First Records of Feather Mites and Haemosporidian Parasites in the Isabelline Wheatear (Oenanthe isabellina) from the Westernmost Part of the Species Breeding Range

Abstract

Host range expansions are an important factor for shaping the community of associated symbiotic organisms. Birds, as a highly mobile group of animals, are of particular interest to study with respect to the diversity and the distribution of the organisms using them as hosts during such large-scale movements. The Isabelline wheatear (Oenanthe isabellina) is a species with a main breeding area in Asia, which has expanded west, towards the Balkans, since the middle of the last century. We collected feather mites and blood samples for haemosporidian parasites screening from adult and juvenile Isabelline wheatears from the westernmost edge of the species breeding area in western Bulgaria. The feather mite species Alaudicola rosickyi (Černy, 1963), previously found on other wheatear species, was found for the first time on Isabelline wheatears. One species of avian malaria parasites—Plasmodium relictum (Grassi and Feletti, 1891) (lineage SGS1)—represented the first record of a malaria parasite in this host species in Europe. Increasing the sampling in the South European populations of the species will shed light on blood parasite species diversity and will reveal if other feather mite species have followed their host during its breeding range expansion.

1. Introduction

In nature, symbionts are the most diverse and abundant group of organisms, which comprise a major part of the food webs [1,2,3]. Birds are hosts of a variety of symbiont organisms with which they may have parasitic, commensal, and mutualistic relationships. One group of parasites, avian haemosporidians (Apicomplexa, Haemosporida), unicellular parasites transmitted by dipteran vectors, which include parasites from the genus Plasmodium (known as causative agents of malaria), have gained a lot of interest in recent years [4,5,6]. Feather mites (Acariformes, Astigmata, Analgoidea and Pterolichoidea) are another group of commensal or parasitic organisms associated with birds [7,8]. Despite the long history of research on these two groups of organisms, a lot of avian hosts are insufficiently studied.

The Isabelline wheatear (Oenanthe isabellina) is a migratory bird species that breeds in Asia and some parts of Eastern Europe, and winters in a wide area spreading from West Africa to South Asia [9,10] (Figure 1). From the main breeding areas in the Central parts of Asia, this species has spread westwards and currently, small populations of Isabelline wheatears can be found at the westernmost edge of the species range in Western Bulgaria, even though it is more abundant in south-eastern parts of the country [11]. Isabelline wheatears prefer open habitats and commonly nest in abandoned rodent or lagomorph burrows [9,10,12]. In Bulgaria, the species presence is associated primarily with colonies of European souslik (Spermophilus citellus) [11]. This close association with burrowing rodents and lagomorphs was in the foundation of a number of parasitological studies on the transmission of pathogens, such as plague, between mammals and birds, including studies on the diversity of the possible vectors like fleas and ticks [13,14,15]. However, data on feather mites and haemosporidian parasites on the Isabelline wheatear are scarce. So far, the species was reported as a host of feather mites from Eastern Europe and Asia [16,17,18]. In the Lower Don area, Mironov et al. [8] studied eleven Isabelline wheatears in total, but feather mites were not found.

To our knowledge, only three studies have examined Isabelline wheatears for haemosporidian parasites. Paperna et al. [20] found a low prevalence of Leucocytozoon and Haemoproteus in migrating Isabelline wheatears passing through Israel in spring. Birds with avian malaria parasites (genus Plasmodium) were not recorded. Ciloglu et al. [21] did not find haemosporidian parasites in five examined birds, and Hussein et al. [22] found Plasmodium sp. in one of the three examined Isabelline wheatears in Iraq.

This study is the first to examine this species for feather mites and haemosporidian parasites in Bulgaria, and aims to increase the knowledge about the diversity and distribution of these two groups of organisms.

2. Materials and Methods

Isabelline wheatears were observed during a study of a European souslik colony in May 2022, in the northwest of Kremikovtsi District, Sofia Valley, Bulgaria (42°47.526′ N, 23°29.513′ E; 690 m a.s.l.). As a pilot study on their parasites, three adult and four juvenile birds were captured using mist nets and were ringed under permit No. 934/19.04.2022 issued by the Bulgarian Ministry of the Environment and Waters (MOEW). The wheatears were ringed, and standard measurements were taken. All birds were examined for feather mites, and blood samples for morphological and molecular identification of haemosporidian parasites were collected.

2.1. Feather Mites’ Collection and Identification

All feather mites observed were removed, stored in 70% ethanol, and were mounted on microscope slides in Euparal mounting medium. Feather mite species identification was performed according to Černy [23] and Mironov [24]. The pictures of collected mites were taken using a combination of a Canon EOS 2000D digital camera, PRO-CA Camera Adapter, and a microscope Olympus SZ61. The collected mite specimens are deposited in the Zoological Collection of Sofia University, Faculty of Biology, Department of Zoology and Anthropology (BFUS).

2.2. Collection of Blood Samples and Preparation of Blood Smears

Blood samples were collected from each bird after puncture of the brachial vein with a sterile syringe needle (size 27G × 3/4). A heparinized capillary was used to collect approximately 30–50 μL of the blood drops at the place of puncture. Several blood drops were immediately used to prepare three thin blood smears on ready-to-use clean glass slides. Blood smears were air dried by a battery-operated fan right after smearing and fixated in 100% methanol for 5 min. Fixated blood smears were air dried and stained in 10% Giemsa solution prepared with phosphate-buffered dH₂O (pH 7.2) for one hour at room temperature. The rest of the collected blood was placed in a 1.5 mL plastic tube with 0.5 mL of SET buffer (0.015 M NaCl, 0.05 M Tris, 0.001 M EDTA, pH 8.0) for further molecular investigation.

2.3. Microscopic Examination of the Blood Smears

Microscopic examination was carried out on a Zeiss Axio Imager M2 light microscope (Oberkochen, Germany) equipped with a ProgRes c10 plus digital camera and ProgRes CapturePro v2.8.0 imaging software. Blood films were examined for 15–20 min at low magnification (immersion oil 630×), and then at least 100 microscopic fields were screened at high magnification (immersion oil 1000×). Parasitaemia values were calculated in percentage as number of infected erythrocytes per 10,000 erythrocytes. The identification of parasite blood stages and morphological species was conducted according to Valkiūnas [4].

2.4. Molecular Identification of Haemosporidian Parasites

Whole DNA extraction of blood samples stored in SET buffer was performed via the proteinase K and ammonium acetate extraction method. Obtained DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA), and it was subsequently diluted to an approximate concentration of 25–50 ng/μL. A nested PCR protocol was used to amplify a 479 bp fragment of the cyt b gene of the haemosporidian genera Haemoproteus, Plasmodium, and Leucocytozoon, as described by Hellgren et al. [25]. All reactions were carried out using DreamTaq Green PCR Master Mix (2×) (Thermo Fisher Scientific Inc.). Two percent agarose gel stained with GelRed (Biotium Inc., Fremont, CA, USA) was used to visualize the presence or absence of amplified signals. The positive samples were sequenced at Macrogen Ltd. (Amsterdam, The Netherlands) from the 5′ and 3′ ends with the primers HaemF (ATGGTGCTTTCGATATATGCATG) and Haem R2 (GCATTATCTGGATGTGATAATGGT), respectively. Obtained sequences were then edited, assembled and aligned using CodonCode Aligner version 8.0.2 (CodonCode, Dedham, MA, USA), and compared to the available sequences in the MalAvi database [5].

3. Results

3.1. Feather Mites

Feather mites were collected from the wing feathers of the three adult birds; in total, 5 male and 15 female mites were found (Figure 2), while no mites were found on the juvenile birds. All collected mites were morphologically identified as Alaudicola rosickyi (Černy, 1963).

3.2. Haemosporidian Parasites

Three birds were found to be infected with haemosporidian parasites. Mature gametocytes of Plasmodium relictum (cyt b lineage SGS1) were found in one of the adult wheatears with parasitaemia of 0.01% (Figure 3). Characteristic morphological features of P. relictum mature gametocytes, such as oval shape and marked displacement of the erythrocyte nucleus, were observed. Pigment granules are roundish and randomly scattered in the cytoplasm, which is also a typical feature for this parasite (Figure 3). Low parasitaemia and the lack of young stages in the smears preclude a detailed morphological description and presentation of different stages of growth. In two other birds, an adult and a juvenile, we observed single young forms of haemosporidian parasites, which we failed to amplify molecularly perhaps due to low DNA quantity (under 2 ng/µL).

4. Discussion

In our study, we found a species of feather mite, Alaudicola rosickyi, for which the Isabelline wheatear represents a new host species. The feather mite genus Alaudicola Mironov, 1996 includes six species, of which five are associated with larks (Alaudidae), and only A. rosickyi is known from birds of the genus Oenanthe [8]. This feather mite species was first described from the eastern black-eared wheatear (Oenanthe melanoleuca; previously O. hispanica) from Albania [23], and it was recently reported from the pied wheatear (Oenanthe pleschanka) from Russia [8]. Alaudicola rosickyi, together with Proctophyllodes hipposideros Gaud, 1953, were found by Ivan Vasilev on northern wheatears (Oenanthe oenanthe) in Bulgaria in 1964 (unpubl.). In the 1950s, Dubinin [16] reported the Isabelline wheatear and the northern wheatears as hosts of Pterodectes bilobatus (Robin, 1877). At that time, only this species was known and other species currently included in the genus Alaudicola Mironov, 1996 had not yet been established. It is highly probable that Dubinin (1951) actually dealt with Alaudicola rosickyi, but did not recognize that this species from wheatears differs from P. bilobatus (now A. bilobatus) associated with larks. We did not find other species of feather mites, but the Isabelline wheatear was reported as a host of Proctophyllodes leptocaulus Gaud, 1953 and Pterodectes sp. from Kyrgyzstan [17], and Proctophyllodes hipposideros from Ukraine [18]. The last one, P. hipposideros, is the most commonly found species on wheatears; it has been reported so far on the western black-eared wheatear (Oenanthe hispanica) and the red-rumped wheatear (O. moesta) from Morocco [26]; the northern wheatear from Sweden, Bulgaria, and Russia [8,27,28]; and the pied wheatear from Armenia, Ukraine, and Russia [8,18,29]. Strelkoviacarus integer (Trouessart et Neumann, 1888) is another feather mite species that was collected from the northern wheatear from Russia [30]. Doña et al. [31] reported some unexpected feather mite species for wheatears, like Proctophyllodes cetti Badek, Mironov et Dabert, 2008 and P. schwerinensis (Černy, 1982) on the northern wheatear, and Proctophyllodes mesocaulus Mack-Fira et Cristea-Nastasescu, 1968 on the western black-eared wheatear and the black wheatear (Oenanthe leucura), using DNA metabarcoding. However, this study was focused on detecting accidental, but natural, transfers of feather mites between passerines. Thus, finding these feather mite species does not mean that they have established stable intra-populations on wheatears. Further studies involving more specimens of the Isabelline wheatear examined might be expected to find other species of feather mites such as the P. hipposideros, which is widely distributed in wheatears.

Wheatears are rarely studied for haemosporidian parasites. So far, there are no published records of haemosporidian parasites found on wheatears in Europe. In our study on Isabelline wheatears, we found Plasmodium relictum (lineage SGS1)—a widespread generalist parasite (lineage) registered on all continents except Antarctica, which is found in 148 avian host species from 37 families, 12 orders, and 9 vector species (mostly mosquitoes from genus Culex) (MalAvi database; accessed April 2024). Recently, Plasmodium sp. was found in an Isabelline wheatear in Iraq [22]. However, this record was only based on morphological examination of blood slides, and the parasites were only identified to a genus level with no molecular data provided. In Eilat, Israel, Paperna et al. [20] found a very low prevalence of genera Leucocytozoon and Haemoproteus in 19 studied Isabelline wheatears, also based on examination of blood smears and without identification of the parasites to a species level.

Data on haemosporidian parasites in other species of wheatears are also scarce. Haiba [32] first reported Plasmodium praecox (currently Plasmodium relictum) in the northern wheatear and the mourning wheatear (Oenanthe lugens) (Lichtenstein, MHC 1823) in Egypt. Valkiūnas et al. [33] found parasites from the three genera, Haemoproteus, Leucocytozoon, and Plasmodium, in pied wheatears in Turkmenistan, and Nourani et al. [34] reported Haemoproteus sp. in the same host species from Iran; however, both studies were based just on morphological identification of the parasites to the genus level. In the MalAvi database, where the records are based on the cyt b gene of the parasites, only two records of haemosporidian parasite lineages in wheatears can be found, both in northern wheatears—lineage SGS1 (Plasmodium relictum) from Morocco [35] and lineage OEOEN01 (Haemoproteus sp.) from Iran [36]. Recently, Ghaemitalab et al. [37] reported lineage LK05 (Plasmodium sp.) from variable wheatear (Oenanthe picata), also from Iran. In the study by Valkiūnas et al. [38], the authors mention lineage GRW6 (Plasmodium elongatum Huff, 1930) as infecting northern wheatears; however, details on this record are not published yet.

The above-mentioned studies on feather mites and haemosporidian parasites were broadly oriented towards their diversity and prevalence in various bird species, and in most cases, the number of screened wheatears was low. Increasing the sampling efforts in terms of better species coverage, more sampling locations, and higher sample sizes is crucial for expanding our knowledge of the blood parasites and feather mites in this comparatively rarely caught group of passerines. In the case of the Isabelline wheatear, gathering more data on other groups of ectoparasites and endoparasites (e.g., ticks, fleas, and parasitic worms) will be of interest, in the light of their co-existence with ground squirrels and other burrowing rodents and the possibility of cross-infections.