A Miniaturized MicroRNA Sensor Identifies Targets Associated with Weight Loss in a Diet and Exercise Intervention among Healthy Overweight Individuals
Abstract
:1. Introduction
2. Materials and Methods
2.1. Participants
2.2. Diet and Exercise Intervention
2.3. Nutrition and Exercise Intervention
2.4. miR Analysis
- miR-140-5p: 3′(FITC) CTACCATAGGGTAAAACCACTG5′
- miR-935: 3′(FITC) GCGGTAGCGGAAGCGGTAACTGG5′
- miR-99a: 3′(FITC)CACAAGATCGGATCTACGGGTT5′
- miR-let-7b: 3′(FITC) AACCACACAACCTACTACCTCA5′
2.5. Body Composition
2.6. Statistical Analyses
3. Results and Discussion
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yang, L.; Colditz, G.A. Prevalence of Overweight and Obesity in the United States, 2007–2012 Computed Tomography Radiation Dose in Patients with Suspected Urolithiasis Computed tomography (CT) for the evaluation of suspected. JAMA Intern. Med. 2015, 175, 1412–1413. [Google Scholar] [CrossRef] [PubMed]
- Hales, C.M.; Carroll, M.D.; Fryar, C.D.; Ogden, C.L. Prevalence of Obesity among Adults and Youth: United States, 2015–2016; NCHS Data Brief, no 288; National Center for Health Statistics: Hyattsville, MD, USA, 2017. [Google Scholar]
- Jarolimova, J.; Tagoni, J.; Stern, T.A. Obesity: Its epidemiology, comorbidities, and management. Prim. Care Companion CNS Disord. 2013, 15, PCC.12f01475. [Google Scholar] [CrossRef] [PubMed]
- Waters, H.; Graf, M. America’s Obesity Crisis: The Health and Economic Costs of Excess Weight; Milen Institute: Santa Monica, CA, USA, 2018. [Google Scholar]
- Buchwald, H.; Avidor, Y.; Braunwald, E.; Jensen, M.D.; Pories, W.; Fahrbach, K.; Schoelles, K. Bariatric Surgery: A Systematic Review and Meta-analysis. JAMA 2004, 292, 1724–1737. [Google Scholar] [CrossRef]
- Courcoulas, A.; Coley, R.Y.; Clark, J.M.; McBride, C.L.; Cirelli, E.; McTigue, K.; Arterburn, D.; Coleman, K.J.; Wellman, R.; Anau, J.; et al. Interventions and Operations 5 Years after Bariatric Surgery in a Cohort from the US National Patient-Centered Clinical Research Network Bariatric Study. JAMA Surg. 2019, 15213, 194–204. [Google Scholar] [CrossRef] [PubMed]
- Wyatt, H.R. Update on treatment strategies for obesity. J. Clin. Endocrinol. Metab. 2013, 98, 1299–1306. [Google Scholar] [CrossRef]
- King, N.A.; Hopkins, M.; Caudwell, P.; Stubbs, R.J.; Blundell, J.E. Individual variability following 12 weeks of supervised exercise: Identification and characterization of compensation for exercise-induced weight loss. Int. J. Obes. 2008, 32, 177–184. [Google Scholar] [CrossRef]
- Swift, D.L.; Johannsen, N.M.; Lavie, C.J.; Earnest, C.P.; Church, T.S. The role of exercise and physical activity in weight loss and maintenance. Prog. Cardiovasc. Dis. 2014, 56, 441–447. [Google Scholar] [CrossRef] [PubMed]
- Parr, E.B.; Camera, D.M.; Burke, L.M.; Phillips, S.M.; Coffey, V.G.; Hawley, J.A. Circulating microrna responses between “high” and “low” responders to a 16-Wk diet and exercise weight loss intervention. PLoS ONE 2016, 11, e0152545. [Google Scholar] [CrossRef]
- Kuzhandai Velu, V.; Ramesh, R.; Srinivasan, A.R. Circulating microRNAs as biomarkers in health and disease. J. Clin. Diagn. Res. 2012, 6, 1791–1795. [Google Scholar]
- Aoi, W.; Ichikawa, H.; Mune, K.; Tanimura, Y.; Mizushima, K.; Naito, Y.; Yoshikawa, T. Muscle-enriched microRNA miR-486 decreases in circulation in response to exercise in young men. Front. Physiol. 2013, 4, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Baggish, A.L.; Hale, A.; Weiner, R.B.; Lewis, G.D.; Systrom, D.; Wang, F.; Wang, T.J.; Chan, S.Y. Dynamic regulation of circulating microRNA during acute exhaustive exercise and sustained aerobic exercise training. J. Physiol. 2011, 589, 3983–3994. [Google Scholar] [CrossRef] [PubMed]
- Uhlemann, M.; Möbius-Winkler, S.; Fikenzer, S.; Adam, J.; Redlich, M.; Möhlenkamp, S.; Hilberg, T.; Schuler, G.C.; Adams, V. Circulating microRNA-126 increases after different forms of endurance exercise in healthy adults. Eur. J. Prev. Cardiol. 2014, 21, 484–491. [Google Scholar] [CrossRef] [PubMed]
- Banzet, S.; Chennaoui, M.; Girard, O.; Racinais, S.; Drogou, C.; Chalabi, H.; Koulmann, N. Changes in circulating microRNAs levels with exercise modality. J. Appl. Physiol. 2013, 115, 1237–1244. [Google Scholar] [CrossRef] [PubMed]
- Baggish, A.L.; Park, J.; Min, P.K.; Isaacs, S.; Parker, B.A.; Thompson, P.D.; Troyanos, C.; D’Hemecourt, P.; Dyer, S.; Thiel, M.; et al. Rapid upregulation and clearance of distinct circulating microRNAs after prolonged aerobic exercise. J. Appl. Physiol. 2014, 116, 522–531. [Google Scholar] [CrossRef]
- Sawada, S.; Kon, M.; Wada, S.; Ushida, T.; Suzuki, K.; Akimoto, T. Profiling of circulating microRNAs after a bout of acute resistance exercise in humans. PLoS ONE 2013, 8, e70823. [Google Scholar] [CrossRef] [PubMed]
- Flowers, E.; Won, G.Y.; Fukuoka, Y. Micrornas associated with exercise and diet: A systematic review. Physiol. Genom. 2015, 47, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Bye, A.; Røsjø, H.; Aspenes, S.T.; Condorelli, G.; Omland, T.; Wisløff, U. Circulating microRNAs and aerobic fitness—The HUNT-Study. PLoS ONE 2013, e57496. [Google Scholar] [CrossRef] [PubMed]
- Mooren, F.C.; Viereck, J.; Krüger, K.; Thum, T. Circulating micrornas as potential biomarkers of aerobic exercise capacity. Am. J. Physiol. Heart Circ. Physiol. 2014, 306, 557–563. [Google Scholar] [CrossRef]
- Drummond, M.J.; McCarthy, J.J.; Fry, C.S.; Esser, K.A.; Rasmussen, B.B. Aging differentially affects human skeletal muscle microRNA expression at rest and after an anabolic stimulus of resistance exercise and essential amino acids. Am. J. Physiol. Endocrinol. Metab. 2008, 295, 1333–1340. [Google Scholar] [CrossRef] [PubMed]
- McPherson, N.O.; Owens, J.A.; Fullston, T.; Lane, M. Preconception diet or exercise intervention in obese fathers normalizes sperm microRNA profile and metabolic syndrome in female offspring. Am. J. Physiol. Endocrinol. Metab. 2015, 308, E805–E821. [Google Scholar] [CrossRef] [PubMed]
- Ortega, F.J.; Mercader, J.M.; Moreno-Navarrete, J.M.; Nonell, L.; Puigdecanet, E.; Rodriquez-Hermosa, J.I.; Rovira, O.; Xifra, G.; Guerra, E.; Moreno, M.; et al. Surgery-induced weight loss is associated with the downregulation of genes targeted by MicroRNAs in adipose tissue. J. Clin. Endocrinol. Metab. 2015, 100, E1467–E1476. [Google Scholar] [CrossRef] [Green Version]
- Ortega, F.J.; Moreno, M.; Mercader, J.M.; Moreno-Navarrete, J.M.; Fuentes-Batllevell, N.; Sabater, M.; Ricart, W.; Fernández-Real, J.M. Inflammation triggers specific microRNA profiles in human adipocytes and macrophages and in their supernatants. Clin. Epigenet. 2015, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Simbo, S.Y. Effects of Exercise and Diet-Induced Weight Loss in Overweight/Obese Women on Characterization of Serum/White Blood Cells, microRNAs and Cytokine Gene Transcription; Texas A&M University: College Station, TX, USA, 2013. [Google Scholar]
- Hilton, C.; Neville, M.J.; Karpe, F. MicroRNAs in adipose tissue: Their role in adipogenesis and obesity. Int. J. Obes. 2013, 37, 325–332. [Google Scholar] [CrossRef]
- Milagro, F.I.; Miranda, J.; Portillo, M.P.; Fernandez-Quintela, A.; Campión, J.; Martínez, J.A. High-throughput sequencing of microRNAs in peripheral blood mononuclear cells: Identification of potential weight loss biomarkers. PLoS ONE 2013, 8, e54319. [Google Scholar]
- Tabet, F.; Forres, L.F.C.; Ong, K.L.; Shrestha, S.; Choteau, S.A.; Barter, P.J.; Clifton, P.; Rye, K.A. High-density lipoprotein-associated miR-223 is altered after diet-induced weight loss in overweight and obese males. PLoS ONE 2016, 11, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Kroh, E.M.; Parkin, R.K.; Mitchell, P.S.; Tewari, M. Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods 2010, 50, 298–301. [Google Scholar] [CrossRef]
- Ganepola, G.A.; Rutledge, J.R.; Suman, P.; Yiengpruksawan, A.; Chang, D.H. Novel blood-based microRNA biomarker panel for early diagnosis of pancreatic cancer. World J. Gastrointest. Oncol. 2014, 6, 22. [Google Scholar] [CrossRef] [PubMed]
- De Planell-Saguer, M.; Rodicio, M.C. Detection methods for microRNAs in clinic practice. Clin. Biochem. 2013, 46, 869–878. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Lu, Z.; Li, H.; Lu, J.; Guo, L.; Ge, Q. Next-generation sequencing of microRNAs for breast cancer detection. J. Biomed. Biotechnol. 2011, 2011, 597145. [Google Scholar] [CrossRef] [PubMed]
- Pritchard, C.C.; Cheng, H.H.; Tewari, M. MicroRNA profiling: Approaches and considerations. Nat. Rev. Genet. 2012, 13, 358–369. [Google Scholar] [CrossRef] [PubMed]
- Zubakov, D.; Boersma, A.W.M.; Choi, Y.; Van Kuijk, P.F.; Wiemer, E.A.C.; Kayser, M. MicroRNA markers for forensic body fluid identification obtained from microarray screening and quantitative RT-PCR confirmation. Int. J. Legal Med. 2010, 124, 217–226. [Google Scholar] [CrossRef] [PubMed]
- Velmanickam, L.; Bains, M.; Fondakowski, M.; Dorsam, G.P.; Nawarathna, D. iLluminate-miRNA: Paradigm for high-throughput, low-cost, and sensitive miRNA detection in serum samples at point-of-care. J. Phys. D Appl. Phys. 2019, 52, 055401. [Google Scholar] [CrossRef]
- Sangiao-Alvarellos, S.; Theofilatos, K.; Barwari, T.; Gutmann, C.; Takov, K.; Singh, B.; Juiz-Valiña, P.; Varela-Rodríguez, B.M.; Outeiriño-Blanco, E.; Duregotti, E.; et al. Metabolic recovery after weight loss surgery is reflected in serum microRNAs. BMJ Open Diabetes Res. Care 2020, 8, e001441. [Google Scholar] [CrossRef] [PubMed]
- Williams, M.D.; Mitchell, G.M. MicroRNAs in insulin resistance and obesity. Exp. Diabetes Res. 2012, 2012, 484696. [Google Scholar] [CrossRef]
- Kajimoto, K.; Naraba, H.; Iwai, N. MicroRNA and 3T3-L1 pre-adipocyte differentiation. RNA 2006, 12, 1626–1632. [Google Scholar] [CrossRef] [PubMed]
- Frost, R.J.A.; Olson, E.N. Control of glucose homeostasis and insulin sensitivity by the Let-7 family of microRNAs. Proc. Natl. Acad. Sci. USA 2011, 108, 21075–21080. [Google Scholar] [CrossRef] [PubMed]
- Wing, C.; Simon, K.; Bello-Gomez, R.A. Designing Difference in Difference Studies: Best Practices for Public Health Policy Research. Annu. Rev. Public Health 2018, 39, 453–469. [Google Scholar] [CrossRef] [PubMed]
- Lorente-Cebrián, S.; González-Muniesa, P.; Milagro, F.I.; Martínez, J.A. MicroRNAs and other non-coding RNAs in adipose tissue and obesity: Emerging roles as biomarkers and therapeutic targets. Clin. Sci. 2019, 133, 23–40. [Google Scholar] [CrossRef]
- Ortega, F.J.; Mercader, J.M.; Catalán, V.; Moreno-Navarrete, J.M.; Pueyo, N.; Sabater, M.; Gómez-Ambrosi, J.; Anglada, R.; Fernández-Formoso, J.A.; Ricart, W.; et al. Targeting the Circulating MicroRNA Signature of Obesity. Clin. Chem. 2013, 59, 781–792. [Google Scholar] [CrossRef]
- Sheng, Z.; Lu, W.; Zuo, Z.; Wang, D.; Zuo, P.; Yao, Y.; Ma, G. MicroRNA-7b attenuates ischemia/reperfusion-induced H9C2 cardiomyocyte apoptosis via the hypoxia inducible factor-1/p-p38 pathway. J. Cell. Biochem. 2019, 120, 9947–9955. [Google Scholar] [CrossRef]
- Chen, Z.; Jin, Y.; Yu, D.; Wang, A.; Mahjabeen, I.; Wang, C.; Liu, X.; Zhou, X. Down-regulation of the microRNA-99 family members in head and neck squamous cell carcinoma. Oral Oncol. 2012, 48, 686–691. [Google Scholar] [CrossRef] [PubMed]
- Caus, M.; Eritja, À.; Bozic, M. Role of microRNAs in Obesity-Related Kidney Disease. Int. J. Mol. Sci. 2021, 22, 11416. [Google Scholar] [CrossRef] [PubMed]
- Landrier, J.F.; Derghal, A.; Mounien, L. MicroRNAs in obesity and related metabolic disorders. Cells 2019, 8, 859. [Google Scholar] [CrossRef] [PubMed]
- Kurylowicz, A. microRNAs in human adipose tissue physiology and dysfunction. Cells 2021, 10, 3342. [Google Scholar] [CrossRef] [PubMed]
Mean ± SD | |
---|---|
Age (years) | 39.13 ± 13.03 |
Height (cm) | 168.73 ± 7.71 |
Body Mass (kg) | 84.43 ± 11.35 |
BMI (kg/m2) | 29.57 ± 2.53 |
Hip Circumference (cm) | 110.81 ± 4.93 |
Waist Circumference (cm) | 89.46 ± 8.43 |
Resting HR (bpm) | 72.46 ± 9.64 |
Resting Systolic BP (mmHg) | 126.85 ± 9.60 |
Resting Diastolic BP (mmHg) | 81.46 ± 9.49 |
Non-Responders (n = 13) | Responders (n = 13) | p Values | ||||
---|---|---|---|---|---|---|
Pre | Post | Pre | Post | Time | Interaction | |
Tissue mass (kg) | 84.9 ± 9.8 | 84.2 ± 9.7 | 78.8 ± 11.5 | 76.3 ± 11.9 | p < 0.001 | p < 0.001 |
Fat mass (kg) | 35.1 ± 6.5 | 34.3 ± 6.5 | 30.5 ± 6.6 | 28.6 ± 6.8 | p < 0.001 | p = 0.040 |
Lean mass (kg) | 49.7 ± 7.7 | 49.9 ± 7.3 | 48.3 ± 8.0 | 47.7 ± 7.9 | p = 0.354 | p = 0.126 |
Total mass (kg) | 87.6 ± 10.2 | 86.9 ± 10.1 | 81.3 ± 11.8 | 78.8 ± 12.2 | p < 0.001 | p < 0.001 |
Systolic blood pressure (mmHg) | 130.3 ± 9.2 | 120.9 ± 7.0 | 123.4 ± 9.1 | 118.5 ± 11.7 | p = 0.002 | p = 0.287 |
Diastolic blood pressure (mmHg) | 85.4 ± 9.4 | 77.3 ± 6.6 | 77.5 ± 8.1 | 73.1 ± 8.5 | p = 0.005 | p = 0.376 |
Resting heart rate (bpm) | 76.8 ± 9.6 | 70.2 ± 12.1 | 68.2 ± 7.9 | 62.0 ± 9.0 | p < 0.001 | p = 0.875 |
Waist circumference (cm) | 92.2 ± 7.9 | 90.2 ± 9.9 | 86.8 ± 8.4 | 82.5 ± 9.4 | p = 0.001 | p = 0.180 |
Hip circumference (cm) | 112.1 ± 5.5 | 109.8 ± 5.9 | 109.5 ± 4.1 | 105.9 ± 4.2 | p < 0.001 | p = 0.057 |
Daily energy intake (kcal) | 2257 ± 592 | 1748 ± 441 | 1932 ± 392 | 1581 ± 258 | p < 0.001 | p = 0.393 |
t-Test | t-Test | |||||||
---|---|---|---|---|---|---|---|---|
Regressor | Estimate | St. Error | t-Test | Prob. | Estimate | St. Error | t-Test | Prob. |
Regression Intercept & Pre-Post | ||||||||
Intercept | −46.406 | 18.634 | −2.490 | 0.019 | −59.656 | 24.675 | −2.420 | 0.022 |
Post-Intervention Indicator | 1.082 | 5.250 | 0.210 | 0.838 | −5.565 | 6.953 | −0.800 | 0.430 |
Subject Characteristics | ||||||||
Systolic BP (mmHg) | 0.006 | 0.069 | 0.080 | 0.935 | 0.072 | 0.091 | 0.790 | 0.435 |
Diastolic BP (mmHg) | 0.029 | 0.074 | 0.390 | 0.697 | −0.091 | 0.098 | −0.930 | 0.359 |
Resting Heart Rate (bt/min) | 0.098 | 0.055 | 1.760 | 0.088 | −0.061 | 0.073 | −0.830 | 0.416 |
Waist Measurement (cm) | 0.359 | 0.083 | 4.310 | <0.001 | 0.002 | 0.110 | 0.020 | 0.983 |
Hip Measurement (cm) | 0.713 | 0.095 | 7.470 | <0.001 | 0.211 | 0.126 | 1.670 | 0.105 |
Energy Expenditure (kcal) | −0.0004 | 0.001 | −0.650 | 0.521 | −0.001 | 0.001 | −0.790 | 0.436 |
Energy Intake from Diet (kcal) | 0.00001 | 0.001 | 0.010 | 0.990 | −0.001 | 0.002 | −0.930 | 0.358 |
Participant Age (yr) | −0.053 | 0.047 | −1.110 | 0.276 | −0.109 | 0.063 | −1.740 | 0.092 |
Height (cm) | −0.252 | 0.109 | −2.300 | 0.028 | 0.597 | 0.145 | 4.120 | <0.001 |
Gender | −0.712 | 2.002 | −0.360 | 0.725 | 6.584 | 2.651 | 2.480 | 0.019 |
miRs Molarities | ||||||||
miR 140 | 1.848 | 0.593 | 3.120 | 0.004 | −1.750 | 0.785 | −2.230 | 0.033 |
miR 140 1 | −1.940 | 0.668 | −2.900 | 0.007 | 1.430 | 0.885 | 1.620 | 0.117 |
miR 935 | −1.037 | 0.319 | −3.260 | 0.003 | 0.334 | 0.422 | 0.790 | 0.435 |
miR 935 1 | 1.905 | 0.435 | 4.380 | <0.001 | −1.393 | 0.576 | −2.420 | 0.022 |
miR Let-7b | −0.361 | 0.377 | −0.960 | 0.345 | 0.746 | 0.499 | 1.490 | 0.145 |
miR Let-7b 1 | 0.498 | 0.597 | 0.830 | 0.411 | 0.315 | 0.791 | 0.400 | 0.694 |
miR 99a | 0.158 | 0.263 | 0.600 | 0.553 | −0.337 | 0.349 | −0.970 | 0.341 |
miR 99a 1 | −0.173 | 0.370 | −0.470 | 0.643 | 0.562 | 0.490 | 1.150 | 0.260 |
miR Control | −0.021 | 1.483 | −0.010 | 0.989 | 1.354 | 1.964 | 0.690 | 0.496 |
miR Control 1 | 3.119 | 11.655 | 0.270 | 0.791 | 7.773 | 15.434 | 0.500 | 0.618 |
R-Square | 0.917 | 0.876 | ||||||
Adjusted R-Square | 0.860 | 0.789 | ||||||
F[21,30]-Statistic of Overall Model Fit | 15.850 | <0.001 | 10.060 | <0.001 | ||||
F[10,30]-Statistic, Joint Significance of All miR Coefficients | 2.499 | 0.026 | 2.117 | 0.055 | ||||
F[5,30]-Statistic, Joint Significance of All Pre-Intervention miR Coefficients | 2.713 | 0.017 | 2.093 | 0.058 | ||||
F[5,30]-Statistic, Joint Significance of All Post Intervention miR Coefficients | 4.643 | 0.001 | 1.534 | 0.176 | ||||
Number of Observations | 52 | 52 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jayasooriya, V.; Johnson, N.; Bradley, A.; Kotarsky, C.; Jepng’etich, L.; Friesner, D.; Stastny, S.; Hackney, K.J.; Nawarathna, D. A Miniaturized MicroRNA Sensor Identifies Targets Associated with Weight Loss in a Diet and Exercise Intervention among Healthy Overweight Individuals. Sensors 2022, 22, 6758. https://doi.org/10.3390/s22186758
Jayasooriya V, Johnson N, Bradley A, Kotarsky C, Jepng’etich L, Friesner D, Stastny S, Hackney KJ, Nawarathna D. A Miniaturized MicroRNA Sensor Identifies Targets Associated with Weight Loss in a Diet and Exercise Intervention among Healthy Overweight Individuals. Sensors. 2022; 22(18):6758. https://doi.org/10.3390/s22186758
Chicago/Turabian StyleJayasooriya, Vidura, Nathaniel Johnson, Adam Bradley, Christopher Kotarsky, Lizzy Jepng’etich, Daniel Friesner, Sherri Stastny, Kyle J. Hackney, and Dharmakeerthi Nawarathna. 2022. "A Miniaturized MicroRNA Sensor Identifies Targets Associated with Weight Loss in a Diet and Exercise Intervention among Healthy Overweight Individuals" Sensors 22, no. 18: 6758. https://doi.org/10.3390/s22186758
APA StyleJayasooriya, V., Johnson, N., Bradley, A., Kotarsky, C., Jepng’etich, L., Friesner, D., Stastny, S., Hackney, K. J., & Nawarathna, D. (2022). A Miniaturized MicroRNA Sensor Identifies Targets Associated with Weight Loss in a Diet and Exercise Intervention among Healthy Overweight Individuals. Sensors, 22(18), 6758. https://doi.org/10.3390/s22186758