Visual Detection of Cucumber Green Mottle Mosaic Virus Based on Terminal Deoxynucleotidyl Transferase Coupled with DNAzymes Amplification
Abstract
1. Introduction
2. Experimental Section
2.1. Material and Reagents
2.2. Instrumentation
2.3. Procedure for CGMMV Assay
2.4. Gel Electrophoresis
2.5. Preparation of Viral cDNA Template from Real Sample
3. Results and Discussion
3.1. Principle of CGMMV Assay
3.2. Feasibility of TdT-Assisted Tailing Reaction
3.3. Feasibility of Visual Detection of CGMMV
3.4. Optimization of CGMMV Assay
3.5. Sensitivity of CGMMV Assay
3.6. Challenged with Plant Samples
4. Conclusions
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Sharma, P.; Verma, R.K.; Mishra, R.; Sahu, A.K.; Choudhary, D.K.; Gaur, R.K. First report of cucumber green mottle mosaic virus association with the leaf green mosaic disease of a vegetable crop, Luffa acutangula L. Acta Virol. 2014, 58, 299–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ugaki, M.; Tomiyama, M.; Kakutani, T.; Hidaka, S.; Kiguchi, T.; Nagata, R.; Sato, T.; Motoyoshi, F.; Nishiguchi, M. The complete nucleotide sequence of cucumber green mottle mosaic virus (SH strain) genomic RNA. J. Gen. Virol. 1991, 72, 1487–1495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dombrovsky, A.; Tran-Nguyen, L.T.T.; Jones, R.A.C. Cucumber green mottle mosaic virus: Rapidly Increasing Global Distribution, Etiology, Epidemiology, and Management. Annu. Rev. Phytopathol. 2017, 55, 231–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shang, H.; Xie, Y.; Zhou, X.; Qian, Y.; Wu, J. Monoclonal antibody-based serological methods for detection of Cucumber green mottle mosaic virus. Virol. J. 2011, 8, 228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lobert, S.; Heil, P.D.; Namba, K.; Stubbs, G. Preliminary X-ray fiber diffraction studies of cucumber green mottle mosaic virus, watermelon strain. J. Mol. Boil. 1987, 196, 935–938. [Google Scholar] [CrossRef] [Scilit]
- Hongyun, C.; Wenjun, Z.; Qinsheng, G.; Qing, C.; Shiming, L.; Shuifang, Z. Real time TaqMan RT-PCR assay for the detection of Cucumber green mottle mosaic virus. J. Virol. Methods 2008, 149, 326–329. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.H.; Wang, L.J.; Callaway, Z.T.; Lu, H.G.; Huang, T.J.; Li, Y.B. A nanowell-based QCM aptasensor for rapid and sensitive detection of avian influenza virus. Sens. Actuators B Chem 2017, 240, 934–940. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Han, T.; Wei, Q.; Zhang, S. Efficient Enhancement of Electrochemiluminescence from Cadmium Sulfide Quantum Dots by Glucose Oxidase Mimicking Gold Nanoparticles for Highly Sensitive Assay of Methyltransferase. Anal. Chem. 2016, 88, 2976–2983. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Cui, M.; Zhou, H.; Zhang, S. Efficient double-quenching of electrochemiluminescence from CdS:Eu QDs by hemin-graphene-Au nanorods ternary composite for ultrasensitive immunoassay. Sci. Rep. 2016, 6, 30577. [Google Scholar] [CrossRef] [Scilit]
- Ashiba, H.; Sugiyama, Y.; Wang, X.M.; Shirato, H.; Higo-Moriguchi, K.; Taniguchi, K.; Ohki, Y.; Fujimaki, M. Detection of norovirus virus-like particles using a surface plasmon resonance-assisted fluoroimmunosensor optimized for quantum dot fluorescent labels. Biosens. Bioelectron. 2017, 93, 260–266. [Google Scholar] [CrossRef] [Scilit]
- Wong, C.; Chua, M.; Mittman, H.; Choo, L.; Lim, H.; Olivo, M. A Phase-Intensity Surface Plasmon Resonance Biosensor for Avian Influenza A (H5N1) Detection. Sensors 2017, 17, 2363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Xu, X.; Huang, Z.; Luo, Y.; Tang, L.; Jiang, J.H. BEAMing LAMP: Single-molecule capture and on-bead isothermal amplification for digital detection of hepatitis C virus in plasma. Chem. Commun. 2018, 54, 291–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez-Jimena, B.; Bekaert, M.; Bakheit, M.; Frischmann, S.; Patel, P.; Simon-Loriere, E.; Lambrechts, L.; Duong, V.; Dussart, P.; Harold, G.; et al. Development and validation of four one-step real-time RT-LAMP assays for specific detection of each dengue virus serotype. PLoS Negl. Trop. Dis. 2018, 12, e0006381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, H.; Li, W.J.; Yao, X.J.; Wu, Y.Y.; Liu, L.L.; He, H.M.; Zhang, R.L.; Ma, Y.F.; Cai, L.T. In Situ Bioorthogonal Metabolic Labeling for Fluorescence Imaging of Virus Infection In Vivo. Small 2017, 13, 1604036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adegoke, O.; Morita, M.; Kato, T.; Ito, M.; Suzuki, T.; Park, E.Y. Localized surface plasmon resonance-mediated fluorescence signals in plasmonic nanoparticle-quantum dot hybrids for ultrasensitive Zika virus RNA detection via hairpin hybridization assays. Biosens. Bioelectron. 2017, 94, 513–522. [Google Scholar] [CrossRef] [Scilit]
- Rivas, L.; Escosura-Muñiz, A.; Serrano, L.; Altet, L.; Francino, O.; Sánchez, A.; Merkoçi, A. Triple lines gold nanoparticle-based lateral flow assay for enhanced and simultaneous detection of Leishmania DNA and endogenous control. Nano Res. 2015, 8, 3704–3714. [Google Scholar] [CrossRef] [Scilit]
- Le, T.T.; Chang, P.; Benton, D.; Mccauley, J.W.; Iqbal, M.; Aeg, C. Dual Recognition Element Lateral Flow Assay (DRELFA)—Towards Multiplex Strain Specific Influenza Virus Detection. Anal. Chem. 2017, 89, 6781. [Google Scholar] [CrossRef] [Scilit]
- Choi, J.R.; Yong, K.W.; Tang, R.; Gong, Y.; Wen, T.; Yang, H.; Li, A.; Chia, Y.C.; Pingguan-Murphy, B.; Xu, F. Lateral Flow Assay Based on Paper-Hydrogel Hybrid Material for Sensitive Point-of-Care Detection of Dengue Virus. Adv. Healthc. Mater. 2017, 6, 1600920. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Xin, X.; Zhou, H.; Zhang, S. A ternary composite based on graphene, hemin, and gold nanorods with high catalytic activity for the detection of cell-surface glycan expression. Chem. A Eur. J. 2015, 21, 1908–1914. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Cui, M.; Niu, L.; Zhou, H.; Zhang, S. Enhanced Peroxidase-Like Properties of Graphene-Hemin-Composite Decorated with Au Nanoflowers as Electrochemical Aptamer Biosensor for the Detection of K562 Leukemia Cancer Cells. Chem. A Eur. J. 2016, 22, 18001–18008. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhou, H.; Xu, J.; Chen, H. Switchable ‘on–off–on’electrochemical technique for direct detection of survivin mRNA in living cells. Analyst 2012, 137, 3940–3945. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.O.; An, K.L.; Shin, S.R.; Jun, K.; Naveen, M.; Son, Y.A. “Turn-On” Fluorescent and Colorimetric Detection of Zn2+ Ions by Rhodamine-Cinnamaldehyde Derivative. J. Nanosci. Nanotechnol. 2018, 18, 5333–5340. [Google Scholar] [CrossRef] [Scilit]
- Ortiz-Tena, J.G.; Ruhmann, B.; Sieber, V. Colorimetric Determination of Sulfate via an Enzyme Cascade for High-Throughput Detection of Sulfatase Activity. Anal. Chem. 2018, 90, 2526–2533. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, H.; Tu, X.; Fu, Z.; Wang, W.; Fu, S.; Zhu, C.; Du, D.; Lin, Y. Colorimetric and chemiluminescent dual-readout immunochromatographic assay for detection of pesticide residues utilizing g-C3N4/BiFeO3 nanocomposites. Biosens. Bioelectron. 2018, 106, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Shibata, H.; Henares, T.G.; Yamada, K.; Suzuki, K.; Citterio, D. Implementation of a plasticized PVC-based cation-selective optode system into a paper-based analytical device for colorimetric sodium detection. Analyst 2018, 143, 678–686. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Zhang, L.; Wei, W.; Zhao, H.; Zhou, Z.; Zhang, Y.; Liu, S. Colorimetric detection of influenza A virus using antibody-functionalized gold nanoparticles. Analyst 2015, 140, 3989–3995. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Ouyang, W.; Xie, P.; Lin, Y.; Qiu, B.; Lin, Z.; Chen, G.; Guo, L. Highly Uniform Gold Nanobipyramids for Ultrasensitive Colorimetric Detection of Influenza Virus. Anal. Chem. 2017, 89, 1617–1623. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Zou, Z.; Chen, L.; Ji, X.; He, Z. Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection. Nanotechnology 2016, 27, 435102. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez, N.M.; Linnes, J.C.; Fan, A.; Ellenson, C.K.; Pollock, N.R.; Klapperich, C.M. Paper-Based RNA Extraction, in Situ Isothermal Amplification, and Lateral Flow Detection for Low-Cost, Rapid Diagnosis of Influenza A (H1N1) from Clinical Specimens. Anal. Chem. 2015, 87, 7872–7879. [Google Scholar] [CrossRef] [Scilit]
- Hamidi, S.V.; Ghourchian, H. Colorimetric monitoring of rolling circle amplification for detection of H5N1 influenza virus using metal indicator. Biosens. Bioelectron. 2015, 72, 121–126. [Google Scholar] [CrossRef] [Scilit]
- Mao, X.; Liu, S.; Yang, C.; Liu, F.; Wang, K.; Chen, G. Colorimetric detection of hepatitis B virus (HBV) DNA based on DNA-templated copper nanoclusters. Anal. Chim. Acta 2016, 909, 101–108. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Li, M.; Du, F.; Chen, G.; Yasmeen, A.; Tang, Z. A Novel Colorimetric PCR-Based Biosensor for Detection and Quantification of Hepatitis B Virus. Methods Mol. Boil. 2017, 1571, 357–369. [Google Scholar] [CrossRef] [Scilit]
- Calvert, A.E.; Biggerstaff, B.J.; Tanner, N.A.; Lauterbach, M.; Lanciotti, R.S. Rapid colorimetric detection of Zika virus from serum and urine specimens by reverse transcription loop-mediated isothermal amplification (RT-LAMP). PLoS ONE 2017, 12, e0185340. [Google Scholar] [CrossRef] [Scilit]
- Zaher, M.R.; Ahmed, H.A.; Hamada, K.E.Z.; Tammam, R.H. Colorimetric Detection of Unamplified Rift Valley Fever Virus Genetic Material Using Unmodified Gold Nanoparticles. Appl. Biochem. Biotechnol. 2018, 184, 898–908. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Liu, Z.; Xia, X.; Yang, C.; Huang, J.; Wan, S. Colorimetric detection of Cucumber green mottle mosaic virus using unmodified gold nanoparticles as colorimetric probes. J. Virol. Methods 2017, 243, 113–119. [Google Scholar] [CrossRef] [Scilit]
- Roychoudhury, R.; Jay, E.; Wu, R. Terminal labeling and addition of homopolymer tracts to duplex DNA fragments by terminal deoxynucleotidyl transferase. Nucleic Acids Res. 1976, 3, 863–877. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.C.; Zhu, Y.J.; Li, X.Y.; Kong, D.M. Amplified detection of genome-containing biological targets using terminal deoxynucleotidyl transferase-assisted rolling circle amplification. Chem. Commun. 2018, 54, 682–685. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Sun, Y.; Lu, J. A novel bioluminescent detection of exonuclease I activity based on terminal deoxynucleotidyl transferase-mediated pyrophosphate release. Luminescence 2018, 33, 1157–1163. [Google Scholar] [CrossRef] [Scilit]
- Brobeil, A.; Wagenlehner, F.; Gattenlohner, S. Expression of terminal deoxynucleotidyl transferase (TdT) in classical seminoma: A potential diagnostic pitfall. Virchows Arch. Int. J. Pathol. 2018, 472, 433–440. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.C.; Cui, Y.X.; Li, X.Y.; Sun, G.Y.; Zhang, Y.P.; Tang, A.N.; Kim, K.; Kong, D.M. Terminal Deoxynucleotidyl Transferase and T7 Exonuclease-Aided Amplification Strategy for Ultrasensitive Detection of Uracil-DNA Glycosylase. Anal. Chem. 2018, 90, 8629–8634. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.; Liu, H.; Li, W.; Chen, H.; Jin, S.; Wang, J.; Wang, J. Label-free monitoring of DNA methyltransferase activity based on terminal deoxynucleotidyl transferase using a thioflavin T probe. Mol. Cell. Probes 2016, 30, 118–121. [Google Scholar] [CrossRef] [Scilit]
- Leung, K.H.; He, B.; Yang, C.; Leung, C.H.; Wang, H.M.; Ma, D.L. Development of an Aptamer-Based Sensing Platform for Metal Ions, Proteins, and Small Molecules through Terminal Deoxynucleotidyl Transferase Induced G-Quadruplex Formation. ACS Appl. Mater. Interfaces 2015, 7, 24046–24052. [Google Scholar] [CrossRef] [Scilit]
- Shen, Q.; Han, L.; Fan, G.; Zhang, J.R.; Jiang, L.; Zhu, J.J. “Signal-on” photoelectrochemical biosensor for sensitive detection of human T-Cell lymphotropic virus type II DNA: Dual signal amplification strategy integrating enzymatic amplification with terminal deoxynucleotidyl transferase-mediated extension. Anal. Chem. 2015, 87, 4949–4956. [Google Scholar] [CrossRef] [Scilit]
- Zhao, B.; Gong, Z.; Ma, Z.; Wang, D.; Jin, Y. Simple and sensitive microRNA labeling by terminal deoxynucleotidyl transferase. Acta Biochim. Biophys. Sin. 2015, 47, 314. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Cui, M.; Zhou, H.; Yang, W. DNAzyme Based Nanomachine for in Situ Detection of MicroRNA in Living Cells. ACS Sens. 2017, 2, 1847–1853. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Liu, J.; Zhou, H. Amplified fluorescence detection of serum prostate specific antigen based on metal-dependent DNAzyme assistant nanomachine. Anal. Chim. Acta 2018, 1008, 96–102. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Liu, J.; Xu, J.; Zhang, S.; Chen, H. Optical nano-biosensing interface via nucleic acid amplification strategy: Construction and application. Chem. Soc. Rev. 2018, 47, 1996–2019. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Wang, W.; Dong, Q.; Huang, Y.; Wen, D.; Mu, Y.; Yuan, Y. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification. Mikrochim. Acta 2017, 185, 75. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, S.; Deng, Q.; Ling, L. A sensitive colorimetric DNA biosensor for specific detection of the HBV gene based on silver-coated glass slide and G-quadruplex-hemin DNAzyme. J. Med. Virol. 2018, 90, 699–705. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Chen, H.; Zhang, X.; Liu, Y.; Guan, A.; Li, Q.; Yang, Q.; Shi, Y.; Xu, S.; Tang, Y. Colorimetric detection of sodium ion in serum based on the G-quadruplex conformation related DNAzyme activity. Anal. Chim. Acta 2016, 912, 133–138. [Google Scholar] [CrossRef] [Scilit]
- Baetsen-Young, A.M.; Vasher, M.; Matta, L.L.; Colgan, P.; Alocilja, E.C.; Day, B. Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles. Biosens. Bioelectron. 2018, 101, 29–36. [Google Scholar] [CrossRef] [Scilit]
- Amini, B.; Kamali, M.; Salouti, M.; Yaghmaei, P. Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2018, 199, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Wen, Y.; Wang, L.; Zhou, C.; Li, Q.; Xu, L.; Li, L.; Shi, J.; Lal, R.; Ren, S.; et al. PCR-Free Colorimetric DNA Hybridization Detection Using a 3D DNA Nanostructured Reporter Probe. ACS Appl. Mater. Interfaces 2017, 9, 38281–38287. [Google Scholar] [CrossRef] [Scilit]
- Bayrac, C.; Eyidogan, F.; Avni Oktem, H. DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis. Biosens. Bioelectron. 2017, 98, 22–28. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Wang, S.; Wu, Z.; Xu, J.; Shen, G.; Yu, R. New function of exonuclease and highly sensitive label-free colorimetric DNA detection. Biosens. Bioelectron. 2016, 77, 879–885. [Google Scholar] [CrossRef] [Scilit]





| Note | Sequence (5′-3′) |
|---|---|
| P1 | ACACACAGCGATCACCCATGTTAAACGTTCGGGTT |
| T1 | AACCCGAACGTTTG |
| SNP-1 | AACCCGAACGTTAG |
| SNP-2 | AACCCGAACGTAAG |
| Hairpin (HP) | TTTTGGGTTGGGCGGGATGGGTTTATrAGGTGTGTATCCCGCCC |
| P3 | ATGCGAGTGGTATCGTCACT |
| Oligo-dT | TTTTTTTTTTTTTTTTTTTTTTTT |
| Analytical Method of Nucleotide Detection | Detection Limit | Reference |
|---|---|---|
| Detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles | 2.94 fM | [51] |
| HBV gene detection by silver-coated glass slide and DNAzyme | 0.2 nM | [49] |
| Pseudomonas aeruginosa ETA gene detection by gold nanoparticles DNA probe and endonuclease enzyme | 9.899 ng/mL | [52] |
| Detection of breast cancer 1 by a 3D DNA nanostructured reporter probe | 10 fM | [53] |
| Salmonella Enteritidis detection by DNA aptamer | 103 CFU/mL | [54] |
| Gold nanoparticles-based method for CGMMV detection | 30 pg/μL | [35] |
| Exonuclease III-based colorimetric DNA detection | 1 pM | [55] |
| Detection of CGMMV by TdT coupled with DNAzymes amplification | 0.1 pM (0.91 μg/mL) | Our strategy |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Liu, J.; Zhou, H. Visual Detection of Cucumber Green Mottle Mosaic Virus Based on Terminal Deoxynucleotidyl Transferase Coupled with DNAzymes Amplification. Sensors 2019, 19, 1298. https://doi.org/10.3390/s19061298
Wang Y, Liu J, Zhou H. Visual Detection of Cucumber Green Mottle Mosaic Virus Based on Terminal Deoxynucleotidyl Transferase Coupled with DNAzymes Amplification. Sensors. 2019; 19(6):1298. https://doi.org/10.3390/s19061298
Chicago/Turabian StyleWang, Ying, Jing Liu, and Hong Zhou. 2019. "Visual Detection of Cucumber Green Mottle Mosaic Virus Based on Terminal Deoxynucleotidyl Transferase Coupled with DNAzymes Amplification" Sensors 19, no. 6: 1298. https://doi.org/10.3390/s19061298
APA StyleWang, Y., Liu, J., & Zhou, H. (2019). Visual Detection of Cucumber Green Mottle Mosaic Virus Based on Terminal Deoxynucleotidyl Transferase Coupled with DNAzymes Amplification. Sensors, 19(6), 1298. https://doi.org/10.3390/s19061298
