Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle
Abstract
1. Introduction
2. Materials and Methods
2.1. Life Cycle and Morphology of Worms
2.2. Molecular Data
2.2.1. DNA Extraction, Amplification, and Sequencing
2.2.2. Analysis of Genetic Data
| Species | Sources | Genbank Accession Number |
|---|---|---|
| Diplostomum cf. vanelli | this study | PP002326 |
| Diplostomum alascense | [21] | MZ314153 |
| Diplostomum phoxini | [18] | AY222173 |
| Diplostomum alarioides | [21] | MZ314152 |
| Diplostomum scudderi | [21] | MZ314170 |
| Diplostomum marshalli | [21] | MZ314167 |
| Diplostomum gavium | [21] | MZ314154-55 MZ314157 |
| Diplostomum pseudospathaceum | [22] | KR269766 |
| Diplostomum rauschi | [21] | MZ314169 |
| Diplostomum indistinctum | [21] | MZ314161-65 |
| Diplostomum spathaceum | [22] | KR269765 |
| [21] | MZ314171 | |
| Diplostomum huronense | [21] | MZ314160 |
| Diplostomum baeri | [23] | OK631869 |
| Diplostomum ardeae | [24] | MT259036 |
| Postharmostomum commutatum * | [25] | MH915390 |
| Species | Sources | Genbank Accession Number |
|---|---|---|
| Diplostomum cf. vanelli | this study | PP002346 |
| Diplostomum huronense | [21] [26] [8] [27] | MZ323257-61 GQ292488-90 KR271069; KR271071-74 HM064667-68; HM064672 |
| Diplostomum rauschi | [21] | MZ323270 |
| Diplostomum indistinctum | [21] [26] [27] [28] | MZ323262-63; MZ323265 GQ292482 HM064673 KT831379 |
| Diplostomum baeri | Unpublished [29] [8] [30] [23] | MF142161; MF142171-73; MF142176; MF142178; MF142184; MF142186-89; MF142191; MF142196; MF142198; MF142209; MF142211-12; MF142214; MF142216; MF142222-24 MH368850-53 KR271040; KR271042-47; KR271050-60; KR271062; KR271064-67 KM212030-KM212031 OK632471-74; OK632476-77 |
| Diplostomum spathaceum | [21] [8] [22] | MZ323274; MZ323276; MZ323278-81 KR271414-16; KR271419-24; KR271427-28; KR271431-45; KR271449; KR271451; KR271454-62; KR271465; KR271467-69 KR269763 |
| Diplostomum alascense | [21] | MZ323250 |
| Diplostomum scudderi | [21] | MZ323273 |
| Diplostomum alarioides | [21] | MZ323249 |
| Diplostomum pseudospathaceum | [22] [8] | KR269764 KR271083-89; KR271091-92 |
| Diplostomum gavium | [21] | MZ323251; MZ323255 |
| Diplostomum marshalli | [21] | MZ323268 |
| Diplostomum lunaschiae | [24] | MT324602; MT324607-08; MT324612-14; MT324617; MT324621-22; MT324595-96; MT324599 |
| Diplostomum ardeae | [24] [8] | MT324592-93 KR271033 |
| Diplostomum mergi | [8] Unpublished | KR271082 KY271543 |
| Postharmostomum commutatum * | [31] | MN200359 |
3. Results
3.1. Morphology Data
3.2. Molecular Data
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Shigin, A.A. Trematode fauna of the USSR. Genus Diplostomum. In Metacercariae; Nauka: Moscow, Russia, 1986. (In Russian) [Google Scholar]
- Shigin, A.A. Trematodes of the fauna of Russia and neighbouring regions. In Genus Diplostomum; Nauka: Moscow, Russia, 1993. (In Russian) [Google Scholar]
- Chappell, L.H.; Hardie, L.J.; Secombes, C.J. Diplostomiasis: The disease and host-parasite interactions. In Parasitic Diseases of Fish; Tresaith: Dyfed, UK, 1994; pp. 59–86. [Google Scholar]
- Niewiadomska, K. Family Diplostomidae Poirier, 1886. In Keys to the Trematoda: Vol. I.; CAB International: Wallingford, UK, 2002. [Google Scholar]
- Georgieva, S.; Soldanova, M.; Perez-Del-Olmo, A.; Dangel, D.R.; Sitko, J.; Sures, B.; Kostadinova, A. Molecular prospecting for European Diplostomum (Digenea: Diplostomidae) reveals cryptic diversity. Int. J. Parasitol. 2013, 43, 57–72. [Google Scholar] [CrossRef] [PubMed]
- Perez-Del-Olmo, A.; Georgieva, S.; Pula, H.; Kostadinova, A. Molecular and morphological evidence for three species of Diplostomum (Digenea: Diplostomidae), parasites of fishes and fish-eating birds in Spain. Parasite Vectors 2014, 7, 502. [Google Scholar] [CrossRef]
- Selbach, C.; Soldanova, M.; Georgieva, S.; Kostadinova, A.; Sures, B. Integrative taxonomic approach to the cryptic diversity of Diplostomum spp. in lymnaeid snails from Europe with a focus on the ‘Diplostomum mergi’ species complex. Parasite Vectors 2015, 8, 300. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; Al-Nasiri, F.S.; Caffara, M.; Drago, F.; Kalbe, M.; Lapierre, A.R.; McLaughlin, J.D.; Nie, P.; Overstreet, R.M.; Souza, G.T.; et al. Diversity, specificity and speciation in larval Diplostomidae (Platyhelminthes: Digenea) in the eyes of freshwater fish, as revealed by DNA barcodes. Int. J. Parasitol. 2015, 45, 841–855. [Google Scholar] [CrossRef] [PubMed]
- Kudlai, O.; Oros, M.; Kostadinova, A.; Georgieva, S. Exploring the diversity of Diplostomum (Digenea: Diplostomidae) in fishes from the River Danube using mitochondrial DNA barcodes. Parasite Vectors 2017, 10, 592. [Google Scholar] [CrossRef] [PubMed]
- Hoogendoorn, C.; Smit, N.J.; Kudlai, O. Resolution of the identity of three species of Diplostomum (Digenea: Diplostomidae) parasitizing freshwater fishes in South Africa, combining molecular and morphological evidence. Int. J. Parasitol. Parasites Wildl. 2020, 11, 50–61. [Google Scholar] [CrossRef] [PubMed]
- Oshmarin, P.G. Parasitic Worms of Mammals and Birds in the Primorsky Region; Academy of Science of USSR: Moscow, Russia, 1963. (In Russian) [Google Scholar]
- Sonin, M.D. Key to Trematodes of Fish-Eating Birds of the Palaearctic: Opisthorchids, Renicolids, Strigeids; Nauka: Moscow, Russia, 1986. (In Russian) [Google Scholar]
- Besprozvannykh, V.V.; Ermolenko, A.V.; Nadtochy, E.V. Parasites of Animals and Man in Southern Far East; Dalnauka: Vladivostok, Russia, 2012. (In Russian) [Google Scholar]
- Truett, G.E.; Heeger, P.; Mynatt, R.L.; Truett, A.A.; Walker, J.A.; Warman, M.L. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). BioTechniques 2000, 29, 52–54. [Google Scholar] [CrossRef] [PubMed]
- Tkach, V.V.; Littlewood, D.T.J.; Olson, P.D.; Kinsella, J.M.; Swiderski, Z. Molecular phylogenetic analysis of the Microphalloidea Ward, 1901, (Trematoda, Digenea). Syst. Parasitol. 2003, 56, 1–15. [Google Scholar] [CrossRef]
- Moszczynska, A.; Locke, S.A.; McLaughlin, J.D.; Marcogliese, D.J.; Crease, T.J. Development of primers for the mitochondrial cytochrome c oxidase I gene in digenetic trematodes (Platyhelminthes) illustrates the challenge of barcoding parasitic helminths. Mol. Ecol. Resour. 2009, 9, 75–82. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5, Molecular evolutionary genetic analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
- Olson, P.D.; Cribb, T.H.; Tkach, V.V.; Bray, R.A.; Littlewood, D.T.J. Phylogeny and classification of the Digenea (Platyhelminthes, Trematoda). Int. J. Parasitol. 2003, 33, 733–755. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3, Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [PubMed]
- Achatz, T.J.; Martens, J.R.; Kostadinova, A.; Pulis, E.E.; Orlofske, S.A.; Bell, J.A.; Fecchio, A.; Oyarzún-Ruiz, P.; Syrota, Y.Y.; Tkach, V.V. Molecular phylogeny of Diplostomum, Tylodelphys, Austrodiplostomum and Paralaria (Digenea: Diplostomidae) necessitates systematic changes and reveals a history of evolutionary host switching events. Int. J. Parasitol. 2022, 52, 47–63. [Google Scholar] [CrossRef]
- Brabec, J.; Kostadinova, A.; Scholz, T.; Littlewood, D.T. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): A molecular resource for taxonomy and molecular epidemiology of important fish pathogens. Parasites Vectors 2015, 8, 336. [Google Scholar] [CrossRef]
- Faltynkova, A.; Kudlai, O.; Pantoja, C.; Yakovleva, G.; Lebedeva, D. Another plea for ‘best practice’ in molecular approaches to trematode systematics: Diplostomum sp. clade Q identified as Diplostomum baeri Dubois, 1937 in Europe. Parasitology 2022, 149, 503–518. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; Drago, F.B.; Nunez, V.; Souza, G.T.R.E.; Takemoto, R.M. Phylogenetic position of Diplostomum spp. from New World herons based on complete mitogenomes, rDNA operons, and DNA barcodes, including a new species with partially elucidated life cycle. Parasitol. Res. 2020, 119, 2129–2137. [Google Scholar] [CrossRef] [PubMed]
- Valadao, M.C.; Silva, B.C.M.; Lopez-Hernandez, D.; Araujo, J.V.; Locke, S.A.; Pinto, H.A. A molecular phylogenetic study of the caecal fluke of poultry, Postharmostomum commutatum (=P. gallinum) (Trematoda: Brachylaimidae). Parasitol. Res. 2018, 117, 3927–3934. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; McLaughlin, J.D.; Dayanandan, S.; Marcogliese, D.J. Diversity and specificity in Diplostomum spp. metacercariae in freshwater fishes revealed by cytochrome c oxidase I and internal transcribed spacer sequences. Int. J. Parasitol. 2010, 40, 333–343. [Google Scholar] [CrossRef]
- Locke, S.A.; McLaughlin, D.J.; Marcogliese, D.J. DNA barcodes show cryptic diversity and a potential physiological basis for host specificity among Diplostomoidea (Platyhelminthes: Digenea) parasitizing freshwater fishes in the St. Lawrence River, Canada. Mol. Ecol. 2010, 19, 2813–2827. [Google Scholar] [CrossRef]
- Gordy, M.A.; Kish, L.; Tarrabain, M.; Hanington, P.C. A comprehensive survey of larval digenean trematodes and their snail hosts in central Alberta, Canada. Parasitol. Res. 2016, 115, 3867–3880. [Google Scholar] [CrossRef]
- Gordy, M.A.; Hanington, P.C. A fine-scale phylogenetic assessment of digenean trematodes in central Alberta reveals we have yet to uncover their total diversity. Ecol. Evol. 2019, 9, 3153–3238. [Google Scholar] [CrossRef]
- Kuhn, J.A.; Kristoffersen, R.; Knudsen, R.; Jakobsen, J.; Marcogliese, D.J.; Locke, S.A.; Primicerio, R.; Amundsen, P.A. Parasite communities of two three-spined stickleback populations in subarctic Norway—Effects of a small spatial-scale host introduction. Parasitol. Res. 2015, 114, 1327–1339. [Google Scholar] [CrossRef]
- Fu, Y.-T.; Jin, Y.-C.; Liu, G.-H. The Complete Mitochondrial Genome of the Caecal Fluke of Poultry, Postharmostomum commutatum, as the First Representative from the Superfamily Brachylaimoidea. Front. Genet. 2019, 10, 1037. [Google Scholar] [CrossRef]
- Skrjabin, K.I. Trematodes of Animal and Man, Principles of Trematodology; House of the USSR Academy of Science: Moscow, Russia, 1960. (In Russian) [Google Scholar]
- Tatonova, Y.V.; Shumenko, P.G.; Besprozvannykh, V.V. Description of Metagonimus pusillus sp. nov. (Trematoda: Heterophyidae): Phylogenetic relationships within the genus. J. Helminthol. 2018, 92, 703–712. [Google Scholar] [CrossRef]



| DNA Region | Primer | Sequence 5′→3′ | Direction | Reference |
|---|---|---|---|---|
| 28S | digl2 | AAGCATATCACTAAGCGG | forward, external | [15] |
| 1500R | GCTATCCTGAGGGAAACTTCG | reverse, external | [15] | |
| 900F | CCGTCTTGAAACACGGACCAAG | forward, internal | [15] | |
| 1200R | CTTGGTCCGTGTTTCAAGACGGG | reverse, internal | [15] | |
| COX1 | MplatCOX1dF | TGTAAAACGACGGCCAGTTTWCITTRGATCATAAG | forward, external | [16] |
| MplatCOX1dR | CAGGAAACAGCTATGACTGAAAYAAYAIIGGATCICCACC | reverse, external | [16] |
| Diplostomum vanelli | |||
|---|---|---|---|
| Source | Present Study | Yamaguti 1935 cit. [32] | Dubois 1938 cit. [32] |
| Body length | 785–1145 | 1210–1600 | 1200–1500 |
| Prosoma length | 410–595 | 680–800 | 670–750 |
| Prosoma width | 250–370 | 450–650 | 480–520 |
| Opisthosoma length | 375–550 | 530–800 | 580–750 |
| Opisthosoma width | 175–245 | 320–470 | 400–470 |
| Oral sucker length | 50–80 | 48–75 | 55–62 |
| Oral sucker width | 45–100 | 38–84 | 62–79 |
| Lateral pseudosucker length | 55 | 90–102 diameter | 72–100 diameter |
| Lateral pseudosucker width | 30–80 | ||
| Pharynx length | 50–70 diameter | 54–66 | 53–65 |
| Pharynx width | 42–54 | 45–50 | |
| Ventral sucker length | 55–85 | 72–108 diameter | 74–82 |
| Ventral sucker width | 70–105 | 86–90 | |
| Holdfast organ length | 80–95 | 150–208 diameter | 220–280 diameter |
| Holdfast organ width | 100–125 | ||
| Anterior testis length | 100–220 | 110–180 | 140–160 |
| Anterior testis width | 70–130 | 200–330 | 270–305 |
| Posterior testis length | 175–220 | 140–200 | 150–205 |
| Posterior testis width | 60–115 | 280–360 | 315–360 |
| Ovary length | 50–60 | 50–110 | 105 |
| Ovary width | 55–75 | 75–160 | 125–140 |
| Eggs length | - | 93–108 | 96–104 |
| Eggs width | - | 54–60 | 54–63 |
| Prosoma/opisthosoma length ratio | 1.0 | - | 0.83–1.0 |
| Oral/ventral sucker length ratio | 0.9 | - | - |
| Species | Distances between Species | Distances within Species | ||||||
|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | ||||
| 1 | Diplostomum spathaceum | 0.0000 | 0.0008 | 0.0044 | 0.0039 | 0.0000 | 0.0000 | |
| 2 | Diplostomum cf. vanelli | 0.0000 | 0.0008 | 0.0044 | 0.0039 | - | - | |
| 3 | Diplostomum huronense | 0.0009 | 0.0009 | 0.0042 | 0.0038 | - | - | |
| 4 | Diplostomum baeri | 0.0188 | 0.0188 | 0.0179 | 0.0049 | - | - | |
| 5 | Diplostomum ardea | 0.0224 | 0.0224 | 0.0215 | 0.0323 | - | - | |
| Species | Distances between Species | Distances within Species | ||||
|---|---|---|---|---|---|---|
| 1 | 2 | 3 | ||||
| 1 | Diplostomum cf. vanelli | 0.0126 | 0.0132 | - | - | |
| 2 | Diplostomum spathaceum | 0.0963 | 0.0126 | 0.0094 | 0.0021 | |
| 3 | Diplostomum indistinctum | 0.0849 | 0.0910 | 0.0082 | 0.0035 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Izrailskaia, A.V.; Besprozvannykh, V.V.; Shchelkanov, M.Y. Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle. Diversity 2024, 16, 286. https://doi.org/10.3390/d16050286
Izrailskaia AV, Besprozvannykh VV, Shchelkanov MY. Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle. Diversity. 2024; 16(5):286. https://doi.org/10.3390/d16050286
Chicago/Turabian StyleIzrailskaia, Anna V., Vladimir V. Besprozvannykh, and Michael Yu. Shchelkanov. 2024. "Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle" Diversity 16, no. 5: 286. https://doi.org/10.3390/d16050286
APA StyleIzrailskaia, A. V., Besprozvannykh, V. V., & Shchelkanov, M. Y. (2024). Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle. Diversity, 16(5), 286. https://doi.org/10.3390/d16050286

