Next Article in Journal
A Model of Southern Sikhote-Alin Liverwort Flora and a New Approach to Analyze the Altitudinal Distribution Patterns in the Zov Tigra National Park (South of the Russian Far East, Temperate Pacific Asia)
Previous Article in Journal
Impacts of Microplastics, Cadmium, and Their Mixtures on Biochemical Biomarkers in the Freshwater Bivalve Corbicula fluminea (Bivalvia, Corbiculidea)
Previous Article in Special Issue
Phylogeographic Relationships Reveal the Origin of an Introduced Population of the Dalmatian Algyroides (Reptilia: Lacertidae) into Southern Italy
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences

1
Laboratory of Marine Biodiversity and Environment LR18ES30, Department of Life Sciences, Faculty of Sciences, University of Sfax Tunisia, Sfax 3000, Tunisia
2
Biology of Organisms, Stress, Health, Environment, Molecular Biology and Evolutionary Genetics Team Faculty of Science and Technology, Le Mans University, Street Olivier Messiaen, CEDEX, 72085 Le Mans, France
3
UMR BOREA, MNHN, CNRS 8067, SU, IRD 207, UCN, UA, CP 26, 43, rue Cuvier, CEDEX, 75231 Paris, France
4
Plankton Culture Laboratory, Department of Fisheries and Aquaculture, University of Patras, 30200 Messolonghi, Greece
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(12), 751; https://doi.org/10.3390/d16120751
Submission received: 24 June 2024 / Revised: 9 September 2024 / Accepted: 10 September 2024 / Published: 8 December 2024
(This article belongs to the Collection Feature Papers in Phylogeny and Evolution)

Abstract

Due to the complexity of taxonomic classification based on the classical morphological characters of copepods, phylogenies have been ambiguous. In this study, we investigate the phylogeny of copepods, including four species from three orders, in the saltern of Sfax using the small subunit of nuclear ribosomal RNA genes (18S). In the studied area, copepods seemed to be a polyphyletic group, and the genetic structure of these crustaceans is complex and problematic. We have also used two mitochondrial markers, the cytochrome c oxidase subunit I (mtCOI) gene and the cytochrome b (Cytb) sequence data, in order to investigate the genetic diversity and differentiation in a total of 96 individuals from two sets of Paracartia grani, sampled from two ponds with different salinities (42 PSU and 61 PSU). All of the results presented here suggest a low genetic diversity among P. grani species and a weak genetic structure between the sets. The nucleotide and haplotype diversity of P. grani were extremely low, indicating the homogeneity of the two sets, which could be combined into one set living in different ranges of salinity. This small genetic diversity is possibly due to the confined natural distribution range and strong selective pressure in a saltern environment. These data also suggest that gene flow is the main factor shaping the genetic structure of the studied sets.

1. Introduction

Copepods, one of the infraclasses of the phylum Crustacea, are a key component in diverse marine ecosystems [1] as they are an intermediate link between phytoplankton and higher trophic levels [2]. This taxon is widely dispersed and distributed in almost all ecosystems, including those with extreme salinities [3,4,5,6]. Taking into account all ecosystems, copepods are considered the most numerically abundant group [7] and can represent more than 80% of the mesozooplankton [8]. They consist of a large number of taxa, with approximately 200 families and 11,500 species [9]. According to Machida et al. [10], this number may only cover 15% of the actual number of copepod species on Earth. Thus, most of them are unidentified. As of yet, the genetic diversity of these tiny crustaceans living in extreme salt ecosystems has not been investigated. Species diversity is reflected in genetic differentiation. One approach to understanding how copepods acquired such an immense diversity in the aquatic realm, particularly in extreme environments, is by studying their phylogenetic relationships. To assess the genetic divergence between populations and species, population genetic analysis seems to be optimal [11].
In recent years, species classification has increasingly utilized molecular genetic methods through the analysis of some fragment of the genome [12,13] because species classification based on traditional morphological characteristics is unreliable and controversial [14]. DNA identification has been applied to wide orders of copepods, including Harpacticoida [15,16,17], Cyclopoida [13,18,19], and Calanoida [20,21,22]. The integration of DNA sequences of numerous zooplankton is also a solution to detect telling cryptic species (i.e., species containing subtle or indistinct differences based only on classical morphological characters [23,24]). To resolve these taxonomic uncertainties, morphological and molecular identification are interconnected, and advances in one area provide significant benefits to the other.
To date, to answer questions relating to phylogenetic relationships and population genetics in copepods at various taxonomic levels, a few nuclear and/or mitochondrial markers have been utilized [25]. Among the most frequently used molecular markers in metazoan, mitochondrial cytochrome b and cytochrome oxidase subunit I (COI) genes were shown to be effective for analyzing inter and intraspecific variation [20,26,27,28]. However, the 16S and 18S ribosomal DNA genes have been used to resolve phylogenetic relationships at the ordinal, familial, or generic levels [27,29,30].
The aim of this work was (i) to improve the phylogeny of four dominant species of copepods living in two contrasting high-salinity salterns located in Sfax and (ii) to analyze the genetic structure of the population of the most abundant species of copepods, Paracartia grani, across different high salinities to better understand the influence of salinity on its genetic structure. To our knowledge, this paper represents the first attempt to study the genetic diversity of dominant copepods in an extreme saltern ecosystem. Studying copepod diversity is essential for developing a complete biodiversity inventory in such ecosystems. In this study, we analyzed the DNA sequences of three genes: a slow-evolving gene, the nuclear small subunit rRNA (18S), and two fast-evolving genes, mitochondrial genes encoding cytochrome c oxidase subunit I (COI) and cytochrome b (Cyt b).

2. Materials and Methods

2.1. Species Sampling

Copepod samples were collected from two solar saltern ponds located in Sfax (A5 and A16) of increasing salinity (42 and 61, respectively) using a 150 μm net (Figure 1). The samples were immediately preserved in 95% ethanol for molecular analysis.
The taxonomic identification of species was carried out in a laboratory under a microscope based on their morphological characteristics and using taxonomic guides [31,32,33,34,35,36].

2.2. DNA Extraction, PCR, and Sequencing

Genomic DNA was extracted from individual adult copepods. Each specimen was placed in a 0.2 mL micro tube with 23 µL of pure water and heated at 94 °C for 5 min in a thermal cycler to extract the DNA.
Genes encoding the nuclear small subunits ribosomal RNA (18S rRNA) were used for phylogenetic analyses for all species. To compare the intraspecific polymorphism patterns of different loci among populations, P. grani was studied because this species is the only one present and abundant in both ponds. The collected samples for each pond are treated as one set. We analyzed the genetic diversity between the two sample sets of P. grani in the Sfax solar saltern using partial sequences of the mitochondrial genes cytochrome c oxidase subunit I (COI) and cytochrome b. The PCR and sequencing primers used for each gene, along with the annealing temperatures and the length of the amplified regions, are specified in Table 1.
PCR amplifications were performed in a Thermal Cycler (Biometra, CANADA) with a total reaction volume of 25 µL, including 10 µL of 1× Green GoTaq Flexi Buffer, 3 µL of 25 mM MgCl2, 1 µL of dNTPs (final concentration 10 mM), 1 µL of each primer (final concentration 10 pMol), 0.2 units of GoTaq Flexi DNA Polymerase (Promega, GERMANY), and 1 µL of a copepod species DNA sample. The final volume was adjusted to 25 µL with pure water. Except for the primers, which were specific for each genetic marker, the composition used for the PCR reactions was identical for 18S, COI, and Cytb.
PCR products were electrophoresed on a 1% agarose gel containing the ethidium bromide and visualized with UV light. The expected fragment was excised and cleaned with the Wizard SV Gel (Promega) Kit. The products were sequenced using forward primers provided by the Beckman Coulter Genomics Company.

2.3. Sequence Alignment and Genetic Analyses

Electropherograms were edited using the program MEGA 5.05 (Molecular Evolutionary Genetic Analysis). The nucleotide sequences were further checked by aligning to the detection artifacts (e.g., insertion or deletion of one or more nucleotide bases) using the default parameters in ClustalW [40] followed by modification by eye. The alignments of the three genes were carried out separately in ClustalW.
Phylogenetic reconstruction for the 18S dataset was implemented in MEGA 5.05 under maximum likelihood (ML). The phylogenetic tree was generated using sequences produced in this study, along with previously deposited copepod sequences from GenBank (Table 2). These last were chosen because they are obtained from copepods sampled from various geographical areas and have taxonomic affinities to the copepod species sampled from the saltern of Sfax. For all these sequences, the nucleotide substitution model was analyzed with the Model generator program [4]].
The genetic diversity of COI and Cytb was analyzed between Paracartia grani sets by the fixation index (Fst). This index was tested using a non-parametric procedure described in Arlequin software [41]. We also calculated haplotype and nucleotide diversities with Arlequin Ver 3.11 and compared the results between ponds. Finally, mtCOI and Cytb haplotype networks that illustrate all connections were drawn using Fluxus Network 4.6 so as to visually understand the relationship among haplotypes recovered from the two pond areas. The mismatch distribution between individual species was computed using the same software.

3. Results

Our previous works reported that copepod communities were composed of 10 taxa belonging to three orders: Harpacticoida, Cyclopoida, and Calanoida [4]. This study focuses on the most abundant species sampled from two ponds (A5 and A16) of increasing salinity (42 and 61, respectively) (Table 3).

3.1. Phylogenetic Analysis

A maximum likelihood tree was constructed using 18S (Figure 2), which enabled analysis of the phyletic relationships between fifteen samples of copepods sampled from the solar salterns of Sfax (Table 3) and twenty-three copepod sequences from several geographical areas available in the databases (Table 2). The length of the sequenced portions varied from 405 to 452 pb. For the 18S gene, 15 haplotypes were collected from 15 individuals in the solar salterns of Sfax. A total of 283 polymorphic sites were detected, with 128 transitions and 204 transversions. Nucleotide composition was strongly TG-biased in 18S (21.15% C, 25.94% T, 22.77% A and 30.13% G). Surprisingly, each sequence is unique. The five samples of Oithona nana showed five haplotypes, which differ with one transition and two transversions; three haplotypes were observed for the 3 O. similis samples. The three Clytemnestra scutellata and the four Paracartia grani species each exhibited an exclusive haplotype. The analysis of the nucleotide substitution model revealed that it is close to the K2P model, which distinguishes the rate of transition and transversion.
For each species, the sequences obtained in this work were grouped and formed independent clusters with high bootstrap support (97%, 98%, 98%, and 73% for O. similis, P. grani, O. nana, and C. scutellate, respectively) (Figure 2). The ML tree based on 18S illustrated that copepod phylogeny is not clearly characterized. However, the Calanoida order appeared distinctly defined as P. grani from the salterns of Sfax and was grouped with most other species of Acartidae available in the database. Conversely, Harpacticoida and Cyclopoida orders appeared as polyphyletic groups. Within the Cyclopoida order, the genus Oithona presented two sets of samples corresponding to two species collected from the salterns of Sfax grouped by species but phyletically not close (O. nana and O. similis) and eight species sampled from different areas. Similarly, the three samples of harpacticoids C. scutellata were grouped together but not close to the five available sequences of harpacticoids from GenBank. All genera within Harpacticoida were scattered across the tree. However, some of the bootstrap values were too low to validate the phylogenetic relationships found in this study.

3.2. Genetic Population Structure Analysis

In the solar saltern of Sfax, P. grani populations were collected from the two ponds, A5 (42) and A16 (61). In these ponds, P. grani was the dominant species, representing 30% in A5 and 50% in A16 [4]. The genetic diversity of COI and Cytb gene fragments of the samples is summarized in Table 4.

3.2.1. Estimation of the Genetic Variability of P. grani with COI

For the mtCOI gene of P. grani obtained from the two ponds A5 and A16, 21 haplotypes (Figure 3) were collected from 46 individuals. These haplotypes contained 52 polymorphic sites, consisting of 39 transitions and 13 transversions. The haplotype diversity (Hd = 0.0217) was larger than the nucleotide diversity (π = 0.0096). The sequences have the nucleotide composition of 15% of C, 37% of T, 26% of A, and 20% of G, and was consistent across both sample sets.
The set of COI sequences of P. grani sampled from pond A16 contained 26 sequences and was 629 bp in length. It spread in 11 haplotypes showed 25 polymorphic sites (22 transitions and three transversions). The P. grani sampled from pond A5 consisted of 20 sequences aligned on 649 positions, forming 12 haplotypes with 42 polymorphic sites (30 transitions and 12 transversions) (Table 4).
At the intrasite level, the haplotype diversity of P. grani sampled from A5 (Hd = 0.05) was higher than that of the samples from A16 (Hd = 0.0385). The nucleotide diversity showed the same trend (π = 0.0122 in A5 and π = 0.0076 in A16). The pairwise difference mean was higher in A5 (Pd = 7.921) compared to the combined ponds (Pd = 6.311). In A16, the pairwise difference mean was lowest (Table 4). No genetic divergence was detected (Fst = 0) between P. grani sets sampled from A5 and A16.
The network haplotype of the whole P. grani collected from A5 and A16 was constructed using the COI sequences (Figure 3). We found two shared haplotypes (the most frequent ones) and many unique haplotypes. Most haplotypes diverged from the dominant one by one to three mutations. The central haplotype is unfairly distributed between the two populations (31.57% and 68.43% for P. grani sampled from A5 and A16, respectively).
Mismatch distributions of pairwise differences were estimated for the mitochondrial COI gene using all sequences determined for P. grani collected from A5 and A16 (Figure 4). The range of the pairwise differences within species was 0–19. The mismatch distribution for P. grani showed a clear bimodal pattern, with peaks at 0 and 9 pairwise differences.

3.2.2. Estimation of the Genetic Variability of P. grani with Cytb

The DNA sequence of a 402 pb region of the Cytb gene was obtained for twenty-three individuals, nine collected in A5 and fourteen collected from A16. Each individual showed its own sequence (Figure 5). The sequence variation resolved 46 polymorphic sites (42 transitions and nine transversions). P. grani from A5 consisted of 27 polymorphic sites (26 transitions and five transversions), while the samples from A16 exhibited 39 polymorphic sites (35 transitions and seven transversions). The Cytb gene showed the same nucleotide composition for P. grani from both A5 and A16 (17% of C, 23% of T, 39% of A and 19% of G).
The haplotype diversity was lower for all the samples combined (Hd = 0.0435) than for each individual site (A5: Hd = 0.111–A16: Hd = 0.0714). No significant difference was observed between nucleotide diversity (total: π= 0.0293—A5: π = 0.0277—A16: π = 0.0283). Whatever the level of analysis (inter or intrasite), the haplotype diversity was higher than nucleotide diversity. The pairwise differences were clearly lower in A5 (Pd = 11.306) than in both ponds combined (Pd = 12.545), whereas it is slightly higher (Pd = 12.923) in A16. The intersite divergence detected with the Cytb marker was higher than with the COI marker (Fst = 0.04007).
The network haplotype of the whole P. grani collected from A5 and A16 was constructed with Cytb (Figure 5). No dominant haplotype was observed. Considering the ponds of collected P. grani, sequences from the A5 pond formed two distinct genetic groups (A and B, Figure 5). Haplotypes obtained from samples collected from A16 all belonged to the same genetic group, which is close to the “A” sequences of the A5 samples.
The mismatch distribution with Cytb in P. grani collected from A5 and A16 underlined that the pairwise genetic differences varied between two and twenty-three (Figure 6). The curve was bimodal with peaks at 11 and 14 pairwise differences. This bimodality was less pronounced with Cytb than that inferred with the COI.

4. Discussion

This study is the first robust analysis on the genetic diversity of copepods in the extreme ecosystem of solar salterns. It provides additional insights into the patterns of genetic distribution and adaptation in the aquatic realm and, in particular, for halophilic lineages. Analysis of DNA sequence variation confirmed that the 18S rRNA gene is a valid marker for phylogenetics [29,42,43,44,45].

4.1. Phylogeny of Copepods

The 18S gene is considered to be an informative marker when studying the genetic diversity of zooplankton at the interspecific level [46,47,48,49]. However, some intraspecific genetic variations were observed in the four studied species. Very few studies have conducted intraspecific analyses of 18S sequences [20,25], making it difficult to determine whether this is a common characteristic among copepod taxa. Additionally, the only intraspecific comparison available in the data banks revealed a significant genetic difference. Nevertheless, each species is genetically defined with a narrow set of sequences. Despite earlier works carried out on copepods [20,24,25,28,46,50,51,52], the phylogeny of this group still remains confused and controversial. Blanco-Bercial [20], Chen and Hare [24], and Cornils and Held [52] highlighted that for calanoids, cryptic diversity, a combination of deep evolutionary divergences, and unique genetic features complicate efforts to construct a consistent and clear phylogenetic tree. Chen and Hare [24], studying the estuarine calanoid Acartia tonsa using mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) markers, uncovered significant cryptic diversity within what was previously considered to be a single species. For cyclopoids, Wyngaard et al. [25] combined molecular and morphological data in their phylogenetic analysis of the freshwater copepod Mesocyclops. They brought attention to the hidden genetic diversity within Mesocyclops and the potential influence of biogeographical factors on the evolution of this group. A similar conclusion has been found from the tree obtained from the analysis of 18S rRNA. Indeed, our results show that the genetic structure of the copepod taxon is not clearly defined because there was no evidence of lineage sorting (i.e., grouping of the haplotypes). Historically, since 1859, copepods have been considered a monophyletic group based on morphological criteria [48,53]. This conclusion was not congruent with our finding because the haplotypes obtained from the saltern of Sfax are not a sister group to the haplotypes sampled from several geographical areas despite the confirmed morphological identification. Our results underscore that copepod phylogeny is complex and problematic. This is in accordance with the findings of Minxiao et al. [50] and Adamowicz et al. [54], who showed that copepod phylogeny presents some ambiguities. Molecular phylogenetic analysis based on one nuclear (18S rRNA) gene showed copepods to be a polyphyletic group. The gene phylogeny underlined that P. grani sequences were grouped with other Acartidae species available in GenBank, except for A. tonsa and A. longiremis. These latter species were not grouped together, which revealed the same problem. The Calanoida subdivision has been problematic due to the wide range of characters (see review by Bradford-Grieve et al. [55]). Our results supported conclusions based on 28S, 18S rRNA, COI, and Cytb regarding the phylogeny of seven Calanoida superfamilies [20].
In our study, Harpacticoida and Cyclopoida were dispersed. The Cyclopoida group was divided into three sub-groups: the first was composed of O. similis (saltern of Sfax) and Paracyclopina nana (Korea), the second presents O. nana (salterns of Sfax), and the last subgroup was constituted by other Oithonidae species, each represented by a single sample. The phylogeny of this order is still very confused; for example, our O. similis sequences were grouped together but not close to the only sequence of the same species available in GenBank. This discrepancy may be related to the geographical origins of these populations. It seems likely that geographic populations of O. similis exhibit significant genetic differentiation among regions, even for a conserved genetic marker. This is supported by Cepeda et al. [13], who observed a significant genetic differentiation within O.similis species from the North and South Atlantic based on 28 rDNA. The hypothesis proposed by Cepeda et al. [13] was conceivable but a problem can also appear due to the morphological analysis and, particularly, to taxonomic uncertainties. In this study, the last hypothesis can be excluded because the morphological identification was confirmed by two experts. A similar issue is observed with the order of Harpacticoida, where C. scutellata from the salterns of Sfax is distant from other Harpacticoida available in GenBank, such as Tisbe sp. and Nitocra sp. Consequently, it is difficult to define clades, as several authors have cited previously. However, the topology of the single-gene phylogeny using a nuclear ribosomal gene (18S) produced inconsistent results [20]. The bootstrap values obtained using the ML method were, for the majority, low and do not, often, validate the groupings obtained. This finding agreed with those reported by Jung et al. [15], who suggested that phylogenetic reconstructions are still problematic in the genus Tigriopus because there were low supporting values in terms of bootstraps. The low support may be attributable to a lack of phylogenetically informative characters for the studied species [12] and to a weak, if not insufficient, phylogenetic signal to resolve all families within the studied orders [50,56]. This may also explain why our results contradicted those of some other authors. The ambiguity of the results can also be attributed to problems involved in the interpretation of morphological criteria established during the identification of species because microscopic observations are difficult to achieve in a general sense [57].

4.2. Population Genetic Diversity and Structure of P. grani

The intraspecific variability of P. grani species sampled from A5 and A16 was assessed using COI and Cytb at both inter and intrapond levels.
The overall diversity of P. grani individuals among the sampled ponds of the salterns of Sfax is not high as it is evident from the relatively low estimates of the haplotype and nucleotide diversities. These diversity indices are lower than those reported by Dippenaar et al. [28], who studied the copepod population of Nesippus orientalis sampled from different sites along the South African coast (Hd = 0.988). They attributed this high diversity to rapid population growth from an ancestral population with a small effective population size, which had sufficient time for the recovery of haplotype variation through mutation [58]. In our study, haplotype diversity was, also, much lower than that reported by Song et al. [59] (Hd = 0.858). These differences may be attributed to the smaller sizes of the population in our study.
For COI at the interpond level, the haplotype and nucleotide diversity of P. grani were lower than those obtained for A. tonsa (Hd = 0.926 and π = 0.0904) sampled from the Atlantic coast, where three sympatric lineages in this species were determined [24]. The low level of genetic differentiation in P. grani may be due to the following factors: the Calanoid P. grani may have a strong ability to adapt to various natural environments as this species have a wider range distribution [6,54], which may reduce the impact of selective pressures. Additionally, P. grani individuals might use water flow to facilitate movement between ponds, contributing to significant gene flow. Gene flow contributes to and maintains the genetic homogeneity of within populations and decreases or eliminates genetic differentiation among sets [60]. The genetic homogenization of the P. grani groups sampled in A5 and A16 ponds reflects high rates of gene exchange [61] despite the salinity levels.
Cytb proves to be the most polymorphic of the two markers and is, therefore, most suitable to differentiate individuals that are genetically close. This indicates that there are two groups of P. grani that are sympatric, at least in pond A5, and genetically distinct. The Fst values between the two ponds are lower than those obtained in other studies, such as that conducted by Makino et al. [62], who compared two populations of Calanoid copepods Sinodiaptomus valkanovi sampled from North East Japan and from the Seto Inland Sea (Fst = 0.85). This high fixation index is attributed to biological invasions, which create significant intraspecific genetic diversity, a phenomenon that does not seem to exist at our study site.
The Fst values obtained in our investigation for P. grani (0 for COI and 0.04007 for Cytb) were lower than 0.05. According to the criteria established by Hartl et al. [63], these values would indicate and confirm low genetic differentiation between ponds. The Fst values obtained in this study are similar to or even lower than those reported in the crustacean Tesseropora atlantica (Fst between 0.014 and 0.041; [64]) and in the 10 area populations of C. finmarchicus (Fst is ranged from 0.0000 to a maximum of 0.2400; [65]).
All of the results obtained in this study (by Hd, π, and Fst with the two studied markers COI and Cytb) indicate a low genetic structuring of P. grani along the salt gradient in the salterns of Sfax. This could be explained by at least two hypotheses: (i) recent range expansion and/or (ii) high gene flow [66]. The first hypothesis does not appear to be the most likely interpretation of our results because the distributions are all bimodal and do not support the network evidence for population expansion involving these mtDNA lineages [67]. Our results indicate that there is no clear segregation between ponds. Indeed, COI and Cytb reveal the existence of two genetic groups detected from the bimodal distributions. The second hypothesis is more plausible. It is known that in organisms, patterns of genetic structure and levels of gene flow among sets can be influenced by water’s physicochemical parameters, such as temperature and salinity [66,68,69]. In our sites, the effect of the increasing salinity in the salterns of Sfax does not have any impact on the levels of gene flow in P. grani populations.

5. Conclusions

Due to the morphological complexity of the taxonomic characters in the copepod infraclass group, subdivisions and phylogenies have been complex and problematic. All of the studied orders were found to be polyphyletic. Phylogeny does not align with some previously published studies, likely due to markedly high divergences between species. Our results give additional new data concerning phylogenies, but further studies are needed. Our findings provide clear evidence of minimal genetic differentiation based on mitochondrial COI and Cytb sequence variations among the P. grani population from A5 and A16. These results support a scenario of high gene flow, which explains the lack of genetic structuring. Sympatric populations may be considered in the two studied ponds, and, in this case, the beginning of a speciation event could explain the present distribution patterns.

Author Contributions

Conceptualization, F.D. and G.N.H.; methodology, C.L., N.A.-T. and F.D.; software, C.L. and F.D.; validation, F.D. and N.C.; formal analysis, C.L. and F.D.; investigation, C.L. and F.D.; resources, C.L., F.D., H.A. and N.C.; data curation, C.L. and F.D.; writing—original draft preparation, C.L. and F.D.; writing—review and editing, W.G., G.N.H. and N.A.-T.; visualization, C.L. and F.D.; supervision, N.C., F.D. and H.A.; project administration, F.D., N.C. and H.A.; funding acquisition F.D., N.C. and H.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within the article. The representatives sequences of copepods are deposited on the EMBL-EBI site accessible via the European Nucleotide Bank archive Data interface (Project number EPR165474).

Acknowledgments

The authors wish to thank Stephane Gasparini (from the University of Pierre and Marie Curie—Paris 6, France) and Danielle Defaye (from the Natural History Mmuseum—Paris 6, France) for helping us to confirm the morphological identification of copepods. We are grateful to the staff of the company of the saline of Sfax MARE Alb.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, H.; Hopcroft, R.R.; Bi, H. Statistical Modeling of Copepod Growth Rates: Comparisons for Data Collections Using the Artificial Cohort (AC) Method. J. Exp. Mar. Biol. Ecol. 2013, 448, 271–280. [Google Scholar] [CrossRef]
  2. Dur, G.; Jiménez-Melero, R.; Beyrend-Dur, D.; Hwang, J.-S.; Souissi, S. Individual-Based Model of the Phenology of Egg-Bearing Copepods: Application to Eurytemora Affinis from the Seine Estuary, France. Ecol. Model. 2013, 269, 21–36. [Google Scholar] [CrossRef]
  3. Kobbi-Rebai, R.; Annabi-Trabelsi, N.; Khemakhem, H.; Ayadi, H.; Aleya, L. Impacts of Restoration of an Uncontrolled Phosphogypsum Dumpsite on the Seasonal Distribution of Abiotic Variables, Phytoplankton, Copepods, and Ciliates in a Man-Made Solar Saltern. Environ. Monit. Assess. 2013, 185, 2139–2155. [Google Scholar] [CrossRef] [PubMed]
  4. Ladhar, C.; Tastard, E.; Casse, N.; Denis, F.; Ayadi, H. Strong and Stable Environmental Structuring of the Zooplankton Communities in Interconnected Salt Ponds. Hydrobiologia 2015, 743, 1–13. [Google Scholar] [CrossRef]
  5. Hotos, G.N. A Preliminary Survey on the Planktonic Biota in a Hypersaline Pond of Messolonghi Saltworks (W. Greece). Diversity 2021, 13, 270. [Google Scholar] [CrossRef]
  6. Annabi-Trabelsi, N.; Rebai, R.K.; Ali, M.; Subrahmanyam, M.N.V.; Belmonte, G.; Ayadi, H. Egg Production and Hatching Success of Paracartia grani (Copepoda, Calanoida, Acartiidae) in Two Hypersaline Ponds of a Tunisian Solar Saltern. J. Sea Res. 2018, 134, 1–9. [Google Scholar] [CrossRef]
  7. Ki, J.-S.; Park, H.G.; Lee, J.-S. The Complete Mitochondrial Genome of the Cyclopoid Copepod Paracyclopina Nana: A Highly Divergent Genome with Novel Gene Order and Atypical Gene Numbers. Gene 2009, 435, 13–22. [Google Scholar] [CrossRef]
  8. Mauchline, J. Adv. Mar. Biol. 33: The Biology of Calanoid Copepods; Academic Press: Cambridge, MA, USA, 1998; ISBN 0-12-026133-2. [Google Scholar]
  9. Humes, A.G. How Many Copepods? Hydrobiologia 1994, 292–293, 1–7. [Google Scholar] [CrossRef]
  10. Machida, R.J.; Miya, M.U.; Nishida, M.; Nishida, S. Complete Mitochondrial DNA Sequence of Tigriopus Japonicus (Crustacea: Copepoda). Mar. Biotechnol. 2002, 4, 406–417. [Google Scholar] [CrossRef]
  11. Xu, H.; Zhang, Y.; Xu, D.; Lou, B.; Guo, Y.; Sun, X.; Guo, B. Genetic Population Structure of Miiuy Croaker (Miichthys miiuy) in the Yellow and East China Seas Base on Mitochondrial COI Sequences. Biochem. Syst. Ecol. 2014, 54, 240–246. [Google Scholar] [CrossRef]
  12. Böttger-Schnack, R.; Machida, R.J. Comparison of Morphological and Molecular Traits for Species Identification and Taxonomic Grouping of Oncaeid Copepods. Hydrobiologia 2011, 666, 111–125. [Google Scholar] [CrossRef]
  13. Cepeda, G.D.; Blanco-Bercial, L.; Bucklin, A.; Berón, C.M.; Viñas, M.D. Molecular Systematic of Three Species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: Comparative Analysis Using 28S rDNA. PLoS ONE 2012, 7, e35861. [Google Scholar] [CrossRef]
  14. Mishler, B.D. The Morphological, Developmental, and Phylogenetic Basis of Species Concepts in Bryophytes. Bryologist 1985, 88, 207–214. [Google Scholar] [CrossRef]
  15. Jung, S.-O.; Lee, Y.-M.; Park, T.-J.; Park, H.G.; Hagiwara, A.; Leung, K.M.Y.; Dahms, H.-U.; Lee, W.; Lee, J.-S. The Complete Mitochondrial Genome of the Intertidal Copepod Tigriopus sp. (Copepoda, Harpactidae) from Korea and Phylogenetic Considerations. J. Exp. Mar. Biol. Ecol. 2006, 333, 251–262. [Google Scholar] [CrossRef]
  16. Chullasorn, S.; Kangtia, P.; Song, S.J.; Khim, J.S. Two New Species of Tigriopus Norman, 1869 from Chonburi Province, Thailand (Crustacea: Copepoda: Harpacticidae). Zootaxa 2021, 5051, 41–67. [Google Scholar] [CrossRef]
  17. Rossel, S.; Martínez Arbizu, P. Revealing Higher than Expected Diversity of Harpacticoida (Crustacea:Copepoda) in the North Sea Using MALDI-TOF MS and Molecular Barcoding. Sci. Rep. 2019, 9, 9182. [Google Scholar] [CrossRef] [PubMed]
  18. Sepahvand, V.; Shahabi, S. First Molecular Evidence for Two New Associate Copepods of Genus Clausidium Kossmann, 1874 (Copepoda: Cyclopoida: Clausidiidae) from the Persian Gulf and Gulf of Oman. Nauplius 2021, 29, e2021019. [Google Scholar] [CrossRef]
  19. Radhika, R.; Bijoy Nandan, S.; Harikrishnan, M. Morphological and Molecular Identification of Marine Copepod Dioithona Rigida Giesbrecht, 1896 (Crustacea:Cyclopoida) Based on Mitochondrial COI Gene Sequences, from Lakshadweep Sea, India. Mitochondrial DNA Part A 2017, 28, 872–879. [Google Scholar] [CrossRef] [PubMed]
  20. Blanco-Bercial, L.; Bradford-Grieve, J.; Bucklin, A. Molecular Phylogeny of the Calanoida (Crustacea: Copepoda). Mol. Phylogenetics Evol. 2011, 59, 103–113. [Google Scholar] [CrossRef]
  21. Kasapidis, P.; Siokou, I.; Khelifi-Touhami, M.; Mazzocchi, M.G.; Matthaiaki, M.; Christou, E.; Fernandez De Puelles, M.L.; Gubanova, A.; Di Capua, I.; Batziakas, S.; et al. Revising the Taxonomic Status and Distribution of the Paracalanus Parvus Species Complex (Copepoda, Calanoida) in the Mediterranean and Black Seas through an Integrated Analysis of Morphology and Molecular Taxonomy. J. Plankton Res. 2018, 40, 595–605. [Google Scholar] [CrossRef]
  22. Sukhikh, N.; Abramova, E.; Holl, A.-C.; Souissi, S.; Alekseev, V. A Comparative Analysis of Genetic Differentiation of the E. Affinis Species Complex and Some Other Eurytemora Species, Using the CO1, nITS and 18SrRNA Genes (Copepoda, Calanoida). Crustaceana 2020, 93, 931–955. [Google Scholar] [CrossRef]
  23. Miyamoto, H.; Machida, R.J.; Nishida, S. Genetic Diversity and Cryptic Speciation of the Deep Sea Chaetognath Caecosagitta Macrocephala (Fowler, 1904). Deep Sea Res. Part II Top. Stud. Oceanogr. 2010, 57, 2211–2219. [Google Scholar] [CrossRef]
  24. Chen, G.; Hare, M.P. Cryptic Diversity and Comparative Phylogeography of the Estuarine Copepod Acartia Tonsa on the US Atlantic Coast: PHYLOGEOGRAPHY of ACARTIA TONSA. Mol. Ecol. 2011, 20, 2425–2441. [Google Scholar] [CrossRef]
  25. Wyngaard, G.A.; Hołyńska, M.; Schulte, J.A. Phylogeny of the Freshwater Copepod Mesocyclops (Crustacea: Cyclopidae) Based on Combined Molecular and Morphological Data, with Notes on Biogeography. Mol. Phylogenetics Evol. 2010, 55, 753–764. [Google Scholar] [CrossRef]
  26. González, C.E.; Goetze, E.; Escribano, R.; Ulloa, O.; Victoriano, P. Genetic Diversity and Novel Lineages in the Cosmopolitan Copepod Pleuromamma Abdominalis in the Southeast Pacific. Sci. Rep. 2020, 10, 1115. [Google Scholar] [CrossRef] [PubMed]
  27. Bucklin, A.; Frost, B.; Bradford-Grieve, J.; Allen, L.; Copley, N. Molecular Systematic and Phylogenetic Assessment of 34 Calanoid Copepod Species of the Calanidae and Clausocalanidae. Mar. Biol. 2003, 142, 333–343. [Google Scholar] [CrossRef]
  28. Dippenaar, S.M.; Mathibela, R.B.; Bloomer, P. Cytochrome Oxidase I Sequences Reveal Possible Cryptic Diversity in the Cosmopolitan Symbiotic Copepod Nesippus Orientalis Heller, 1868 (Pandaridae: Siphonostomatoida) on Elasmobranch Hosts from the KwaZulu-Natal Coast of South Africa. Exp. Parasitol. 2010, 125, 42–50. [Google Scholar] [CrossRef]
  29. Bernot, J.P.; Boxshall, G.A.; Crandall, K.A. A Synthesis Tree of the Copepoda: Integrating Phylogenetic and Taxonomic Data Reveals Multiple Origins of Parasitism. PeerJ 2021, 9, e12034. [Google Scholar] [CrossRef]
  30. Nawaz, M.A.; Baskar, G.; Meenakshi, S.V.; Saboor, A.; Sivakumar, K. Phylogenetic Relationship of Marine Calanoid Copepods (Crustacea: Maxillopoda) Based on Morphological and Molecular Datasets from the Chennai Coast, Bay of Bengal. Thalassas 2024, 40, 31–42. [Google Scholar] [CrossRef]
  31. Rose, M. Faune de France. 26 Copépodes Pélagiques; Lechevallier: Paris, France, 1933. [Google Scholar]
  32. Bradford-Grieve, J. Pelagic Ecosystem Structure and Functioning in the Subtropical Front Region East of New Zealand in Austral Winter and Spring 1993. J. Plankton Res. 1999, 21, 405–428. [Google Scholar] [CrossRef]
  33. Boxshall, G.A.; Halsey, S.H. An Introduction to Copepod Diversity; Ray Society: London, UK, 2004; ISBN 0-903874-31-8. [Google Scholar]
  34. Todd, C.D.; Laverack, M.S.; Boxshall, G.A. Coastal Marine Zooplankton: A Practical Manual for Students, 2nd ed.; Cambridge University Press: Cambridge, UK; New York, NY, USA, 1996; ISBN 978-0-521-55533-3. [Google Scholar]
  35. Böttger-Schnack, R.; Schnack, D. Definition of Species Groups of Oncaeidae (Copepoda: Cyclopoida) as Basis for a Worldwide Identification Key. J. Nat. Hist. 2013, 47, 265–288. [Google Scholar] [CrossRef]
  36. Razouls, C.; Desreumaux, N.; Kouwenberg, J.; de Bovée, F. Biodiversity of Marine Planktonic Copepods (Morphology, Geographical Distribution and Biological Data); Sorbonne University, CNRS: Paris, France, 2005. [Google Scholar]
  37. Hermann, D. Caractérisation D’éléments Transposables de Type Mariner Chez Les Microalgues Marines; Université du Maine: Le Mans, France, 2011. [Google Scholar]
  38. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  39. Merritt, T.J.S.; Shi, L.; Chase, M.C.; Rex, M.A.; Etter, R.J.; Quattro, J.M. Universal Cytochrome b Primers Facilitate Intraspecific Studies in Molluscan Taxa. Mol. Mar. Biol. Biotechnol. 1998, 7, 7–11. [Google Scholar] [PubMed]
  40. Chenna, R. Multiple Sequence Alignment with the Clustal Series of Programs. Nucleic Acids Res. 2003, 31, 3497–3500. [Google Scholar] [CrossRef]
  41. Schneider, S.; Roessli, D.; Excoffier, L. Arlequin Ver. 2.000. A Software for Population Genetics Data Analysis; Genetics and Biometry Laboratory, University of Geneva: Geneva, Switzerland, 2000. [Google Scholar]
  42. Schwentner, M.; Timms, B.V.; Bastrop, R.; Richter, S. Phylogeny of Spinicaudata (Branchiopoda, Crustacea) Based on Three Molecular Markers—An Australian Origin for Limnadopsis. Mol. Phylogenetics Evol. 2009, 53, 716–725. [Google Scholar] [CrossRef]
  43. Williams, S.T.; Donald, K.M.; Spencer, H.G.; Nakano, T. Molecular Systematics of the Marine Gastropod Families Trochidae and Calliostomatidae (Mollusca: Superfamily Trochoidea). Mol. Phylogenetics Evol. 2010, 54, 783–809. [Google Scholar] [CrossRef]
  44. Sabroux, R.; Corbari, L.; Hassanin, A. Phylogeny of Sea Spiders (Arthropoda: Pycnogonida) Inferred from Mitochondrial Genome and 18S Ribosomal RNA Gene Sequences. Mol. Phylogenetics Evol. 2023, 182, 107726. [Google Scholar] [CrossRef]
  45. Watanabe, T.; Hirai, J.; Sildever, S.; Tadokoro, K.; Hidaka, K.; Tanita, I.; Nishiuchi, K.; Iguchi, N.; Kasai, H.; Nishi, N.; et al. Improving Taxonomic Classification of Marine Zooplankton by Molecular Approach: Registration of Taxonomically Verified 18S and 28S rRNA Gene Sequences. PeerJ 2023, 11, e15427. [Google Scholar] [CrossRef]
  46. Laakmann, S.; Auel, H.; Kochzius, M. Evolution in the Deep Sea: Biological Traits, Ecology and Phylogenetics of Pelagic Copepods. Mol. Phylogenetics Evol. 2012, 65, 535–546. [Google Scholar] [CrossRef]
  47. Questel, J.M.; Hopcroft, R.R.; DeHart, H.M.; Smoot, C.A.; Kosobokova, K.N.; Bucklin, A. Metabarcoding of Zooplankton Diversity within the Chukchi Borderland, Arctic Ocean: Improved Resolution from Multi-Gene Markers and Region-Specific DNA Databases. Mar. Biodivers. 2021, 51, 4. [Google Scholar] [CrossRef]
  48. Wu, S.; Xiong, J.; Yu, Y. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda. PLoS ONE 2015, 10, e0131498. [Google Scholar] [CrossRef] [PubMed]
  49. Matthews, S.A.; Goetze, E.; Ohman, M.D. Recommendations for Interpreting Zooplankton Metabarcoding and Integrating Molecular Methods with Morphological Analyses. ICES J. Mar. Sci. 2021, 78, 3387–3396. [Google Scholar] [CrossRef]
  50. Minxiao, W.; Song, S.; Chaolun, L.; Xin, S. Distinctive Mitochondrial Genome of Calanoid Copepod Calanus Sinicus with Multiple Large Non-Coding Regions and Reshuffled Gene Order: Useful Molecular Markers for Phylogenetic and Population Studies. BMC Genom. 2011, 12, 73. [Google Scholar] [CrossRef] [PubMed]
  51. Machida, R.J.; Miya, M.U.; Nishida, M.; Nishida, S. Molecular Phylogeny and Evolution of the Pelagic Copepod Genus Neocalanus (Crustacea: Copepoda). Mar. Biol. 2006, 148, 1071–1079. [Google Scholar] [CrossRef]
  52. Cornils, A.; Held, C. Evidence of Cryptic and Pseudocryptic Speciation in the Paracalanus Parvus Species Complex (Crustacea, Copepoda, Calanoida). Front. Zool. 2014, 11, 19. [Google Scholar] [CrossRef]
  53. Khodami, S.; Mercado-Salas, N.F.; Tang, D.; Martinez Arbizu, P. Molecular Evidence for the Retention of the Thaumatopsyllidae in the Order Cyclopoida (Copepoda) and Establishment of Four Suborders and Two Families within the Cyclopoida. Mol. Phylogenetics Evol. 2019, 138, 43–52. [Google Scholar] [CrossRef]
  54. Adamowicz, S.J.; Menu-Marque, S.; Halse, S.A.; Topan, J.C.; Zemlak, T.S.; Hebert, P.D.N.; Witt, J.D.S. The Evolutionary Diversification of the Centropagidae (Crustacea, Calanoida): A History of Habitat Shifts. Mol. Phylogenetics Evol. 2010, 55, 418–430. [Google Scholar] [CrossRef] [PubMed]
  55. Bradford-Grieve, J.M.; Boxshall, G.A.; Ahyong, S.T.; Ohtsuka, S. Cladistic Analysis of the Calanoid Copepoda. Invertebr. Syst. 2010, 24, 291. [Google Scholar] [CrossRef]
  56. Huys, R.; Mackenzie-Dodds, J.; Llewellyn-Hughes, J. Cancrincolidae (Copepoda, Harpacticoida) Associated with Land Crabs: A Semiterrestrial Leaf of the Ameirid Tree. Mol. Phylogenetics Evol. 2009, 51, 143–156. [Google Scholar] [CrossRef]
  57. Ki, J.-S.; Park, H.G.; Lee, J.-S. Extensive Analysis of Nuclear Cistron rDNA Sequence of Paracyclopina Nana (Cyclopoida: Cyclopettidae). Hydrobiologia 2011, 666, 3–9. [Google Scholar] [CrossRef]
  58. Avise, J.C. Phylogeography: The History and Formation of Species; Harvard University Press: Cambridge, MA, USA, 2000; ISBN 0-674-66638-0. [Google Scholar]
  59. Song, J.; Hou, F.; Zhang, X.; Yue, B.; Song, Z. Mitochondrial Genetic Diversity and Population Structure of a Vulnerable Freshwater Fish, Rock Carp (Procypris Rabaudi) in Upper Yangtze River Drainage. Biochem. Syst. Ecol. 2014, 55, 1–9. [Google Scholar] [CrossRef]
  60. Bu, X.; Liu, L.; Nie, L. Genetic Diversity and Population Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus Sinensis) in Three Geographical Populations. Biochem. Syst. Ecol. 2014, 54, 279–284. [Google Scholar] [CrossRef]
  61. Bucklin, A. Population Genetics of Drifting (Calanus Spp.) and Resident (Acartia Clausi) Plankton in Norwegian Fjords. J. Plankton Res. 2000, 22, 1237–1251. [Google Scholar] [CrossRef]
  62. Makino, W.; Knox, M.A.; Duggan, I.C. Invasion, Genetic Variation and Species Identity of the Calanoid Copepod Sinodiaptomus Valkanovi. Freshw. Biol. 2010, 55, 375–386. [Google Scholar] [CrossRef]
  63. Hartl, D.L.; Clark, A.G.; Clark, A.G. Principles of Population Genetics; Sinauer Associates: Sunderland, MA, USA, 1997; Volume 116. [Google Scholar]
  64. Pannacciulli, F.G.; Manetti, G.; Maltagliati, F. Genetic Diversity in Two Barnacle Species, Chthamalus Stellatus and Tesseropora Atlantica (Crustacea, Cirripedia), with Different Larval Dispersal Modes in the Archipelago of the Azores. Mar. Biol. 2009, 156, 2441–2450. [Google Scholar] [CrossRef]
  65. Unal, E.; Bucklin, A. Basin-Scale Population Genetic Structure of the Planktonic Copepod Calanus Finmarchicus in the North Atlantic Ocean. Prog. Oceanogr. 2010, 87, 175–185. [Google Scholar] [CrossRef]
  66. De Aranzamendi, M.C.; Bastida, R.; Gardenal, C.N. Genetic Population Structure in Nacella Magellanica: Evidence of Rapid Range Expansion throughout the Entire Species Distribution on the Atlantic Coast. J. Exp. Mar. Biol. Ecol. 2014, 460, 53–61. [Google Scholar] [CrossRef]
  67. Zlojutro, M.; Rubicz, R.; Devor, E.J.; Spitsyn, V.A.; Makarov, S.V.; Wilson, K.; Crawford, M.H. Genetic Structure of the Aleuts and Circumpolar Populations Based on Mitochondrial DNA Sequences: A Synthesis. Am. J. Phys. Anthr. 2006, 129, 446–464. [Google Scholar] [CrossRef]
  68. Grosberg, R.; Cunningham, C.W. Genetic Structure in the Sea: From Populations to Communities. In Marine Community Ecology; Sinauer Associates: Sunderland, MA, USA, 2001; pp. 61–84. [Google Scholar]
  69. Wares, J.P.; Gaines, S.D.; Cunningham, C.W. A Comparative Study of Asymmetric Migration Events across a Marine Biogeographic Boundary. Evolution 2001, 55, 295–306. [Google Scholar] [CrossRef]
Figure 1. Location of the sampled ponds (A5, A16, C41, and M2) in the solar salterns of Sfax. Arrows indicate the direction of the water flow in the salterns.
Figure 1. Location of the sampled ponds (A5, A16, C41, and M2) in the solar salterns of Sfax. Arrows indicate the direction of the water flow in the salterns.
Diversity 16 00751 g001
Figure 2. Phylogenetic analysis of nuclear ribosomal 18S sequence variation for copepods sampled from the solar saltern of Sfax and those available in GenBank. The gene tree was reconstructed using the ML algorithm and bootstrapped × 1000. Numbers along tree branches are bootstrap values (i.e., percentage of trees among 1000 sub-replicates exhibiting that branch point). Empty symbols correspond to the different sequences available in GenBank.
Figure 2. Phylogenetic analysis of nuclear ribosomal 18S sequence variation for copepods sampled from the solar saltern of Sfax and those available in GenBank. The gene tree was reconstructed using the ML algorithm and bootstrapped × 1000. Numbers along tree branches are bootstrap values (i.e., percentage of trees among 1000 sub-replicates exhibiting that branch point). Empty symbols correspond to the different sequences available in GenBank.
Diversity 16 00751 g002
Figure 3. Network graphic constructed with COI with color-coded nodes: blue for P. grani sampled from A5 and pink for P. grani sampled from A16.
Figure 3. Network graphic constructed with COI with color-coded nodes: blue for P. grani sampled from A5 and pink for P. grani sampled from A16.
Diversity 16 00751 g003
Figure 4. Calculating genetic distances in network’s mismatch distribution tool with COI for P. grani sampled from A5 and A16.
Figure 4. Calculating genetic distances in network’s mismatch distribution tool with COI for P. grani sampled from A5 and A16.
Diversity 16 00751 g004
Figure 5. Network graphic constructed with Cytb with color-coded nodes: green for P. grani sampled from A5 and orange for P. grani sampled from A16.
Figure 5. Network graphic constructed with Cytb with color-coded nodes: green for P. grani sampled from A5 and orange for P. grani sampled from A16.
Diversity 16 00751 g005
Figure 6. Calculating genetic distances in network’s mismatch distribution tool with Cytb for P. grani sampled from A5 and A16.
Figure 6. Calculating genetic distances in network’s mismatch distribution tool with Cytb for P. grani sampled from A5 and A16.
Diversity 16 00751 g006
Table 1. PCR and sequencing primer names and sequences; lengths of the PCR product for this study; annealing temperature (AT). Abbreviations are as follows: forward primer (F); reverse primer (R); base pairs (bp).
Table 1. PCR and sequencing primer names and sequences; lengths of the PCR product for this study; annealing temperature (AT). Abbreviations are as follows: forward primer (F); reverse primer (R); base pairs (bp).
GenePrimer Name, SequenceSize (bp)AT (°C)
18SRib1 (F), GGGGGAGTATGGTCGCAAGGC [37]~40060
Rib2 (R), TCAGTGTAGCGCGCGTGCGGC [37]
COILCO1490 (F), GGTCAACAAATCATAAAGATATTGG [38]~65040
HCO2198 (R), TAAACTTCAGGGTGACCAAAAAATCA [38]
CytbUCYTB151F, TGTGGRGCNACYGTWATYACTAA [39]~40042
UCYTB270R, AANAGGAARTAYCAYTCNGGYTG [39]
Table 2. List of species with their localization and GenBank Accession numbers for 18S.
Table 2. List of species with their localization and GenBank Accession numbers for 18S.
OrdreSpeciesLocalizationAccession Numbers in GenBank
CalanoidaAcartia longiremisSwedenGU969156
Acartia pacificaNot definedGU969157
Acartia negligensNot definedGU969198
Acartia danaeNot definedGU969197
Acartia hongiNot definedGU969195
Acartia omoriiNot definedGU969196
Acartia tonsa 1USAGU350740
Acartia tonsa 2USAGU350741
Acartia tonsa 3USAFJ422281
CyclopoidaOithona sp. 1USAGU594643
Oithona sp. 2New CaledoniaJF781540
Oithona sp. 3New CaledoniaJF781539
Oithona nanaBrazilHQ008734
Paracyclopina nanaKoreaFJ214952
Oithona simplexBrazilHQ008735
Oithona hebesBrazilHQ008733
Dioithona oculataBelizeHQ008732
Oithona similisNot definedGU969179
HarpacticoidaNitocra sp.Not definedJX438707
Attheyella crassaEnglandEU380307
Itunella muelleriIcelandEU380309
Mesochra rapiensSwedenEU380308
Tisbe sp.USAFJ713566
Table 3. Distribution, taxon, and individual number of copepod samples utilized for phylogenetic analyses. Order assignations.
Table 3. Distribution, taxon, and individual number of copepod samples utilized for phylogenetic analyses. Order assignations.
OrderSpeciesSampling PondsIndividual Number
CyclopoidaOithona similisA53
Oithona nanaA55
CalanoidaParacartia graniA164
HarpacticoidaClytemnestra scutellataA53
Table 4. Genetic diversity of Paracartia grani sampled from A5 and A16 with COI and Cytb genes.
Table 4. Genetic diversity of Paracartia grani sampled from A5 and A16 with COI and Cytb genes.
P. grani
COICytb
A5A16A5 and A16A5A16A5 and A16
N20264691423
Nhap12112191423
Nsipol422552273946
Hd0.05000.03850.02170.1110.07140.0435
π0.01220.00760.00960.02770.02830.0293
Pd7.9215.0926.31111.30612.92312.545
Fst 0 0.04007
N: number of sequenced individuals; Nhap = number of haplotypes; Nsipol= number of polymorphic sites; Hd = haplotype diversity; π = nucleotide diversity; Pd: mean of pairwise differences; Fst = fixation index.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ladhar, C.; Denis, F.; Guermazi, W.; Annabi-Trabelsi, N.; Casse, N.; Ayadi, H.; Hotos, G.N. Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity 2024, 16, 751. https://doi.org/10.3390/d16120751

AMA Style

Ladhar C, Denis F, Guermazi W, Annabi-Trabelsi N, Casse N, Ayadi H, Hotos GN. Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity. 2024; 16(12):751. https://doi.org/10.3390/d16120751

Chicago/Turabian Style

Ladhar, Chiraz, Françoise Denis, Wassim Guermazi, Neila Annabi-Trabelsi, Nathalie Casse, Habib Ayadi, and George N. Hotos. 2024. "Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences" Diversity 16, no. 12: 751. https://doi.org/10.3390/d16120751

APA Style

Ladhar, C., Denis, F., Guermazi, W., Annabi-Trabelsi, N., Casse, N., Ayadi, H., & Hotos, G. N. (2024). Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity, 16(12), 751. https://doi.org/10.3390/d16120751

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop