Graphene Oxide Nanoparticles Modified Paper Electrode as a Biosensing Platform for Detection of the htrA Gene of O. tsutsugamushi
Abstract
1. Introduction
2. Experimental
2.1. Materials
2.2. Apparatus
2.3. Synthesis of Graphene Oxide
2.4. Modification of the Screen-Printed Paper Electrode (SPPE) Using GO (SPPE/GO)
2.5. Fabrication of the DNA Sensor (SPPE/GO/ssDNAprobe/BSA)
2.6. Characterization
2.7. Measurement of DNA Sensor Response
2.8. Selectivity, Specificity and Stability
3. Results and Discussion
3.1. Characterization of GONPs
3.2. Surface Characterization
3.3. Electrochemical Characterizations
3.4. Performance of Electrochemical DNA Sensor
3.5. Selectivity, Specificity, and Stability of the Fabricated DNA Sensor
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Kala, D.; Gupta, S.; Nagraik, R.; Verma, V.; Thakur, A.; Kaushal, A. Diagnosis of scrub typhus: Recent advancements and challenges. 3 Biotech 2020, 10, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Neelakandan, S.; Viswanathan, S.; Selvaraj, J.; Pillai, V. Scrub typhus meningitis: A clue so near. BMJ Case Rep. 2021, 14, e242377. [Google Scholar] [CrossRef] [Scilit]
- Kala, D.; Sharma, T.K.; Gupta, S.; Nagraik, R.; Verma, V.; Thakur, A.; Kaushal, A. AuNPs/CNF-modified DNA biosensor for early and quick detection of O. tsutsugamushi in patients suffering from scrub typhus. 3 Biotech 2020, 10, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Saraswati, K.; Day, N.P.; Mukaka, M.; Blacksell, S.D. Scrub typhus point-of-care testing: A systematic review and meta-analysis. PLoS Negl. Trop. Dis. 2018, 12, e0006330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohanraj, J.; Durgalakshmi, D.; Rakkesh, R.A.; Balakumar, S.; Rajendran, S.; Karimi-Maleh, H. Facile synthesis of paper based graphene electrodes for point of care devices: A double stranded DNA (dsDNA) biosensor. J. Colloid Interface Sci. 2020, 566, 463–472. [Google Scholar] [CrossRef] [Scilit]
- Cao, L.; Han, G.C.; Xiao, H.; Chen, Z.; Fang, C. A novel 3D paper-based microfluidic electrochemical glucose biosensor based on rGO-TEPA/PB sensitive film. Anal. Chim. Acta 2020, 1096, 34–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yáñez-Sedeño, P.; Campuzano, S.; Pingarrón, J.M. Screen-printed electrodes: Promising paper and wearable transducers for (bio) sensing. Biosensors 2020, 10, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farshchi, F.; Saadati, A.; Hasanzadeh, M. Optimized DNA-based biosensor for monitoring Leishmania infantum in human plasma samples using biomacromolecular interaction: A novel platform for infectious disease diagnosis. Anal. Methods 2020, 12, 4759–4768. [Google Scholar] [CrossRef] [Scilit]
- Gutiérrez-Capitán, M.; Baldi, A.; Fernández-Sánchez, C. Electrochemical paper-based biosensor devices for rapid detection of biomarkers. Sensors 2020, 20, 967. [Google Scholar] [CrossRef] [Scilit]
- Loo, S.W.; Pui, T.S. Cytokine and cancer biomarkers detection: The dawn of electrochemical paper-based biosensor. Sensors 2020, 20, 1854. [Google Scholar] [CrossRef] [Scilit]
- Sakata, T.; Hagio, M.; Saito, A.; Mori, Y.; Nakao, M.; Nishi, K. Biocompatible and flexible paper-based metal electrode for potentiometric wearable wireless biosensing. Sci. Technol. Adv. Mater. 2020, 21, 379–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valentine, C.J.; Takagishi, K.; Umezu, S.; Daly, R.; De Volder, M. Based electrochemical sensors using paper as a scaffold to create porous carbon nanotube electrodes. ACS Appl. Mater. Interfaces 2020, 12, 30680–30685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, S.; Zhang, L.; Zhang, Y.; Liu, H.; Huang, J.; Yan, M.; Yu, J. Electrochemical K-562 cells sensor based on origami paper device for point-of-care testing. Talanta 2015, 145, 12–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Zhang, Y.; Dong, C.; Ge, S.; Yu, J. A 3D electrochemical immunodevice based on a porous Pt-paper electrode and metal ion functionalized flower-like Au nanoparticles. J. Mater. Chem. B 2015, 3, 2764–2769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Umar, M.; Saifi, A.; Kumar, S.; Augustine, S.; Srivastava, S.; Malhotra, B.D. Electrochemical paper based cancer biosensor using iron oxide nanoparticles decorated PEDOT: PSS. Anal. Chim. Acta 2019, 1056, 135–145. [Google Scholar] [CrossRef] [Scilit]
- Prasad, K.S.; Cao, X.; Gao, N.; Jin, Q.; Sanjay, S.T.; Henao-Pabon, G.; Li, X. A low-cost nanomaterial-based electrochemical immunosensor on paper for high-sensitivity early detection of pancreatic cancer. Sens. Actuators B Chem. 2020, 305, 127516. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.; Kim, J.; Kim, S.; Min, D.H. Biosensors based on graphene oxide and its biomedical application. Adv. Drug Deliv. Rev. 2016, 105, 275–287. [Google Scholar] [CrossRef] [Scilit]
- Qian, L.; Thiruppathi, A.R.; Elmahdy, R.; van der Zalm, J.; Chen, A. Graphene-Oxide-Based electrochemical sensors for the sensitive detection of pharmaceutical drug naproxen. Sensors 2020, 20, 1252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peña-Bahamonde, J.; Nguyen, H.N.; Fanourakis, S.K.; Rodrigues, D.F. Recent advances in graphene-based biosensor technology with applications in life sciences. J. Nanobiotechnol. 2018, 16, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Sehrawat, P.; Islam, S.S.; Mishra, P.; Ahmad, S. Reduced graphene oxide (rGO) based wideband optical sensor and the role of temperature, defect states and quantum efficiency. Sci. Rep. 2018, 8, 1–13. [Google Scholar]
- Balaji, A.; Yang, S.; Wang, J.; Zhang, J. Graphene oxide-based nanostructured DNA sensor. Biosensors 2019, 9, 74. [Google Scholar] [CrossRef] [Scilit]
- Gong, Q.; Han, H.; Yang, H.; Zhang, M.; Sun, X.; Liang, Y.; Liu, Z.; Zhang, W.; Qiao, J. Sensitive electrochemical DNA sensor for the detection of HIV based on a polyaniline/graphene nanocomposite. J. Mater. 2019, 5, 313–319. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi, M.; Ahour, F. An electrochemical biosensor based on a graphene oxide modified pencil graphite electrode for direct detection and discrimination of double-stranded DNA sequences. Anal. Methods 2020, 12, 4541–4550. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Fu, B.; Liu, T.; Yan, Z.; Li, K. A graphene oxide-DNA electrochemical sensor based on glassy carbon electrode for sensitive determination of methotrexate. Electroanalysis 2018, 30, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Furst, A.L.; Hill, M.G.; Barton, J.K. Electrocatalysis in DNA sensors. Polyhedron 2014, 84, 150–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaaba, N.I.; Foo, K.L.; Hashim, U.; Tan, S.J.; Liu, W.W.; Voon, C.H. Synthesis of graphene oxide using modified hummers method: Solvent influence. Procedia Eng. 2017, 184, 469–477. [Google Scholar] [CrossRef] [Scilit]
- Yakovenko, O.S.; Matzui, L.Y.; Vovchenko, L.L.; Lozitsky, O.V.; Prokopov, O.I.; Lazarenko, O.A.; Zhuravkov, A.V.; Oliynyk, V.V.; Launets, V.L.; Trukhanov, S.V.; et al. Electrophysical properties of epoxy-based composites with graphite nanoplatelets and magnetically aligned magnetite. Mol. Cryst. Liq. Cryst. 2018, 661, 68–80. [Google Scholar] [CrossRef] [Scilit]
- Manoratne, C.H.; Rosa, S.R.D.; Kottegoda, I.R.M. XRD-HTA, UV visible, FTIR and SEM interpretation of reduced graphene oxide synthesized from high purity vein graphite. Mat. Sci. Res. India 2017, 14, 19–30. [Google Scholar] [CrossRef] [Scilit]
- Ghadim, E.E.; Manouchehri, F.; Soleimani, G.; Hosseini, H.; Kimiagar, S.; Nafisi, S. Adsorption properties of tetracycline onto graphene oxide: Equilibrium, kinetic and thermodynamic studies. PLoS ONE 2013, 8, e79254. [Google Scholar] [CrossRef] [Scilit]
- Song, N.J.; Chen, C.M.; Lu, C.; Liu, Z.; Kong, Q.Q.; Cai, R. Thermally reduced graphene oxide films as flexible lateral heat spreaders. J. Mater. Chem. A 2014, 2, 16563–16568. [Google Scholar] [CrossRef] [Scilit]
- He, D.; Peng, Z.; Gong, W.; Luo, Y.; Zhao, P.; Kong, L. Mechanism of a green graphene oxide reduction with reusable potassium carbonate. RSC Adv. 2015, 5, 11966–11972. [Google Scholar] [CrossRef] [Scilit]
- Ickecan, D.; Zan, R.; Nezir, S. Eco-Friendly synthesis and characterization of reduced graphene oxide. J. Phys. Conf. Ser. 2017, 902, 012027. [Google Scholar] [CrossRef] [Scilit]
- Kumar, N.; Das, S.; Bernhard, C.; Varma, G.D. Effect of graphene oxide doping on superconducting properties of bulk MgB2. Supercond. Sci. Technol. 2013, 26, 095008. [Google Scholar]
- Li, J.; Zeng, X.; Ren, T.; Van der Heide, E. The preparation of graphene oxide and its derivatives and their application in bio-tribological systems. Lubricants 2014, 2, 137–161. [Google Scholar] [CrossRef] [Scilit]
- Bahrami, A.; Kazeminezhad, I.; Abdi, Y. Pt-Ni/rGO counter electrode: Electrocatalytic activity for dye-sensitized solar cell. Superlattices Microstruct. 2019, 125, 125–137. [Google Scholar] [CrossRef] [Scilit]
- Zakirov, M.I.; Semen’ko, M.P.; Korotchenkov, O.A. A simple sonochemical synthesis of nanosized ZnO from zinc acetate and sodium hydroxide. J. Nano Electron. Phys. 2018, 10. [Google Scholar] [CrossRef] [Scilit]
- Verma, V.; Kala, D.; Gupta, S.; Kumar, H.; Kaushal, A.; Kuča, K.; Cruz-Martins, N.; Kumar, D. Leptospira interrogans outer membrane protein-based nanohybrid sensor for the diagnosis of leptospirosis. Sensors 2021, 21, 2552. [Google Scholar] [CrossRef] [Scilit]









| DNA Sample | Mismatch Base Sequences |
|---|---|
| cDNA | 5′ACCCCAGAACCTAAGAACACT 3′ |
| 1 base mismatch | 5′AGCCCAGAACCTAAGAACACT 3′ |
| 2 base mismatch | 5′ AGGCCAGAACCTAAGAACACT 3′ |
| 3 base mismatch | 5′ AGGGCAGAACCTAAGAACACT 3′ |
| 4 base mismatch | 5′ TGGGCAGAACCTAAGAACACT 3′ |
| Multiple base mismatch | 5′ TGGGCACAAGGTAAGTTCAGT 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kala, D.; Sharma, T.K.; Gupta, S.; Verma, V.; Thakur, A.; Kaushal, A.; Trukhanov, A.V.; Trukhanov, S.V. Graphene Oxide Nanoparticles Modified Paper Electrode as a Biosensing Platform for Detection of the htrA Gene of O. tsutsugamushi. Sensors 2021, 21, 4366. https://doi.org/10.3390/s21134366
Kala D, Sharma TK, Gupta S, Verma V, Thakur A, Kaushal A, Trukhanov AV, Trukhanov SV. Graphene Oxide Nanoparticles Modified Paper Electrode as a Biosensing Platform for Detection of the htrA Gene of O. tsutsugamushi. Sensors. 2021; 21(13):4366. https://doi.org/10.3390/s21134366
Chicago/Turabian StyleKala, Deepak, Tarun Kumar Sharma, Shagun Gupta, Vivek Verma, Atul Thakur, Ankur Kaushal, Alex V. Trukhanov, and Sergei V. Trukhanov. 2021. "Graphene Oxide Nanoparticles Modified Paper Electrode as a Biosensing Platform for Detection of the htrA Gene of O. tsutsugamushi" Sensors 21, no. 13: 4366. https://doi.org/10.3390/s21134366
APA StyleKala, D., Sharma, T. K., Gupta, S., Verma, V., Thakur, A., Kaushal, A., Trukhanov, A. V., & Trukhanov, S. V. (2021). Graphene Oxide Nanoparticles Modified Paper Electrode as a Biosensing Platform for Detection of the htrA Gene of O. tsutsugamushi. Sensors, 21(13), 4366. https://doi.org/10.3390/s21134366

