Next Article in Journal
The Status and Spatial Patterns of Poaching, Illegal Trade, and Human–Bear Conflict of Asiatic Black Bears in China, 2010–2020
Previous Article in Journal
The First Detection of Parasite Ellobiopsis sp. on Calanoids (Crustacea: Copepoda) Inhabiting the Caspian Sea (Central Asia: West Kazakhstan)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 17
Issue 2
10.3390/d17020092
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Deeper Insights into Species Diversity and Ecological Characterisation of the Macrosporum Group of the Genus Tuber

by
Ruilong Liu
1,
Lingfang E
1,
Rui Wang
1,
Chengjin Yu
1,
Jingsheng Yang
1,
Yuenan Li
1,
Xuesong Jiang
1,
Junyue Song
1,
Fuqiang Yu
2,
Ruixue Wang
1,* and
Shanping Wan
1,*
1
College of Resources and Environment, Yunnan Agricultural University, Kunming 650201, China
2
The Germplasm Bank of Wild Species, Yunnan Key Laboratory for Fungal Diversity and Green Development, Kunming Institute of Botany, Chinese Academy of Sciences, 132 Lanhei Road, Kunming 650201, China
*
Authors to whom correspondence should be addressed.
Diversity 2025, 17(2), 92; https://doi.org/10.3390/d17020092
Submission received: 2 January 2025 / Revised: 23 January 2025 / Accepted: 24 January 2025 / Published: 27 January 2025
Browse Figures
Review Reports Versions Notes

Abstract

:
Tuber is a rare edible and medicinal fungus with a global distribution. The Macrosporum lineage within Tuber is a relatively small and infrequent clade, which has been receiving increasing attention due to the presence of an endangered species, T. gigantosporum. However, the species diversity, phylogenetic relationships, geographic distribution, and ecological characteristics of the Macrosporum group remain poorly understood. Through extensive sampling and combining the accurate and available global specimen and mycorrhizal data, 19 Tuber specimens from Southwest China were studied based on morphology, molecular systematics, and ecology. The specimens were identified as T. calosporum, T. glabrum, and T. sinomacrosporum within the Macrosporum group, with detailed descriptions provided, particularly supplementing the taxonomic features of T. glabrum. A classification key for the Macrosporum group species is also provided. The geographic distribution of specimens and diverse hosts suggest that the Macrosporum clade displays wider ecological adaptability. This study is important to better understand the diversity and conservation measures of Tuber resources throughout the world.

1. Introduction

The genus Tuber (Tuberaceae, Pezizales, Ascomycota), as an important hypogenous ectomycorrhizal fungi, comprises Tuber species that form symbiotic relationships with the root systems of major forest-forming trees, playing a significant ecological role in nutrient cycling and vegetation succession [1,2]. In Europe, the retail price of T. melanosporum can reach EUR 2000 per kg, while for the white truffle T. magnatum, it can go up to EUR 5000 per kg [3]. Tuber is also an important medicinal fungus, known for its high nutritional health benefits and potential medicinal value [4].
Globally, the genus Tuber is divided into 12 phylogenetic clades, including the Macrosporum lineage [5,6]. Species in the Macrosporum clade often form symbiotic relationships with angiosperms or pine species, but the geographic origins and ancestral hosts of this lineage have not been well resolved [5]. The taxonomic position of the Macrosporum clade has shifted from a genus-level classification to a subclade within Tuber. In 1935, Mattirolo established the genus Paradox within the Tuberaceae based on the key morphological feature of having only one spore per ascus [7,8]. Subsequent molecular studies have shown that species within Paradox actually belong to the Macrosporum clade of Tuber, specifically the Paradox subclade [9,10]. The Paradox subclade is characterized by asci containing 1–2 large, elliptical spores, alongside the traditional Macrosporum subclade, which has asci containing 1–4 spherical spores. Early studies identified two species in the Macrosporum clade: T. macrosporum from Europe and T. canaliculatum from North America [11,12]. Recent studies have confirmed the distribution of this group in East Asia (including China and Japan), showing greater species diversity [9,10,13,14,15]. To date, nine species have been identified within the Macrosporum clade, including European T. macrosporum; North American T. canaliculatum; Japanese T. tomentosum and T. iryudaense; and Chinese T. calosporum, T. glabrum, T. sinomonosporum, T. sinomacrosporum, and T. gigantosporum [10].
Among the Macrosporum species, two are particularly valuable due to their strong and favourable aroma [3,16]: one is T. macrosporum, whose fragrance rivals that of Italian white truffles, maturing as early as June and more commonly, from September to December [17]. It is often found on plains or north-facing slopes, lowlands, or riverbanks [18], preferring calcareous, neutral, or slightly alkaline well-aerated and moist organic soils and occasionally found in slightly acidic environments lacking limestone. Common soil types include clay loam, loam, and sandy loam [19]. The hosts are primarily deciduous mixed forest species, such as Quercus, Populus, Salix and Fagus. This species is widely distributed in Italy and Eastern Europe, and cultivation has been achieved in Austria and Hungary [20,21]. The pleasantly aromatic T. canaliculatum is one of the larger and more pungent North American Tuber species. It has a wide distribution across the Eastern USA, mainly in the mid-Atlantic states [3], and has also been successfully cultivated in Canada [16,22].
The genus Tuber evolved with rich diversity in China, including more than 80 phylogenetic species within nine phylogroups [6,23,24,25,26,27], but due to the high value of Tuber, this resource has been overexploited, leading to significant destruction. According to the Red List of Biodiversity in China—Macrofungi (2018), T. gigantosporum from the Macrosporum clade is considered the most threatened and is classified as endangered, with no new collection records since its publication [28]. According to recent research, T. sinomacrosporum bears a striking resemblance to T. gigantosporum, which makes it particularly valuable [10]. In addition, the T. calosporum and T. glabrum specimens collected in this study possess strong aromas, indicating potential scientific and commercial value. However, there has been no comprehensive systematic research on the species diversity and resource assessment of the Macrosporum clade. Therefore, this study conducts extensive sampling, combining global species information of the Macrosporum clade, using ITS-rDNA data, as well as morphological and ecological characteristics, to conduct a comprehensive study. The aim of this paper is to clarify the species diversity, phylogenetic relationships, host characteristics, and geographic distribution of this important truffle group in the world and specifically, to provide important scientific evidence for the utilization and conservation of the Macrosporum group in China.

2. Materials and Methods

2.1. Morphological Study

The specimens were collected from Yunnan Province in China over the past decade and were deposited at the Herbarium of Cryptogams at the Kunming Institute of Botany, the Chinese Academy of Sciences (HKAS), and Yunnan Agricultural University (YNAU).
The morphological characteristics of the collected specimens were observed and described following the methods of Wan et al. [10] using a light microscope, an electron microscope, and a scanning electron microscope. Hand-cut sections were mounted in 5% (w/v) KOH and examined under a light microscope (Leica DM2500, Leica Microsystems, Wetzlar, Germany). The observations included both the macroscopic (size, colour, surface texture, and presence of warts on the ascocarps) and microscopic features (peridium type and characteristics of the gleba, asci, and spores). The size of ascospores was measured separately based on the number of spores in each ascus, with the length and width measured for 150 ascospores (excluding ornamentation height). In species descriptions, ascospore size is expressed as (a)b–c(d), where 90% of the measurements fall between b and c, and a and d represent the minimum and maximum values, respectively. The length-to-width ratio is represented by Q, and Qm refers to the average Q of all ascospores ± standard deviation [10]. For scanning electron microscopy (SEM), spores were scraped from the dried gleba onto double-sided tape, and this was mounted directly on an SEM stub, coated with gold-palladium, and examined and photographed using a JSM-5600LV SEM (JEOL, Tokyo, Japan).

2.2. Molecular Methods

DNA was extracted from pieces of dried ascoma using a modified CTAB procedure, followed by polymerase chain reaction (PCR) amplification and sequencing of the primer pairs ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) [6,10]. PCR reactions were run as follows: 94 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 1 min. The final reaction was followed by an extension at 72 °C for 10 min. The PCR products were sent to Tsingke Biotech Corporation (Beijing, China) for purifying and sequencing.

2.3. Phylogenetic Analysis

The ITS sequence from the studied specimen was compiled, together with sequences from references taxa curated in GenBank (http://www.ncbi.nlm.nih.gov/) (accessed on 12 December 2024). A total of 57 taxa were analysed (Table 1). An ITS dataset was used to clarify the phylogenetic position of the new species in this genus. Two sequences derived from T. indicum were selected and used as the outgroup (Figure 1).
The combined sequences were aligned using MAFFT software (version 7) online, and after constructing the matrix, Gblocks 0.91b was used to exclude ambiguous sequence regions, followed by manual adjustment in Bioedit to ensure accurate alignment [29]. Modetest V2 was used to select the best-fit substitution model for the matrix based on the Akaike information criterion (AIC) [30]. The phylogenetic tree was then constructed using Raxml B 7.2.8 with the maximum likelihood (ML) method [31] to obtain support values, and Bayesian inference (BI) was performed using MrBayes 3.1 parallel version [32] to obtain posterior probabilities.

3. Results

The final ITS alignment included 57 sequences, which contained 626 aligned sites. The Bayesian analysis yielded a similar tree to that from the parsimony analysis; thus, only the tree inferred from the ML analysis is shown in Figure 1. All analysed Macrosporum species formed a monophyletic group, with 100% BS and 1.0 PP, based on the ITS sequences. And all samples formed two distinct branches, subclade 1 (Paradox subclade) and subclade 2 (traditional Macrosporum clade).
As for the 19 collected specimens in this study, one was identified as T. sinomacrosporum, the other eleven were identified as T. calosporum, and the rest were identified as T. glabrum.

3.1. Morphological Characteristics Observation and Analysis

3.1.1. Tuber sinomacrosporum S. P. Wan, and F. Q. Yu, sp. nov. Phytotaxa, (4), 2023

Ascocarps ellipsoid or irregularly ellipsoid, 1.35–2.2 cm in diam. Fresh ascocarps yellow to brown; reddish-brown when dried; solid. Peridium 108–148 μm thick, one layer, prosenchymatous, with irregular yellow cells and interwoven yellow hyphae; cells (1.0–)2.2–5.7(–7.8) × (1.0–)1.7–4.5(–5.4) μm; and hyphae 1.3–2.8 μm in diam. Gleba white or greyish mycelium when young, becoming brown to dark brown with maturity, formed by transparent, intertwined thin-walled hyphae, 0.7–2.4 μm in diam; cells are spherical or nearly spherical, measuring 1.1–7.3(–10.5) × 0.9–5.7(–8.6) μm. Asci ellipsoid, translucent, 114.0–143.0(–158.0) × 86.0–117.0(–124.0) μm, containing one spore and rarely, two spores, either sessile or with short or long stalks measuring 7.5–49.0 μm. Ascospores ellipsoid, long ellipsoid, or broad ellipsoid, transparent when immature, becoming reddish-brown or brown at maturity. Excluding ornamentation, 1-spored (80.0–)89.0–105.0(–109.0) × (55.0–)61.0–76.0(–78.0) μm, Q = 1.32–1.53, Qm = 1.43 ± 0.08 (n = 120); 2-spored (51.0–)55.0–78.0(–84.0) × (32.0–)37.0–55.0(–57.0) μm, Q = 1.25–1.65, Qm = 1.4 ± 0.16 (n = 30). Ornamented with alveolate reticulum, 2–6 μm high, composed of irregular polygonal meshes with 3–7 meshes longitudinally and 3–7 meshes transversely.
Distribution and Habitat: China, Yunnan Province; found in soil under pine forests.
Voucher Specimen: China, Dali City, Yunnan Province, 26 December 2020, wsp1048 (YNAU016, Holotype).
Notes: This species is morphologically similar to T. gigantosporum, sharing characteristics such as asci containing 1(2) spores and large, ellipsoid spores [33]. However, T. gigantosporum can be distinguished by its larger spores, which reach up to 120 × 80 μm in size.

3.1.2. Tuber calosporum S.P. Wan, Mycoscience, 57: 393–399, 2016

Ascomata (Figure 1A) globose, subglobose, or ovoid, 1.4–2.3 cm; surface (Figure 1B) yellow-white when immature, yellow-brown to brown when mature, with yellow grooves and warty or scaly protrusions; brown when dried. Gleba (Figure 1A) light yellow when immature, purple-brown to brown when mature, composed of transparent interwoven hyphae, 2–6 μm in dim; clearly visible spores. Peridium (Figure 1C) 123–164 μm thick, one layer, prosenchymatous, composed of subglobose cells and interwoven hyphae; cells (5.6–)6–34 × 2.2–13(–14) μm; hyphae 1.2–5.5 μm in diam. Asci (Figure 1D) elliptical or irregularly spherical, 102–149(–151) × 82–84(–147) μm, translucent, mostly containing one spore, occasionally 2–3 spores. Ascospores (Figure 1D) elliptical, transparent or pale yellow when immature, reddish-brown when mature, without ornamentation; 1-spored 77–101(–102) × 57–72(–74) μm, 2-spored 60–74(–76) × 45–54(–56) μm, 3-spored (57–)59–61(–62) × (37–)39–46 μm, with a length-to-width ratio Q = 1.34–1.54, Qm = 1.38 ± 0.04. Ornamented with alveolate reticulum, less than 2 μm high, composed of irregular pentagonal or hexagonal meshes, with 4–9 meshes present.
Distribution and Habitat: China, Yunnan Province. Found in mixed forests dominated by Pinus yunnanensis or P. armandii in humus-rich soil.
Voucher Specimen: China, Huize County, Yunnan Province, October 2014, wsp143 (HKAS88790, Holotype), wsp145 (HKAS88751), wsp186 (HKAS88791), wsp382 (HKAS88794), wsp163 (HKAS95370); Kunming City, Yunnan Province, September 17, 2015, wsp615 (HKAS95788), wsp635 (HKAS95789), wsp636 (HKAS95790), wsp637 (HKAS95791), wsp649 (HKAS95792), wsp651 (HKAS95793).
Notes: This species is distinguished from others by its relatively smooth surface of the fruiting body and the flaky warty protrusions in the grooves.

3.1.3. Tuber glabrum L. Fan and S. Feng, Mycological Progress, 13(2): 241–246, 2014

Ascomata (Figure 2A,B) spherical to sub-spherical, 0.8–5 cm in diameter. Immature ascomata yellow-white to pale brown, mature specimens light brown to brown, sometimes with brown spots or a yellow-green hue, smooth surface or shallow yellow warts, often covered in golden-yellow or brown fluff. Gleba white when young, turning light brown to black at maturity; distinct marbled mycelial strands, wide or narrow. Peridium (Figure 2C) brown-yellow to brown, 140–260 μm thick, one layer, prosenchymatous, loose tissue, near-spherical cells interwoven with hyphae; hyphal diameter 1.3–2.6 μm. Asci (Figure 2D,E) elliptical or nearly spherical, 121.9–159.9 × 105.7–152.2 μm, transparent, typically containing one spore, rarely two, no stalk. Ascospores (Figure 2F) elliptical, occasionally nearly spherical, colourless or pale yellow when immature, turning red-brown or brown when mature, without ornamentation; 1-spored 79.2–109 × 62.5–75.5 μm, Q = 1.04–1.62, Qm = 1.43 ± 0.12 (n = 60); 2-spored 85–112.3 × 49.4–61.8 μm, Q = 1.5–2.07, Qm = 1.74 ± 0.18 (n = 12). Ornamented with alveolate reticulum, less than 2 μm high, irregularly arranged shallow honeycomb-like meshes, 6–9 vertical meshes and 4–11 horizontal meshes.
Distribution and Habitat: China, Yunnan Province. Found in the soil under mixed forests predominantly composed of P. yunnanensis or in humus-rich soil under P. armandii.
Voucher Specimen: China, Honghe Prefecture, Yunnan Province, September 6, 2016, wsp779-1 (HKAS96137), wsp779-2 (HKAS96138), wsp780 (HKAS96139), wsp781 (HKAS96140); Baoshan City, Yunnan Province, December 5, 2022, wsp2433 (YNAU1631); Kunming City, Yunnan Province, December 12, 2022, wsp2474 (YNAU1673), wsp2475 (YNAU1674).
Notes: Based on the extensive study and description in this paper, a range of morphological characteristics of T. glabrum have been supplemented. We discovered that this species possesses strong aromatic qualities and is characterized by a distinct surface covered in golden yellow or brown woolly hyphae. These features are also present in other species within the Macrosporum clade, including the Japanese species T. tomentosum and T. iryudaense, the Chinese T. sinomacrosporum, and the North American T. canaliculatum. Furthermore, this study confirmed that T. glabrum exhibits nearly spherical spores, in addition to the elliptical spores that were originally described.
Furthermore, based on observations of the microscopic and macroscopic characteristics of specimens of T. glabrum and its phylogenetically related T. sinomacrosporum and T. calosporum, along with previous studies [10,14,15], we found that T. sinomacrosporum has larger ascospores compared to those of T. calosporum and T. glabrum. The asci of T. sinomacrosporum and T. glabrum typically contain up to two spores, while T. calosporum usually has one to three spores per ascus. All three species possess spores with alveolate ornamentation, but they differ in depth. Tuber glabrum and T. calosporum feature shallower ornamentation, measuring less than 2 μm, whereas T. sinomacrosporum can reach depths of up to 6 μm. Additionally, there are significant differences in spore size among the three species.

3.2. Phylogenetic Analysis Results

Phylogenetic analysis based on samples and mycorrhizal sequences shows that species within the Macrosporum clade cluster together as a monophyletic group, with high support (PP 100, BS 1.0) (Figure 1). Furthermore, the Macrosporum clade is divided into two subclades: subclade 1 (Paradoxa subclade) contains the Chinese species T. glabrum, T. sinomacrosporum, T. calosporum, T. sinomonosporum, and the Japanese T. iryudaense; subclade 2 (the traditional Macrosporum subclade) comprises three species: the European T. macrosporum, the North American T. canaliculatum, and the Japanese T. tomentosum. In the phylogenetic tree, the Asian species are distributed across both subclades, with the Chinese species concentrated in subclade 1. The European and American species belong to subclade 2, and the mycorrhizal sequences correspond to T. canaliculatum from North America and T. macrosporum from Europe within subclade 2.

4. Discussion

The Macrosporum clade is still poorly understood across the world, although its study can be traced back to 1831 [11]. In this study, more specimens and mycorrhizal sequences are used to clarify the species diversity, as well as the ecological and geographical distribution characteristics of the Macrosporum clade of genus Tuber. The phylogenetic result shows that the Macrosporum clade comprises a total of eight species divided into two distinct subclades (Figure 3); all four Chinese species are clustered in subclade 1 (Paradoxa subclade); species from Europe and America belong to subclade 2 (Macrosporum clade); two Japanese species belong to two subclades, respectively. The samples collected in this study all belong to the Macrosporum clade and include T. glabrum, T. sinomacrosporum, and T. calosporum; the mycorrhizal sequences are identified as T. canaliculatum and T. macrosporum. Notably, some sequences were mistakenly uploaded to GenBank as European T. macrosporum, but analysis in this study has shown that they actually belong to other species. For example, JQ288921 corresponds to T. malenconii from the Aestivum group of Tuber in France, clarifying and confirming the molecular systematic position of these sequences.
In terms of morphology, compared to other species within the genus Tuber, species of the Macrosporum clade exhibit brown ascomata surfaces, fewer ascospores per ascus 1–3(5), larger ascospores (>60 μm), and shallower ornamentation (mostly < 2 μm) [9,10,14]. Phylogenetically, Paradoxa subclade 1 contains five species: T. glabrum, T. sinomacrosporum, T. calosporum, T. sinomonosporum, and T. iryudaense, with each species forming independent phylogenetic branches.
Here, additional specimens of T. glabrum were observed to further describe and add to the morphological characteristics of the species. We found that this species has a strong and pleasant odour, and that the surface of the fruiting body is covered with fuzzy, golden hyphae. As some other species of the Macrosporum clade, such as T. tomentosum [9], display similar fuzzy structures, this significant feature can be used as a morphological criterion to identify species of the Macrosporum clade.
Although T. sinomacrosporum and T. calosporum are relatively closely related genetically in the subclade 1 (Figure 3), T. sinomacrosporum differs from the latter in having reddish-brown ascomata, fewer and larger spores, and lower spore ornamentation [10]. Chinese T. sinomonosporum and the Japanese T. iryudaense are also relatively closely related [6,9]. However, T. iryudaense differs from other species in that it has only one relatively broad ascospore per ascus (68–97 × 51–80 µm) [9]. Notably, the critically endangered T. gigantosporum, despite the lack of molecular sequences, can be clearly distinguished from other species by its characteristic 1(2) spore number and large, elliptical spore shape ((80–)105–115(–120) × (55–)70–75(–80) μm) in the original description [33], allowing it to be placed in the Paradoxa subclade 1.
The traditional subclade Macrosporum contains three species (Figure 3). These include the Japanese T. tomentosum and the North American T. canaliculatum, both with spherical to nearly spherical spores [9,12,34]. However, the spores of T. tomentosum are smaller (27–64 × 26–55 μm) than those of T. canaliculatum (48–72 × 40–52(–64) μm. The European T. macrosporum has elliptical ascospores (Q = 1.6–1.7) [3,35], which were well distinguished from those of the other two species.
Ecologically, the species of the Macrosporum clade are distributed throughout Europe, North America, and Asia [3,9,10,11,12]. Among them, T. calosporum, T. glabrum, T. sinomonosporum, and T. sinomacrosporum are found only in Southwest China, mainly associated with pine hosts, such as P. yunnanensis and P. armandii [10,15]. Tuber iryudaense and T. tomentosum are found in Japan, with a variety of hosts [9], including Quercus spp., Abies spp., Carpinus spp., Castanopsis spp., and Pinus spp. Tuber iryudaense ripens from July to August, whereas T. tomentosum has a longer harvesting period, generally from April to December, and is often collected from forest margins. Tuber macrosporum is widespread in Europe, commonly found in Serbia, Hungary, and Romania, less commonly in Italy, and rarely in France and the UK, but it is also reported in Switzerland, Germany, Ukraine, Croatia, and Slovenia. Recently, it has also been reported from Slovakia, Poland, and Turkey [3]. It usually grows on calcareous or slightly alkaline loams, with Quercus spp., Corylus spp., Carpinus spp., Salix spp., Tilia spp., Fagus spp., and Populus spp. as dominant hosts [36,37,38,39]. The North American T. canaliculatum is mainly found in eastern North America, ranging from the Central United States northwards to Canada [3], with host plants mainly comprising the pine and beech families [40].

5. Conclusions

To date, species in the Macrosporum clade are distributed throughout North America, Europe, and Asia. Although this clade exhibits less diversity than other clades within the genus Tuber, such as the Puberulum and Rufum clades, it possesses potential scientific and commercial value. Accordingly, this study conducted taxonomic and molecular phylogenetic research on samples from the Macrosporum clade to analyse their species diversity and ecological distribution. Globally, the Macrosporum clade comprises eight species, six of which are found in Asia, indicating a much higher diversity in Asia than previously thought.
Despite conducting nationwide research over the past decade, this group has only been discovered in Yunnan Province. However, this finding significantly enhances our understanding of Tuber species diversity in China and provides crucial foundational data for further studies on the ecological distribution and evolution of truffles.
In particular, the traditionally recognized European and American Macrosporum subclades now include the fuzzy truffle, T. tomentosum, which originates from East Asia. This suggests that the centre of diversity or potential geographic origin of this clade may be linked to East Asia. Although further phylogeographic studies and more samples are needed to confirm this hypothesis, it offers valuable insights for future research. Therefore, it is both necessary and urgent to continue investigating truffle resources. This research also serves as a reference for the species diversity and conservation of Tuber.

6. Species Identification Key for the Macrosporum Clade

1. The ascomata are distinctly cracked, with irregular plate-like warts....................T. macrosporum [3]
1. The ascomata are relatively smooth, without cracks.............................................................................2
2. The ascomata are without hairs................................................................................................................3
2. The ascomata have hairs............................................................................................................................4
3. The ascomata have a smooth surface, with spherical spores............................T. sinomonosporum [6]
3. The ascomata have small flaky warts in the grooves on the surface, with elliptical
spores.............................................................................................................T. calosporum ([15], this article)
4. The ascomata have localized hairs in the grooves on the surface........................................................5
4. The ascomata are densely covered with hairs on the surface...............................................................6
5. The asci contain 1–3 spores, which are relatively small...................................T. canaliculatum [12,34]
5. The asci contain 1–2 spores, which are relatively large...................................T. sinomacrosporum [10]
6. The spores are spherical to nearly spherical................................................................T. tomentosum [9]
6. The spores are elliptical..............................................................................................................................7
7. The asci contain 1–2 spores, with surface ornamentation height < 2 μm........................T. glabrum ([14], this article)
7. The asci contain 1 spore, with surface ornamentation height < 5 μm........................T. iryudaense [9]

Author Contributions

Conceptualization, S.W.; methodology, L.E. and C.Y.; software, R.L. and R.W. (Rui Wang); validation, R.W. (Ruixue Wang) and S.W.; data analysis, R.L. and L.E.; data curation, R.L.; writing—original draft preparation, R.L. and L.E.; writing—review and editing, S.W., F.Y., J.Y. and Y.L.; visualization, X.J. and J.S.; supervision, R.W. (Ruixue Wang); project administration, S.W.; funding acquisition, S.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Young Talents Special Project of the Xing Dian Talent Support Program of Yunnan Province (XDYC-QNRC-2023-0415), the Basic Research Program of Yunnan (202201AT070268), the National Natural Science Foundation of China (No. 32060008), and the Yunnan Technology Innovation Program (202205AD160036).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We thank ZhiJia Gu of the Key Laboratory for Plant Diversity and Biogeography of East Asia, Chinese Academy of Sciences, for performing the scanning electron microscopy (SEM).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Jeandroz, S.; Murat, C.; Wang, Y.J.; Bonfante, P.; Tacon, F. Molecular phylogeny and historical biogeography of the genus Tuber, the ‘true truffles’. J. Biogeogr. 2008, 35, 815–829. [Google Scholar] [CrossRef]
  2. Guerin-Laguette, A. Successes and challenges in the sustainable cultivation of edible mycorrhizal fungi—Furthering the dream. Mycoscience 2021, 62, 10–28. [Google Scholar] [CrossRef] [PubMed]
  3. Zambonelli, A.; Iotti, M.; Murat, C. True Truffle (Tuber spp.) in the World; Soil Biology Series 47; Springer: Cham, Switzerland, 2016; pp. 3–18. [Google Scholar]
  4. Li, Y.; Guo, S.X.; Chen, J. Research progress on chemical constituents and pharmacological effects of Tuber (Pezizales, Ascomycota). Mycosystema 2021, 40, 873–894. [Google Scholar]
  5. Bonito, G.; Smith, M.E.; Nowak, M.; Healy, R.A.; Guevara, G.; Cazares, E.; Kinoshita, A.; Nouhra, E.R.; Dominguez, L.S.; Tedersoo, L.; et al. Historical biogeography and diversification of truffles in the Tuberaceae and their newly identified southern hemisphere sister lineage. PLoS ONE 2013, 8, E52765. [Google Scholar] [CrossRef] [PubMed]
  6. Fan, L.; Li, T.; Xu, Y.Y.; Yan, X.Y. Species diversity, phylogeny, endemism and geography of the truffle genus Tuber in China based on morphological and molecular data. Persoonia 2022, 48, 175–202. [Google Scholar] [CrossRef]
  7. Montecchi, A.; Sarasini, M. Funghi ipogei d’Europa; Associazione Micologica Bresadola Fondazione centro studi micologici: Trento, Italy, 2000; p. 714. [Google Scholar]
  8. Castellano, M.A.; Trappe, J.M.; Luoma, D.L. Sequestrate fungi. In Biodiversity of Fungi; Mueller, G.M., Bills, G.F., Foster, M.S., Eds.; Inventory and Monitoring Methods; Elsevier: Amsterdam, The Netherlands, 2004; pp. 197–213. [Google Scholar]
  9. Kinoshita, A.; Sasaki, H.; Orihara, T.; Nakajima, M.; Nara, K. Tuber iryudaense and T. tomentosum: Two new truffles encased in tomentose mycelium from Japan. Mycologia 2021, 113, 653–663. [Google Scholar] [CrossRef] [PubMed]
  10. Wan, S.P.; Liu, W.; Cui, M.J.; Wang, R.; Wang, Y.Y.; Liu, M.J.; Wang, R.X.; Yu, C.J.; Yu, F.Q. Morphological and molecular evidence support a new truffle, Tuber sinomacrosporum, in Macrosporum group. Phytotaxa 2023, 591, 283–291. [Google Scholar] [CrossRef]
  11. Vittadini, C. Monographia Tuberacearum; Ex Typographia Felicis Rusconi: Milano, Italy, 1831; p. 35. [Google Scholar]
  12. Gilkey, H.M. Two new truffles. Mycologia 1920, 12, 99–101. [Google Scholar] [CrossRef]
  13. Kinoshita, A.; Sasaki, H.; Nara, K. Phylogeny and diversity of Japanese truffles (Tuber spp.) inferred from sequences of four nuclear loci. Mycologia 2011, 103, 779–794. [Google Scholar] [CrossRef]
  14. Fan, L.; Feng, S.; Cao, J.Z. The phylogenetic position of Tuber glabrum sp. nov. and T. sinomonosporum nom. nov. two Paradoxa-like truffle species from China. Mycol. Prog. 2014, 13, 241–246. [Google Scholar] [CrossRef]
  15. Wan, S.P.; Wang, X.H.; Zheng, Y.; Yu, F.Q. Tuber shidianense and T. calosporum, two new truffle species from southwest China. Mycoscience 2016, 57, 393–399. [Google Scholar] [CrossRef]
  16. Fortier, D.; Seguin, J.C.; Voyer, N. Characterization of the Volatilome of Tuber canaliculatum Harvested in Quebec, Canada. ACS Omega 2022, 7, 29038–29045. [Google Scholar] [CrossRef]
  17. Vezzola, V. La coltivazione di Tuber macrosporum. In Atti del 3 congresso internazionale di Spoleto sul tartufo; Donnini, D., Ed.; Comunita Montana dei Monti Martani, Serano e Subasio: Valtopina, Italy, 2010; pp. 694–697. [Google Scholar]
  18. Milenković, M.; Marjanović, Z. Current Results on Tuber spp. Research in Yugoslavia; Federation Francaise des Trufficulteurs: Uzès, France, 2001; pp. 218–225. [Google Scholar]
  19. Csorbainé, A.G.; Bratek, Z.; Illyés, Z.; Dimény, J. Studies on Tuber macrosporum Vittad. Natural Truffle Habitats in the Carpatho-Pannon Region; Comunità Montana dei Monti Martani, Serano e Subasio: Valtopina, Italy, 2011; pp. 182–188. [Google Scholar]
  20. Benucci, G.M.; Gógán, C.A.; Baciarelli, F.L.; Bencivenga, M.; Di, M.G.; Donnini, D. Mycorrhization of Quercus robur L., Quercus cerris L. and Corylus avellana L. seedlings with Tuber macrosporum Vittad. Mycorrhiza 2012, 22, 639–646. [Google Scholar] [CrossRef]
  21. Benucci, G.M.; Raggi, L.; Albertini, E.; Csorbai, A.G.; Donnini, D. Assessment of ectomycorrhizal biodiversity in Tuber macrosporum productive sites. Mycorrhiza 2014, 24, 281–292. [Google Scholar] [CrossRef]
  22. Berch, S.M. Advances in the Cultivation of Truffles in Canada. In Mushrooms, Humans and Nature in a Changing World; Pérez-Moreno, J., Guerin-Laguette, A., Flores Arzú, R., Yu, F.Q., Eds.; Springer: Cham, Switzerland, 2020; pp. 287–296. [Google Scholar]
  23. Li, L.; Wan, S.; Wang, Y.; Thongklang, N.; Yang, M.; Liu, C.; Luo, Z.; Li, S. Three New Species of Tuber Discovered in Alpine Fir Forests in Yunnan, China. J. Fungi 2024, 10, 453. [Google Scholar] [CrossRef] [PubMed]
  24. Fan, L.; Han, L.; Zhang, P.R.; Yan, X.Y. Molecular analysis of Chinese truffles resembling Tuber californicum in morphology reveals a rich pattern of species diversity with emphasis on four new species. Mycologia 2016, 108, 344–353. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, R.; Dong, G.; Li, Y.; Wang, R.; Yang, S.; Yuan, J.; Xie, X.; Shi, X.; Yu, J.; Pérez-Moreno, J.; et al. Three New Truffle Species (Tuber, Tuberaceae, Pezizales, and Ascomycota) from Yunnan, China, and Multigen Phylogenetic Arrangement within the Melanosporum Group. J. Fungi 2024, 10, 640. [Google Scholar] [CrossRef] [PubMed]
  26. Wan, S.P.; Tang, L.; Zheng, Y.; Yu, F.Q. Two novel Tuber species (Tuberaceae, Pezizales) in the Latisporum Group from China. Mycoscience 2017, 58, 312–319. [Google Scholar] [CrossRef]
  27. Wan, S.P.; Xu, W.J.; Tan, N.; Wang, Y.; Zheng, Y.; Yu, F.Q. Three Excavatum species Tuber badium, T. depressum and T. verrucosivolvum from Sichuan Province, China. Phytotaxa 2017, 296, 228–238. [Google Scholar] [CrossRef]
  28. Li, Y.; Fan, L.; Wang, K.; Song, M.S.; Wang, X.C.; Zhuang, W.Y.; Yao, Y.J. Status and Protection of Threatened Truffle (Tuberaceae) Resources in China. Acta Edulis Fungi 2020, 27, 109–119. [Google Scholar]
  29. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  30. Nylander, J.A.A. MrModeltest 2.3. Program Distributed by the Author. Evolutionary Biology Center; Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
  31. Stamatakis, A. RAxML-VI-HPC: Maximum-likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006, 22, 2688–2690. [Google Scholar] [CrossRef]
  32. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, Y.; Li, Z.P. A new species of Tuber from China. Acta Mycol. Sin. 1991, 10, 263–265. [Google Scholar]
  34. Gilkey, H.M. Tuberales of North America. Oregon State Monographs. Stud. Bot. 1939, 1, 1–63. [Google Scholar]
  35. Riousset, G.; Riousset, L.; Chevalier, G.; Bardet, M.C. Truffle d’ Europe et de Chine; Institut National de la Recherche Agronomique: Paris, France, 2001; p. 181. [Google Scholar]
  36. Cacialli, G. Le specie europee del genere Tuber. Una revisione storica. Mycologist 2005, 19, 134–135. [Google Scholar] [CrossRef]
  37. Miko, M.; Jan, G.; Bratek, Z. Tuber macrosporum Vitt. and Tuber mesentericum Vitt. one hundred years neglected hypogeous fungi species in Slovak Republic. Acta Fytotechn Zootech 2006, 4, 85–90. [Google Scholar]
  38. Marjanović, Ž.; Grebenc, T.; Marković, M.; Glišić, A.; Milenković, M. Ecological specificity and molecular diversity of truffles (genus Tuber) originating from mid-west of the Balkan Peninsula. Sydowia 2010, 62, 67–87. [Google Scholar]
  39. Gógán, C.A. Studies on Cultivation Possibilities of Summer Truffle (Tuber aestivum Vittad.) and Smooth Black Truffle (Tuber macrosporum Vittad.) in Hungary. Ph.D. Thesis, SzentIstván University, Gödöllő, Budapest, 2011. [Google Scholar]
  40. Lefevre, C. Native and Cultivated Truffles of North America. In Edible Ectomycorrhizal Mushrooms; Zambonelli, A., Bonito, G.M., Eds.; Springer: Cham, Switzerland, 2012; pp. 220–221. [Google Scholar]
Diversity 17 00092 g001
Figure 1. Tuber calosporum (HKAS95791): (A) an ascoma and gleba; (B) surface of dried ascoma; (C) a peridium section; (D) asci and ascospores.
Figure 1. Tuber calosporum (HKAS95791): (A) an ascoma and gleba; (B) surface of dried ascoma; (C) a peridium section; (D) asci and ascospores.
Diversity 17 00092 g001
Diversity 17 00092 g002
Figure 2. Tuber glabrum (YNAU1674): (A) an ascoma and gleba; (B) surface of dried ascoma; (C) a peridium section; (D,E) LM photos of asci and ascospores; (F) an SEM photo of ascospore.
Figure 2. Tuber glabrum (YNAU1674): (A) an ascoma and gleba; (B) surface of dried ascoma; (C) a peridium section; (D,E) LM photos of asci and ascospores; (F) an SEM photo of ascospore.
Diversity 17 00092 g002
Diversity 17 00092 g003
Figure 3. RAxML tree of the Macrosporum clade inferred from the ITS sequences. Bootstrap (BS), values derived from maximum likelihood (ML) analysis (≥70%), and posterior probabilities (PPs), from Bayesian inference (≥0.90), are shown above or beneath the branches at the nodes.
Figure 3. RAxML tree of the Macrosporum clade inferred from the ITS sequences. Bootstrap (BS), values derived from maximum likelihood (ML) analysis (≥70%), and posterior probabilities (PPs), from Bayesian inference (≥0.90), are shown above or beneath the branches at the nodes.
Diversity 17 00092 g003
Table 1. Sequences of Tuber spp. used in the phylogenetic analysis.
Table 1. Sequences of Tuber spp. used in the phylogenetic analysis.
SpeciesVoucher/IsolateOriginTissueITS GenBankHost
T. canaliculatumJT12670CanadaascocarpGQ221455Quercus sp.
Pinus sp.
T. canaliculatumTbc1CanadaascocarpOM948973-
T. canaliculatum1662_PREMIXUSAectomycorrhizaOQ612551Quercus rubra
T. canaliculatumAMC495USAectomycorrhizaOQ207646Betula lenta
T. canaliculatumAMC101USAectomycorrhizaOP413007Quercus alba
T. canaliculatumFLAS-F-68694USAascocarpOM416870-
T. canaliculatumOSC59072USAascocarpHM485347-
T. macrosporumITA_011sItalyascocarpKP738396-
T. macrosporumITA_010SItalyascocarpKP738394-
T. macrosporumHUN_21HungaryascocarpKP738377-
T. macrosporumHUN_20HungaryascocarpKP738376-
T. macrosporumFRA_004FranceascocarpKP738363-
T. macrosporumFRA_003FranceascocarpKP738362-
T. macrosporumSLO_001SlovakiaascocarpKP738360-
T. macrosporumHMSFI_TUBMAC/141207ASloveniaascocarpFM205634-
T. macrosporumSER_002SerbiaascocarpKP738358-
zT. macrosporumSER_001SerbiaascocarpKP738357-
T. macrosporumCMI-Unibo_4938IranascocarpMW884554-
T. macrosporumCMI-Unibo_4937IranascocarpMW884553-
T. macrosporumANK_Akata_7398TurkeyascocarpMW362409-
T. macrosporumANK_Akata_7390TurkeyascocarpMW362408-
T. macrosporumUASWS1867SwitzerlandascocarpKY197983-
T. macrosporumNW1TMacro2PolandascocarpKJ524532-
T. macrosporumNW1TMacro1PolandascocarpKJ524529-
T. macrosporumS7510_7610GermanyascocarpJF926121-
T. macrosporumITA_012SItalyascocarpKP738346-
T. macrosporumUE_ITA032ItalyectomycorrhizaJX474822-
T. macrosporumUE_ITA005ItalyectomycorrhizaJX474809-
T. macrosporumUE_ITA026ItalyectomycorrhizaJX474821-
T. macrosporumUE_ITA240ItalyectomycorrhizaJX474839-
T. tomentosumK108 (holotype)JapanascocarpAB553349Quercus acutissima
Quercus crispula
Quercus serrata
T. tomentosumAK1907JapanascocarpLC570852Quercus serrata
T. tomentosumAK1909JapanascocarpLC570851Quercus sp.
T. tomentosumK22JapanascocarpAB553345Quercus myrsinifolia
T. tomentosumK440JapanascocarpAB553365Quercus serrata
Quercus crispula
T. tomentosumK446JapanascocarpAB553367Quercus serrata
T. tomentosumK215JapanascocarpAB553356Quercus acutissima
T. tomentosumK85JapanascocarpAB553347Abies firma
Carpinus tschonoskii
Quercus serrata
T. tomentosumK103JapanascocarpAB553348Pinus densiflora
T. tomentosumK407JapanascocarpAB553358Castanopsis sieboldii
Quercus glauca
T. tomentosumK411JapanascocarpAB553360Pinus thunbergii
T. glabrumBJTCFAN228 (holotype)China: YunnanascocarpKF002731Pinus yunnanensis
T. glabrumBJTCFAN232China: YunnanascocarpKF002727Pinus yunnanensis
T. glabrumYNAU1674China: YunnanascocarpPQ181852Pinus armandii
T. glabrumHKAS96140China: YunnanascocarpPQ181853Pinus armandii
T. calosporumHKAS:88790 (holotype)China: YunnanascocarpKT444598Pinus yunnanensis
T. calosporumHKAS95788China: YunnanascocarpPQ168923-
T. calosporumHKAS:88791China: YunnanascocarpKT444597Pinus yunnanensis
T. calosporumHKAS:88751China: YunnanascocarpKT444600Pinus yunnanensis
T. sinomonosporumBJTCFAN150 (holotype)China: YunnanascocarpKF002729-
T. sinomacrosporumYNAU016 (holotype)China: YunnanascocarpOK625303Pinus sp.
T. iryudaenseHS1309JapanascocarpLC570849Quercus serrata
T. iryudaenseHS1223 (holotype)JapanascocarpLC570848Quercus serrata
Quercus salicina
Castanopsis sieboldii
T. iryudaenseKPM-NC25676JapanascocarpLC570847Quercus serrata
T. iryudaenseK201JapanascocarpAB553344Quercus serrata
T. indicumHKAS49752ChinaascocarpGU979079-
T. indicumHKAS47614ChinaascocarpGU979077-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, R.; E, L.; Wang, R.; Yu, C.; Yang, J.; Li, Y.; Jiang, X.; Song, J.; Yu, F.; Wang, R.; et al. Deeper Insights into Species Diversity and Ecological Characterisation of the Macrosporum Group of the Genus Tuber. Diversity 2025, 17, 92. https://doi.org/10.3390/d17020092

AMA Style

Liu R, E L, Wang R, Yu C, Yang J, Li Y, Jiang X, Song J, Yu F, Wang R, et al. Deeper Insights into Species Diversity and Ecological Characterisation of the Macrosporum Group of the Genus Tuber. Diversity. 2025; 17(2):92. https://doi.org/10.3390/d17020092

Chicago/Turabian Style

Liu, Ruilong, Lingfang E, Rui Wang, Chengjin Yu, Jingsheng Yang, Yuenan Li, Xuesong Jiang, Junyue Song, Fuqiang Yu, Ruixue Wang, and et al. 2025. "Deeper Insights into Species Diversity and Ecological Characterisation of the Macrosporum Group of the Genus Tuber" Diversity 17, no. 2: 92. https://doi.org/10.3390/d17020092

APA Style

Liu, R., E, L., Wang, R., Yu, C., Yang, J., Li, Y., Jiang, X., Song, J., Yu, F., Wang, R., & Wan, S. (2025). Deeper Insights into Species Diversity and Ecological Characterisation of the Macrosporum Group of the Genus Tuber. Diversity, 17(2), 92. https://doi.org/10.3390/d17020092

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop