cas12a-regulated homogeneous electrochemical aptasensor for amplified detection of protein. Sens. Actuators B Chem. 2021, 348, 130713. [Google Scholar] [CrossRef]
- Bourkaib, M.C.; Gaudin, P.; Vibert, F.; Guiavarc’h, Y.; Delaunay, S.; Framboisier, X.; Humeau, C.; Chevalot, I.; Blin, J.-L. APTES modified SBA15 and meso-macro silica materials for the immobilization of aminoacylases from Streptomyces ambofaciens. Microporous Mesoporous Mater. 2021, 323, 111226. [Google Scholar] [CrossRef]
- Nayak, N.; Huertas, R.; Crespo, J.G.; Portugal, C.A.M. Surface modification of alumina monolithic columns with 3-aminopropyltetraethoxysilane (APTES) for protein attachment. Sep. Purif. Technol. 2019, 229, 115674. [Google Scholar] [CrossRef]
- Lima, V.V.; Nora, F.B.D.; Peres, E.C.; Reis, G.S.; Lima, C.; Oliveira, M.L.; Dotto, G.L. Synthesis and characterization of biopolymers functionalized with APTES (3–aminopropyltriethoxysilane) for the adsorption of sunset yellow dye. J. Environ. Chem. Eng. 2019, 7, 103410. [Google Scholar] [CrossRef]
- Ghazali, N.N.; Mohamad Nor, N.; Abdul Razak, K.; Lockman, Z.; Hattori, T. Hydrothermal synthesis of bismuth nanosheets for modified APTES-functionalized screen-printed carbon electrode in lead and cadmium detection. J. Nanoparticle Res. 2020, 22, 211. [Google Scholar] [CrossRef]
- Siddique, A.; Meckel, T.; Stark, R.W.; Narayan, S. Improved cell adhesion under shear stress in PDMS microfluidic devices. Colloids Surf. B Biointerfaces 2017, 150, 456–464. [Google Scholar] [CrossRef]
- Cotchim, S.; Thavarungkul, P.; Kanatharana, P.; Thanakiatkrai, P.; Kitpipit, T.; Limbut, W. Extraction and electrochemical detection for quantification of trace-level DNA. Mikrochim. Acta 2021, 188, 180. [Google Scholar] [CrossRef]
- Nur Sonuç Karaboğa, M.; Kemal Sezgintürk, M. A Practical Approach for the Detection of Protein Tau with a Portable Potentiostat. Electroanalysis 2022, 35, e202200072. [Google Scholar] [CrossRef]
- Ebrahim, S.; Raoof, M.; Ramadan, W.; Soliman, M. New self assembly monolayer onto SiGe as a selective biosensor for single-strand DNA. Microelectron. Eng. 2016, 160, 87–93. [Google Scholar] [CrossRef]
- Deshmukh, R.; Prusty, A.K.; Roy, U.; Bhand, S. A capacitive DNA sensor for sensitive detection of Escherichia coli O157:H7 in potable water based on the z3276 genetic marker: Fabrication and analytical performance. Analyst 2020, 145, 2267–2278. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Qing, Y.; Hao, X.; Fang, C.; Ouyang, P.; Li, H.; Wang, Z.; Liao, Y.; Fang, H.; Du, J. APTES-Modified Remote Self-Assembled DNA-Based Electrochemical Biosensor for Human Papillomavirus DNA Detection. Biosensors 2022, 12, 449. [Google Scholar] [CrossRef]
- Khater, M.; de la Escosura-Muniz, A.; Quesada-Gonzalez, D.; Merkoci, A. Electrochemical detection of plant virus using gold nanoparticle-modified electrodes. Anal. Chim. Acta 2019, 1046, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Pilehvar, S.; Reinemann, C.; Bottari, F.; Vanderleyden, E.; Van Vlierberghe, S.; Blust, R.; Strehlitz, B.; De Wael, K. A joint action of aptamers and gold nanoparticles chemically trapped on a glassy carbon support for the electrochemical sensing of ofloxacin. Sens. Actuators B Chem. 2017, 240, 1024–1035. [Google Scholar] [CrossRef]
- Pourmadadi, M.; Shayeh, J.S.; Omidi, M.; Yazdian, F.; Alebouyeh, M.; Tayebi, L. A glassy carbon electrode modified with reduced graphene oxide and gold nanoparticles for electrochemical aptasensing of lipopolysaccharides from Escherichia coli bacteria. Mikrochim. Acta 2019, 186, 787. [Google Scholar] [CrossRef]
- Chekin, F.; Bagga, K.; Subramanian, P.; Jijie, R.; Singh, S.K.; Kurungot, S.; Boukherroub, R.; Szunerits, S. Nucleic aptamer modified porous reduced graphene oxide/MoS2 based electrodes for viral detection: Application to human papillomavirus (HPV). Sens. Actuators B Chem. 2018, 262, 991–1000. [Google Scholar] [CrossRef]
- Jampasa, S.; Siangproh, W.; Laocharoensuk, R.; Yanatatsaneejit, P.; Vilaivan, T.; Chailapakul, O. A new DNA sensor design for the simultaneous detection of HPV type 16 and 18 DNA. Sens. Actuators B Chem. 2018, 265, 514–521. [Google Scholar] [CrossRef]
- Shariati, M.; Ghorbani, M.; Sasanpour, P.; Karimizefreh, A. An ultrasensitive label free human papilloma virus DNA biosensor using gold nanotubes based on nanoporous polycarbonate in electrical alignment. Anal. Chim. Acta 2019, 1048, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Nie, Y.; Zhang, X.; Zhang, Q.; Liang, Z.; Ma, Q.; Su, X. A novel high efficient electrochemiluminescence sensor based on reductive Cu(I) particles catalyzed Zn-doped MoS2 QDs for HPV 16 DNA determination. Biosens. Bioelectron. 2020, 160, 112217. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′–3′) |
---|---|
Capture probe (CP) | TTTCAATTTTTGGATTAC-SH |
Target DNA (TD) | GTAATCCAAAAATTGAAAACTAAGGGTCTGAGGG |
Auxiliary probe 1 (AP1) | TACTCCCCCAGGTGCCCCTCAGACCCTTAGT |
Auxiliary probe 2 (AP2) | GCACCTGGGGGAGTAACTAAGGGTCTGAGGG |
Noncomplementary sequence (NC) | CCTTTTAGTCAGTGTGGAAATCTCTAGCAGTGGC |
Single-base mismatch target (1MT) | GTAATCCAATAATTGAAAACTAAGGGTCTGAGGG |
Two-base mismatch target (2MT) | GTAATCCAATTATTGAAAACTAAGGGTCTGAGGG |
HPV 18 | GTATATTGCAAGACAGTATTGGAACTTACAGAGG |
HPV 31 | CCAAAAGCCCAAGGAAGATCCATTTAAA |
HPV 33 | CACATCCACCCGCACATCGTCTGCAAAA |
Dynamic Line Arrange (mol/L) | LOD (mol/L) | Method | Reference |
---|---|---|---|
3.50 × 10−12–3.53 × 10−11 | 1.750 × 10−12 | DPV | [29] |
5.00 × 10−10–1.00 × 10−7 | 1.500 × 10−10 | DPV | [30] |
1.00 × 10−14–1.00 × 10−6 | 1.000 × 10−15 | EIS | [31] |
1.00 × 10−10–2.00 × 10−7 | 3.000 × 10−11 | ECL | [32] |
1.00 × 10−13–1.00 × 10−6 | 5.475 × 10−16 | DPV | [25] |
1.00 × 10−13–1.00 × 10−5 | 1.731 × 10−16 | DPV | This work |
TD Added (nmol/L) | Total Found (nmol/L) | Recovery (%) | RSD (%) |
---|---|---|---|
1.0 | 0.987 | 98.70 | 1.74 |
10.0 | 9.985 | 99.85 | 3.14 |
100.0 | 100.533 | 100.53 | 1.95 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Liao, Y.; Qing, Y.; Li, H.; Du, J. Electrochemical DNA Biosensors with Dual-Signal Amplification Strategy for Highly Sensitive HPV 16 Detection. Sensors 2023, 23, 7380. https://doi.org/10.3390/s23177380
Yang Y, Liao Y, Qing Y, Li H, Du J. Electrochemical DNA Biosensors with Dual-Signal Amplification Strategy for Highly Sensitive HPV 16 Detection. Sensors. 2023; 23(17):7380. https://doi.org/10.3390/s23177380
Chicago/Turabian StyleYang, Yuxing, Yazhen Liao, Yang Qing, Haiyu Li, and Jie Du. 2023. "Electrochemical DNA Biosensors with Dual-Signal Amplification Strategy for Highly Sensitive HPV 16 Detection" Sensors 23, no. 17: 7380. https://doi.org/10.3390/s23177380