Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823
Reference
- Senn, S.; Bhattacharyya, S.; Presley, G.; Taylor, A.E.; Stanis, R.; Pangell, K.; Melendez, D.; Ford, J. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823. [Google Scholar] [CrossRef]
| Marker | Description | Target Organisms | Forward Primer | Reverse Primer | Reference |
|---|---|---|---|---|---|
| 16S | Prokaryotic rRNA small subunit | Bacteria, archaea | GTGYCAGCMGCCGCGGTAA | GGACTACNVGGGTWTCTAAT | F: 515F and R: 806R, see Caporaso et al., 2012 [22] |
| 18S | Eukaryotic rRNA small subunit | Fungi, algae, protists | GTACACACCGCCCGTC | TGATCCTTCTGCAGGTTCACCTAC | Amaral-Zettler et al., 2009 [23]; Euk_1391f and EukBr |
| PITS | Plant rRNA internal transcribed spacer | Plants | ATGCGATACTTGGTGTGAAT | GACGCTTCTCCAGACTACAAT | Gu et al., 2013 [24] |
| CO1 | Mitochondrial cytochrome oxidase subunit I | Animals | GGWACWGGWTGAACWGTWTAYCCYCC | TANACYTCnGGRTGNCCRAARAAYCA | Leray et al., 2013 [25] |
| FITS | Fungal rRNA internal transcribed spacer | Fungi | GGAAGTAAAAGTCGTAACAAGG | CAAGAGATCCGTTGTTGAAAGTT | F: ITS5, White et al., 1990 [26]; R: 5.8S, Epp et al., 2012 [27] |
| 12S | Mitochondrial rRNA small subunit | Fish, birds, snakes, insects | TAGAACAGGCTCCTCTAG | TTAGATACCCCACTATGC | Epp et al., 2012 [27] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Senn, S.; Bhattacharyya, S.; Presley, G.; Taylor, A.E.; Stanis, R.; Pangell, K.; Melendez, D.; Ford, J. Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823. Diversity 2025, 17, 208. https://doi.org/10.3390/d17030208
Senn S, Bhattacharyya S, Presley G, Taylor AE, Stanis R, Pangell K, Melendez D, Ford J. Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823. Diversity. 2025; 17(3):208. https://doi.org/10.3390/d17030208
Chicago/Turabian StyleSenn, Savanah, Sharmodeep Bhattacharyya, Gerald Presley, Anne E. Taylor, Rayne Stanis, Kelly Pangell, Daila Melendez, and Jillian Ford. 2025. "Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823" Diversity 17, no. 3: 208. https://doi.org/10.3390/d17030208
APA StyleSenn, S., Bhattacharyya, S., Presley, G., Taylor, A. E., Stanis, R., Pangell, K., Melendez, D., & Ford, J. (2025). Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823. Diversity, 17(3), 208. https://doi.org/10.3390/d17030208

