Next Article in Journal
The Terebrantia (Insecta: Thysanoptera) of the Maltese Islands
Next Article in Special Issue
Description of Cylindrospermum solincola sp. nov. from Jammu and Kashmir, India and Further Insights into the Ecological Distribution and Morphological Attributes of Cylindrospermum badium
Previous Article in Journal
Epiphytic Diatoms from the Central Region of the Gulf of California: Floristics and Biogeographic Remarks
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Description of Neochlorella semenenkoi gen. et. sp. nov. (Chlorophyta, Trebouxiophyceae), a Novel Chlorella-like Alga with High Biotechnological Potential

by
Elena S. Krivina
1,†,
Lidia A. Bobrovnikova
2,3,†,
Anna D. Temraleeva
1,
Alexandra G. Markelova
2,
David A. Gabrielyan
2 and
Maria A. Sinetova
2,*
1
Federal Research Center “Pushchino Scientific Center for Biological Research of the Russian Academy of Sciences”, Prosp. Nauki, 3, Pushchino 142290, Russia
2
K.A. Timiryazev Institute of Plant Physiology of the Russian Academy of Sciences, Botanicheskaya Str. 35, Moscow 127276, Russia
3
Department of Agricultural Biotechnology, Hungarian University of Agriculture and Life Sciences (MATE), 2100 Godollo, Hungary
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Diversity 2023, 15(4), 513; https://doi.org/10.3390/d15040513
Submission received: 3 December 2022 / Revised: 18 March 2023 / Accepted: 29 March 2023 / Published: 3 April 2023
(This article belongs to the Special Issue The Phylogenetic Diversity of Cyanobacteria and Algae)

Abstract

Despite many publications about Chlorella-like algae, their reliable and accurate identification is still difficult due to their simplicity and high phenotypic plasticity. The molecular approach has revolutionized our understanding of the diversity of ’small green balls’, and a natural classification of this group is currently being developed. This work is aimed at providing a detailed study of the phylogenetic position, morphology, ultrastructure, and physiology of the biotechnologically remarkable Chlorella-like strain IPPAS C-1210. Based on the SSU–ITS1–5.8S–ITS2 phylogeny, genetic distances, and the presence of compensatory base changes (CBCs) in ITS1 and conserved regions of ITS2 secondary structures, we describe a new genus, Neochlorella, with IPPAS C-1210 as the authentic strain of the type species, N. semenenkoi gen. and sp. nov. In addition, we justify the reassignment of the strain C. thermophila ITBB HTA 1–65 into N. thermophila comb. nov. The distinctive ultrastructural and physiological traits of the new species are discussed.

1. Introduction

The genus Chlorella was described by M.W. Beijerinck in 1890 [1], and initially, it included unicellular coccoid green algae with cells of spherical, oval, or wide-oval shape, without bristles, less than 10 μm in size, which reproduce by autospores, and which are mainly aquatic inhabitants. In this regard, for a long time, all the so-called ‘small green balls’ with Chlorella-like morphology were attributed to this genus. Subsequently, more detailed studies of the biochemical, ultrastructural, and genetic characteristics of Chlorella-like strains revealed their heterogeneity, and, therefore, the genus Chlorella underwent several revisions. First, based on the differences in the nucleotide sequences of the 18S rRNA gene and the ITS2 spacer, Krienitz et al. [2] isolated C. kessleri into a separate genus Parachlorella. A year later, the separation of the Chlorella and Parachlorella clades was confirmed by studies of ultrastructure and synthesis of autospore cell walls [3]. Then, Luo et al. [4] summarized the available data on Chlorella molecular genetics, morphology, and ontogenesis and proposed a new concept of the Chlorella clade. According to their proposal, besides the archetype, the Chlorella clade included several genera with different morphologies: Actinastrum, Didymogenes, Hegewaldia, Meyerella, and Micractinium. Revision by Pröschold et al. [5] identified two new Dictyosphaerium-like genera, Hindakia and Heynigia (colonies up to 64-celled connected via mucilaginous stalks), belonging to the Chlorella clade. Then, Bock et al. [6] described five species with classic Chlorella-like morphotype (C. volutis, C. elongata, C. rotunda, C. lewinii, and C. singularis), and four Dictyosphaerium-like species that, however, were assigned to the genus Chlorella (C. pituita, C. pulchelloides, C. chlorelloides, and C. coloniales). In subsequent studies, a number of new taxa belonging to the Chlorella clade were discovered: C. thermophila [7], genus Carolibrandtia [8,9], Micractinium singularis, M. variabile, M. simplicissimum [10], and M. kostikovii [11].
Although Chlorella-like algae have been studied for more than 130 years, their reliable and accurate identification is still difficult due to the simplicity and high phenotypic plasticity of their morphological properties. Though the molecular approach has revolutionized the understanding of the diversity of ‘small green balls’, a natural classification of this group is currently being developed. Nevertheless, many taxonomically problematic groups in the Chlorella clade require detailed investigation [12]. For example, besides the high diversity of the Chlorella clade itself, recent studies have shown that, in its present state, the genus Chlorella includes misidentified strains that actually belong to other independent genera [7,12,13,14]. Thereby, the issue of correct genera and species delimitation and identification in the Chlorella clade is of great importance.
The study of Chlorella clade representatives has not only theoretical but also practical significance. In 1919, the German cell physiologist and future Nobel laureate, O.H. Warburg, began to use a pure laboratory culture of Chlorella in his study of photosynthesis [15]. Since that time, Chlorella-like strains have been widely used as model organisms in plant physiological and biochemical studies due to their simple morphology and life cycle, fast growth in a wide range of growth conditions, and moderate nutritional requirements [16]. High biomass productivity, metabolic plasticity, and ability to produce high amounts of proteins, lipids, carotenoids, polysaccharides, and vitamins have made Chlorella-like strains the most cultivated eukaryotic microalgae for biofuel production and for the nutraceutical or pharmaceutical industries [17,18,19].
Like many strains from the Chlorella clade, the strain IPPAS C-1210, which is being studied here, is characterized by a high growth rate; in the exponential phase, its biomass is rich in protein and chlorophyll, while in the stationary phase, it contains mainly carbohydrates and lipids [20]. This work aimed at providing a detailed study of the phylogenetic position, morphology, ultrastructure, and physiology of this biotechnologically promising Chlorella-like strain, with a description of a new genus and species.

2. Materials and Methods

2.1. Isolation and Cultivation of Algal Strain

The strain IPPAS C-1210 was isolated in 2013 from the freshwater Issyk Lake in Trans-Ili Alatau, Kazakhstan (43°15′11″ N, 77°29′05″ E), by the enrichment culture technique and then purified to an axenic status using standard methods [21]. The strain was maintained either on agarized BG-11 medium [22] at 22 °C in a 12:12 h light/dark regime under illumination of 30 μmol photons m−2 s−1, or on agarized BBM-3N medium [21] at 22 °C under continuous illumination of 30 μmol photons m−2 s−1.
The strain IPPAS C-1210 was deposited at the collection of microalgae and cyanobacteria IPPAS of the K.A. Timiryazev Institute of Plant Physiology, Russian Academy of Sciences (RAS) (http://cellreg.org/Catalog/, accessed on 3 December 2022), and at the Algal Collection ACSSI of the Institute of Physicochemical and Biological Problems in Soil Science, RAS (http://acssi.org/ accessed on 3 December 2022), under number 342.

2.2. Light and Electron Microscopy

To test the phenotypic plasticity, the strain IPPAS C-1210 was grown in different media and under different cultivation conditions, as listed in Table 1: maintenance conditions (1), intensive cultivation conditions (2), and cultivation in liquid TAP medium [23] for comparison with the morphometric data obtained for C. thermophila ITBB HTA 1–65 by Ma et al. [7] (3).
Morphology and life cycles were observed using a Carl Zeiss Axio Scope A1 microscope (Oberkochen, Germany) in the Collective Use Center, Institute of Physicochemical and Biological Problems in Soil Science, RAS. The results were documented using drawings and photographs obtained with a Carl Zeiss MRc 5 color digital camera (Germany). As an alternative, a Carl Zeiss Axio Imager D1 microscope with an AxioCam MRc camera (Germany) was used.
The morphology was described according to Komárek and Fott [24] and Andreyeva [25].
Transmission electron microscopy (TEM) was performed using a TEM Libra-120 (Carl Zeiss, Germany) as described previously [26]. For TEM analysis, the culture was grown as described in Table 1, line 2. The samples were taken on the third and ninth days (exponential and stationary phase, respectively).

2.3. Grazing Test

Cultures of phycophages Paramecium caudatum, Daphnia pulex, Philodina acuticornis, and Brachionus rotundiformis were used during the biotests to stimulate the development of bristles as described previously with some modifications [27]. To study the effect of the metabolites released by these predators into the culture medium, the medium with predators (500 individuals per ml) was filtered through a 0.2 µm PTFE filter. Then, 5 mL of the filtrate was added to 25 mL of IPPAS C-1210 culture grown in BG-11 medium. To study the direct effect of phycophages, 5 mL of the predator culture was added to 25 mL of IPPAS C-1210 culture grown in BG-11 medium. In the case of the test with Brachionus rotundiformis, the modified medium BG-11 with 25 g/L of NaCl was used [27]. The IPPAS C-1210 culture grown in standard BG-11 medium was used as a control. The density of the algal culture was at least 1.5 × 105 cells mL−1. The cultures were shaken very gently by hand for 5 s twice a day. The development of bristles was examined at 24 h, 48 h, and 72 h following culturing using a light microscope. The test was performed on three replicates per exposure condition and control.

2.4. DNA Isolation and Sequencing

Total genomic DNA was isolated from algal cells using the GenEluteTM PlantGenomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol. Amplification was carried out with the GenAmp 2720 machine (Life Technologies, Grand Island, NY, USA) using Hot Start Taq polymerase (Syntol, Moscow, Russia). The primers and conditions for the SSU and ITS1-5.8S-ITS2 amplification are listed in Table 2. All primers were synthesized by Evrogen (Evrogen JSC, Moscow, Russia). Amplified partial SSU and ITS1-5.8S-ITS2 fragments were separated by agarose gel electrophoresis; DNA was stained with ethidium bromide, visualized, and excised under weak ultraviolet light. DNA was purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Vilnius, Lithuania) and sequenced by Sanger sequencing (Evrogen JSC, Moscow, Russia) using the same primers as used for the initial PCR. The obtained sequences were assembled using the SeqMan Pro module of the Lasergene v. 12.3.1 software package (DNAStar Inc., Madison, WI, USA) and deposited in GenBank under accession numbers MT897850 (SSU) and MT890143 (ITS1-5.8S-ITS2).

2.5. Phylogenetic Analysis

Phylogenetic analysis was performed on a concatenated dataset of the SSU and ITS1-5.8S-ITS2 sequences. All of the sequences were searched using the BLASTn algorithm in GenBank (https://blast.ncbi.nlm.nih.gov, accessed on 10 September 2021). The sequences were selected based on the criteria of highest identity (≥95%), read quality (without degenerate and unknown nucleotides), read length (≥2300 bp), and, mainly, belonging to the type species and collection of authentic strains. A data set of 103 sequences with 2611 aligned base positions was used for the phylogenetic analyses; introns were excluded. Dictyosphaerium ehrenbergianum, Parachlorella beijerinckii, and P. kessleri were chosen as an outgroup. The taxon names are listed according to the international electronic database AlgaeBase [31]. Multiple alignment was performed in BioEdit 7.2.5 using the ClustalW algorithm [32]. Based on the AIC in jModelTest [33], the GTR + I + G nucleotide substitution model was selected as the optimal model for Maximum Likelihood (ML) and Bayesian Inference (BI). ML was performed using PhyML [34] with 1000 bootstrap replicates. BI was performed using BEAST v. 1.8.4 [35] with 1,000,000,000 generations of Markov chain Monte Carlo iterations, and the parameters were saved every 100,000th tree, while discarding the first 25% as burn-in. The calculation of genetic distances was performed in the MEGA 6.0 program [36]. To compare the tree topology, we used data from articles [2,5,6,7,8,9,37,38,39,40,41]. The folding of ITS1 and ITS2 was performed using the RNAfold web server (http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi, accessed on 20 November 2021) in accordance with the principle of minimum energy. The correctness of the predicted secondary structure of the ITS1 and ITS2 regions was verified [42,43,44,45]. The comparison of the secondary structure of the spacers between strains and the search for conservative motifs and compensatory base changes (CBCs) were carried out in the 4SALE program [46,47]. For species delimitation, we used the search of CBCs in the ITS2 secondary structure. According to the classical approach, the presence of even one CBC in the conservative regions of ITS2 (5 bp of helix I, 10 bp of helix II, and whole helix III) in two microalgae correlates with their belonging to different species [43,44]. We also took into account the recommendations of Hoshina et al. [8,38] and Chae et al. [10] that, within the framework of the Chlorella clade, CBCs in non-conservative regions of ITS1 or ITS2, as well as stable differences in their secondary structures, may also indicate belonging to different species. The secondary structures of the spacers were visualized in the PseudoViewer3 program. To analyze the level of genetic differences, the nucleotide sequences of ITS2 were aligned, taking into account the secondary structure in the 4SALE program. Then, the genetic distances were calculated in the MEGA 6.0 program (using the Kimura 2-parameter model). The results were interpreted based on the works by Hoshina et al. [14,38,48].

2.6. Physiological Tests

Several physiological tests were performed to determine the optimal growth conditions and stress tolerance limits of the strain IPPAS C-1210. We tested temperature, pH, and osmotic effects on the growth of IPPAS C-1210, as well as the ability of this strain to use different sources of carbon and nitrogen.
For the physiological experiments, the strain was pre-grown for 7–14 days in 300 mL Erlenmeyer flasks with 150 mL of BG-11 medium buffered with 20 mM HEPES (pH 7.5) or BBM-3N medium. The cultures were grown at room temperature on an orbital shaker with an average illumination of 50 μmol photons m−2 s−1 from a warm white light.
The effect of temperature on microalgal growth was investigated using the Laboratory System for Intensive Cultivation described in Gabrielyan et al. [49]. The culture grown for four days at a temperature of 32 ± 1 °C was used as an inoculum. Cultivation was carried out in a glass vessel with 200 mL of buffered BG-11 medium under an average illumination of 100 or 500 μmol photons m−2 s−1 and aeration with sterile air containing 1.5–2% CO2 at four different temperatures, 24 ± 1 °C, 30 ± 1 °C, 36 ± 1 °C, and 41 ± 1 °C, for 7–9 days. Each temperature variant was grown in triplicate. Culture growth was followed by optical density measurements at 750 nm (OD750), and the initial OD750 was in the range of 0.08–0.09.
The following physiological experiments were carried out in a growth chamber MLR-351 (SANYO, Japan) at 32 ± 1 °C under continuous illumination of 50 μmol photons m−2 s−1. The temperature of 32 °C was chosen based on data from a study of the temperature effect on the growth of the strain IPPAS C-1210 (see Section 3.4.).
Evaluation of the effect of pH on growth was carried out in 75 mL Erlenmeyer flasks with 25 mL of BBM-3N medium with pH values adjusted to 4–11 (with step 1) using either NaOH or HCl, with each pH variant in triplicate. The cultures were incubated for eight days. Culture growth was estimated based on changes in OD750 (ΔOD750), and the initial OD750 was 0.01–0.02. The experiment was repeated twice independently.
The tolerance of the strain IPPAS C-1210 to the combined effect of NaCl and NaHCO3 was investigated based on the method described in Mikhodyuk et al. [50] with modifications. The BBM-3N medium was used with a cross gradient of NaHCO3 and NaCl concentrations (0–2 M; steps 0.2 M and 0.4 M, respectively). Cultivation was held in 10 mL serum vials filled with 10 mL of the corresponding media and closed with cotton plugs. Culture growth was estimated after seven days of cultivation based on ΔOD750, and the initial OD750 was 0.2. The experiment was repeated twice independently.
The ability of the strain to use different carbon and nitrogen sources for growth was observed using BG-11 medium with modifications. The tested compounds and their concentrations were chosen based on Shihira and Krauss [51].
In the first experimental series, the strain was cultivated in BG-11 media buffered with 20 mM HEPES (pH 7.5) with different nitrogen sources: NaNO3, NH4NO3, (NH4)2SO4, and CO(NH2)2 (urea); in all variants, the nitrogen concentration was adjusted to 17.6 mM. Cultivation was caried out in 75 mL Erlenmeyer flasks with 25 mL of the corresponding medium. The culture grown in standard BG-11 with 20 mM HEPES (pH 7.5) was used as an inoculum after centrifugation and washing with the corresponding growth medium. Growth was estimated after 12 days of cultivation based on changes in OD750, and the initial OD750 was 0.03. Each medium variant was grown in triplicate.
In the second series of experiments, the strain IPPAS C-1210 was grown on plates with modified BG-11 media buffered with 20 mM HEPES (pH 7.5) and containing different nitrogen and carbon sources. As nitrogen sources, 17.6 mM sodium nitrate, 0.01% yeast extract, 0.01% casamino acids, and 0.01% tryptone were used. As carbon sources, atmospheric carbon dioxide, 0.1% glucose, 0.1% mannose, 0.1% lactose, 0.1% galactose, 0.1% glycerol, 0.001 M acetate, and 0.01 M acetate were used. For the experiment, the inoculum grown in standard liquid BG-11 medium with 20 mM HEPES (pH 7.5) was concentrated by centrifugation, and then a series of 5 tenfold dilutions with the same medium was prepared. Three drops of 10 μL of each dilution were plated on nutrient agar plates, with two plates per medium variation. One Petri dish was wrapped in aluminum foil (dark condition, heterotrophic growth) and another Petri dish was held under light (light condition, autotrophic or mixotrophic growth). The variants grown on standard BG-11 medium with 20 mM HEPES (pH 7.5) were used as a control. After 14 days of incubation, when colonies in the highest dilutions were clearly seen, the growth was estimated based on the number and size of the colonies.

2.7. Statistics

The significance of the effects from the temperature, pH, and nitrogen source experiments on the growth of IPPAS C-1210 was analyzed using a one-way ANOVA with a Tukey’s post hoc test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/). The data were considered significantly different at p < 0.05.

3. Results

3.1. Morphology and Ultrastructure

Morphological observations by light microscopy revealed that the strain IPPAS C-1210 had a Chlorella-like morphotype (Figure 1). The cells were solitary, planktonic, and without bristles. Mucilage was absent. The vegetative cells were spherical to ellipsoidal, and 3.5−6.5 μm in diameter in all tested variants. Chloroplasts were single, parietal, and cup-shaped, with a spherical pyrenoid covered by a segmented starch sheath. Old cells accumulated oil droplets (Figure 1d). Reproduction was by 2−8 autospores, and sporangium size was 5.5–8 μm in diameter (Figure 1e–g). Autospores were equal in size (1.5–2.0 × 1.5–2.5 μm) and exhibited liberation by rupture of the sporangium cell wall (Figure 1g). Zoospores and sexual reproduction were not observed.
Upon TEM observation, a double thylakoid that dissected the pyrenoid matrix and starch sheath was observed (Figure 2a,b,d). Starch grains were scattered among the thylakoids in the chloroplast (Figure 2a–d); in mature cells, numerous lipid bodies were located in the cytoplasm close to the plasma membrane (Figure 2d,f). A single nucleus was peripherally positioned (Figure 2a,b). Young cells had thin single-layered microfibrillar cell walls with an average thickness of 20–40 nm (Figure 2a). The cell walls of cells in the stationary phase of growth were significantly thicker (100–200 nm) and had a non-homogeneous ultrastructure (Figure 2d–f). Autospore cell walls were clearly seen in the autosporangia as thin electron-dense layers (Figure 2c).
The grazing test had no effect on the IPPAS C-1210 morphology: the strain did not produce bristles either under direct pressure from phycophages or in contact with their metabolites (Figure S1).

3.2. Phylogenetic Analysis

Based on the 18S–ITS1–5.8S–ITS2 phylogeny, the studied strain IPPAS C-1210 clustered with the strain ITBB HTA 1–65 (PP—1.00, BP—100%) (Figure 3). The latter strain (hereafter, ITBB HTA 1–65) is the authentic strain of C. thermophila [7]. The genetic distance between the IPPAS C-1210 and ITBB HTA 1–65 was 3.9%. A related phylogenetic lineage was formed by the strain CCAP 211/120 (PP—1.00, BP—86%), which is the authentic strain of C. volutis [6]. The genetic differences between this strain and the cluster containing IPPAS C-1210 and ITBB HTA 1–65 ranged from 3.6% to 4.4%. This group occupied a unique phylogenetic position within the Chlorella clade and did not cluster with C. vulgaris, which is the type species of the genus Chlorella, or with the type species of any other genera. In contrast to the ITBB HTA 1–65 and C. volutis CCAP211/120, the SSU rDNA of IPPAS C-1210 possessed an intron of 440 bp.

3.3. ITS1 and ITS2 Secondary Structures

The secondary structures of the ITS1 regions of the strains IPPAS C-1210, ITBB HTA 1–65, and C. volutis CCAP211/120 are shown in Figure 4. The length of the ITS1 of IPPAS C-1210 was 278 bp, and it was 280 bp for ITBB HTA 1–65 and 260 bp for C. volutis CCAP 211/120. The ITS1 secondary structures of these strains corresponded to the generalized description of the model, which was suggested for eukaryotic organisms by A. Coleman [44] and included four unbranched helices. The helices I−III were located next to each other. The short helix IV was separated from others by unpaired nucleotides. Following the helix IV, a single-stranded A-rich region was adjacent to the 5.8S rRNA gene. The strains IPPAS C-1210 and ITBB HTA 1–65 had no CBCs in ITS1. Compared to C. volutis CCAP 211/120, the strains IPPAS C-1210 and ITBB HTA 1–65 exhibited three CBCs in ITS1: 13th bp (G–C –› U–A) and 16th bp (C−G → G−C) in the helix II and, 1st bp (U−A –› G−C) in the helix IV. The CBC (U–A → G–C) at the base of the helix IV distinguished the strains IPPAS C-1210 and ITBB HTA 1–65 from all other members of the Chlorella clade.
The length of the ITS2 regions of the strains IPPAS C-1210 and ITBB HTA 1–65 was 261 bp and 266 bp, respectively. The ITS2 length of the strain C. volutis CCAP 211/120 was shorter (249 bp). The ITS2 secondary structure of these strains under consideration had common features specific for green microalgae (Chlorophyta): four unbranched helices, a pyrimidine–pyrimidine mismatch in the helix II, and the conservative motif GGUAGG on the 5′-side of helix III [42,43]. One CBC was found in the conserved region of the ITS2 helix I between the strain IPPAS C-1210 and the strain ITBB HTA 1–65 (3rd bp: G−C → U−A) (Figure 5). This CBC can be considered the molecular signature of the strain ITBB HTA 1–65 in the entire Chlorella clade.
CBC in the 7th bp (A-U-G-C) of the ITS2 helix III was one more molecular signature of the strains IPPAS C-1210 and ITBB HTA 1–65 that distinguished them from other species of the Chlorella clade. Another CBC between the strains IPPAS C-1210, ITBB HTA 1–65, and C. volutis CCAP 211/120 was found in the conserved region of the helix III (20th bp: G−C → A−U).

3.4. Physiological Tests

Temperature and light intensity effects. The strain IPPAS C-1210 grew well at temperatures ranging from 24 to 36 °C, with the highest growth rate (μmax = 3.024 day−1, doubling time of 5.5 h) at 30 °C and irradiation of 500 μmol photons m−2 s−1 (Figure 6). At 24 °C, the cultures grew at a similar rate as at 30 °C at lower irradiance of 100 μmol photons m−2 s−1, but the growth was notably slower at higher irradiance of 500 μmol photons m−2 s−1. At 36 °C, the growth significantly slowed down after four days, especially at higher irradiance. At 41 °C, retardation of growth was observed after two days at lower irradiation and after one day at higher irradiation. Microscopic observation on the fourth day of incubation at 41 °C revealed that all cells were bleached, but the cultures were able to resume their growth after being transferred to 30 °C.
Since the optimal growth temperature for the IPPAS C-1210 strain was found to be 30 °C, the following physiological tests were performed in a growth chamber with a temperature of 32 °C, which was the closest to the optimal temperature among available variants.
The effect of pH. The highest biomass increment was observed in the media with an initial alkaline pH of 8–11 (Figure 7 and Figure S2). At pH < 6, growth was very weak, although after eight days of incubation, the average pH values in these variants increased by 0.3–0.6 units. The final pH values in the variants with an initial pH of 8–11 were in the range of 8–9, which was defined as optimal.
NaCl and NaHCO3 tolerance. The experiments with the combined effect of NaHCO3 and NaCl revealed that the optimal growth of the strain IPPAS C-1210 was at 0.2 M NaHCO3 and in the absence of NaCl (Figure 8 and Figure S3). The strain was able to maintain growth with NaHCO3 up to 1.2 M in the medium and NaCl up to 2 M. Tolerance to NaCl decreased as NaHCO3 concentration increased, and vice versa.
Carbon and nitrogen sources. In the first series of the experiments with different nitrogen sources, the highest biomass yield was in the BG-11 medium with urea (Figure 9). In the variants with nitrate and ammonium, the biomass yield was approximately two times lower.
The tests on agar plates with different nitrogen and carbon sources revealed that the addition of 0.1% glucose under the mixotrophic and heterotrophic conditions improved growth most significantly (Figure 10). The addition of 0.1% galactose and 0.01 M or 0.001 M acetate also improved growth, especially under the dark conditions. Mannose and lactose had no effect on growth, and glycerol inhibited it. All tested organic sources of nitrogen (0.01% yeast extract, 0.01% casamino acids, and 0.01% tryptone) improved growth under the light conditions and could be used as a carbon source under the heterotrophic conditions, with tryptone and yeast extract being more effective.

3.5. Formal Description

Neochlorella Krivina, Temraleeva, Bobrovnikova et Sinetova gen. nov.
Description: Cells are solitary, planktonic, spherical or ellipsoidal shape, without bristles. Mucilage is absent. Chloroplast is single, parietal, and cup-shaped, with a spherical pyrenoid covered by two starch grains. Asexual reproduction occurs by equal autospores. Zoospores and sexual reproduction were not observed. Autospores are released through disruption of the parent cell wall. The genus differs from other genera of the family by the SSU and ITS rRNA gene sequences.
Distribution: Among the representatives of this genus, there are freshwater and aeroterrestrial organisms.
Type species: Neochlorella semenenkoi Krivina, Temraleeva, Bobrovnikova et Sinetova sp. nov.
Etymology: From Greek ‘neo-‘= new and the previously described genus Chlorella, Neoclorella can be translated as “new Chlorella”. The name reflects that it is a new genus of Chlorella-like algae.
Holotype: The cryopreserved culture of the authentic strain Neochlorella semenenkoi IPPAS C-1210.
Holotype locality: The holotype culture was obtained from the freshwater lake Issyk, Kazakhstan (43°15′11.16″ N, 77°29′4.92″ E).
Holotype deposit: Material from the authentic strain Neochlorella semenenkoi IPPAS C-1210 is stored at the IPPAS collection of microalgae and cyanobacteria, Moscow, Russian Federation (metabolically inactive cryopreserved culture).
Isotypes: The authentic strain IPPAS C-1210 was deposited in the Algal Collection of Soil Science Institute (ACSSI) under the designation ACSSI 342.
Neochlorella semenenkoi Krivina, Temraleeva, Bobrovnikova et Sinetova sp. nov.
LM and TEM observation (Figure 1): Cells are solitary, planktonic, and spherical shaped, without bristles, and 3.5−6.3 μm in diameter. Mucilage is absent. Chloroplast is single, parietal, and cup-shaped, with a spherical pyrenoid, and is covered by two starch halves. Asexual reproduction occurs by 2−8 equal autospores. In the process of development, they change their shape from initially spherical and ellipsoid shaped to spherical shaped. Zoospores and sexual reproduction were not observed.
Holotype: Material from the authentic strain IPPAS C-1210 is stored in the IPPAS collection of microalgae and cyanobacteria, Moscow, Russian Federation (metabolically inactive cryopreserved culture).
Isotype: The authentic strain IPPAS C-1210 was deposited at the Algal Collection of Soil Science Institute (ACSSI) under the designation ACSSI 342.
Etymology: The species is named in honor of Prof. Victor Efimovich Semenenko, a founder of microalgal biotechnology in Russia, in recognition of the many contributions he made to our knowledge about the physiology of Chlorella-like algae.
Authentic strain: IPPAS C-1210.
GenBank accession number: MT897850; MT890143.
Neochlorella thermophila (Ma, S., Han, B., Huss, V.A.R., Hu, X., Sun, X. and Zhang, J.) Krivina, Temraleeva, Bobrovnikova et Sinetova, comb. nov.
Synonym: C. thermophila Ma, S., Han, B., Huss, V.A.R., Hu, X., Sun, X. and Zhang, J. [7].
LM and TEM observation: Cells are solitary, planktonic, spherical, or ellipsoidal shaped, without bristles, and 1.5−2.5 μm in diameter. Mucilage is absent. Cell walls are smooth and double-layered. Chloroplast is single, parietal, and cup-shaped, with a spherical pyrenoid covered by two starch grains. Asexual reproduction occurs by 2−4 equal autospores. Zoospores and sexual reproduction were not observed [7].
Holotype: Deposited as strain HTA 1–65 in cryopreserved and active forms in the Microorganism Collection Center of the Institute of Tropical Bioscience and Biotechnology (ITBB), CATAS, Hainan, China [7].
Type location: Rooftops, Haikou, Hainan Province, China [7].
Etymology: The species is named after its thermo-tolerance [7].
Authentic strain: ITBB HTA 1–65 [7].
GenBank accession number: KF661334; KJ002639 [7].

4. Discussion

Identification of asexual small coccoid green algae is very difficult due to the simplicity and scarcity of morphological characteristics. One of the most striking examples of this is the genus Chlorella. At present, the name ‘Chlorella‘ indicates the morphotype of the organism rather than its taxonomic status. Such a morphotype is a result of convergent evolution and occurs among various microalgae [52,53,54,55]. In this regard, the most effective way to determine the true taxonomic status is a combined use of morphological, ecophysiological, and molecular phylogenetic methods [8,14,41,56]. Based on such an integrative approach, we describe a new genus, Neochlorella, with the IPPAS C-1210 as the authentic strain of the type species, N. semenenkoi gen. and sp. nov. In addition, we justify the reassignment of the strain C. thermophila ITBB HTA 1–65 into N. thermophila comb. nov.

4.1. Morphology and Ultrastructure

The light and TEM observations of N. semenenkoi IPPAS C-1210 showed the typical Chlorella-like morphology, but correct species affiliation based on morphology and ultrastructure alone was not possible (Table 3). At the same time, our strain had a number of differences from neighboring phylogenetic lineages [6,7]. Thus, in contrast to C. volutis CCAP 211/120, with adult cells having only a spherical shape, the adult cells of N. semenenkoi IPPAS C-1210 and N. thermophila ITBB HTA 1–65 are both spherical and ellipsoidal. The cells of N. semenenkoi IPPAS C-1210 are larger in size (3.5−6.3 μm) than the cells of N. thermophila ITBB HTA 1–65 (1.5−2.5 μm), but they are smaller than the cells of C. volutis CCAP 211/120 (5.0−6.5 μm). The chloroplasts of N. semenenkoi IPPAS C-1210 and N. thermophila ITBB HTA 1–65 are predominantly cup-shaped, unlike those of the strain C. volutis CCAP 211/120, which may be saucer-shaped. All of them have one pyrenoid with a segmented starch sheath. In the stationary phase, the cells of N. semenenkoi IPPAS C-1210 accumulate large lipid droplets (Figure 1d and Figure 2d,f), which makes them different from the cells of N. thermophila ITBB HTA 1–65 with only a few small oil bodies [7].
Reproduction of all these strains is by autospores. N. semenenkoi IPPAS C-1210 autosporangia form 2–8 autospores, while N. thermophila ITBB HTA 1–65 has been reported to produce 2–4 autospores per autosporangium [7]. Nevertheless, according to the available illustrative material (Figure 1B in Ma et al. [7]), N. thermophila autosporangia also may contain more than four autospores (at least five are clearly seen).
Cells of N. semenenkoi IPPAS C-1210 have a thick (100–200 nm) non-homogenous cell wall in the stationary phase (Figure 2d–f). It may be different from cells of the sister species N. thermophila ITBB HTA 1–65, which have cell walls that are significantly thinner (60–80 nm, as can be estimated from Figure 1C,D in Ma et al. [7]). To confirm the difference, it is necessary to study the cell wall ultrastructure of N. thermophila in cells at different growth stage. Unfortunately, no data are found on the cell wall ultrastructure of the authentic strains of C. volutis and C. lewinii. The cell wall ultrastructure of the C. sorokiniana type strain SAG 211-8k (=IAM C-212 = UTEX 1230) was studied in detail by Yamamoto et al. [3], Němcová and Kalina [60] and Rosen et al. [66]. Cell walls of both young and adult cells of C. sorokiniana are also much thinner than those of N. semenenkoi IPPAS C-1210 (22 and 60 nm, respectively [3], and Figure 3 and Figure 4 in Němcová and Kalina [60]). The images of cell walls of the authentic strain of C. vulgaris SAG 211-11b (=H1955) were found only in the work by Němcová and Kalina [60]. Mature cells of C. vulgaris have a thick cell wall (estimated from Figure 1 and Figure 2 in Němcová and Kalina [60] as 180–200 nm), but its ultrastructure is indistinguishable on the available images. Cell wall ultrastructure has been repeatedly suggested as a distinctive trait for Chlorella-like algae [3,16,60,67,68]. New studies based on type strains are needed to clarify the role of cell wall ultrastructure and composition as a taxonomic marker.

4.2. Phylogenetic Analysis

The results of phylogenetic analysis are generally consistent with previous studies [7,12,13,14]. All taxonomically recognized, non-monotypic genera (Hindakia, Heynigia, Didymogenes, and Micractinium) are well-supported clusters. The phylogenetic tree confirms that the boundaries of the genus Chlorella are currently incorrectly defined and need to be revised. In particular, the species C. pulchelloides, C. chlorelloides, C. singularis, C. colonialialis, C. elongata, C. lewinii, C. sorokiniana, and C. volutis are misidentified and actually belong to other independent genera that need to be studied, described, and validated.
The expansion of the phylogenetic dataset makes it possible to identify groups in the Chlorella clade with strong statistical support. According to the results obtained, N. semenenkoi IPPAS C-1210 and N. thermophila ITBB HTA 1–65, together with C. volutis CCAP 211/120, form a cluster with a unique phylogenetic position within the Chlorella clade. Unfortunately, for the entire Chlorella clade, it is impossible to clearly and unambiguously determine the interspecific and intergeneric level of genetic differences. For example, in the genus Micractinium, the interspecific level of genetic differences varies from 0.3 to 4.3%, and in the genus Hegewaldia, it is 3.9%. At the same time, the genetic distance between the genera Heynigia and Hindakia is 2.2–2.5%, and between Heynigia and Didymogenes, it is 2.2–2.9%. Nevertheless, it can be confidently stated that the genetic distance between N. semenenkoi IPPAS C-1210 and N. thermophila ITBB HTA 1–65 (3.9%) corresponds at least to the interspecific level. The Neochlorella clade is separated from the authentic strain C. vulgaris SAG 211-11b by a genetic distance of 5.2–5.4% and from the authentic strains of type species of other genera by genetic distances of ≥4.4%, which definitely correspond to the intergeneric level.
N. semenenkoi IPPAS C-1210 possesses a 440-nucleotide insertion in the 18S rRNA gene as mentioned above, but this intron is not present in any of its closely related strains (Figure 3). The use of the main characteristics of intron (composition and position in the SSU) as a tool for distinguishing algal species is quite effective, including the differentiation of morphologically cryptic species [13,38,56,69,70]. It should be noted, however, that the presence or absence of an intron, as well as differences in its structure or length, can be observed between different populations of the same species in some cases. For example, when studying the representatives of Chlorella variabilis, Hoshina et al. [14] found differences in the length and structure of an intron between strains of different populations. Nevertheless, in the present case, the presence of an intron in the 18S rRNA gene can be considered an additional confirmation of the difference between N. semenenkoi and its sister species, N. thermophila.

4.3. ITS1 and ITS2 Secondary Structures

Currently, the analysis of the secondary structures of ITS1 and ITS2 is widely used to distinguish the species of green algae [42,44,71]. N. semenenkoi IPPAS C-1210 shows differences in one CBC in the conserved regions of ITS2 compared to N. thermophila ITBB HTA 1–65. In comparison to C. volutis CCAP 211/120, both Neochlorella species have three CBCs in the ITS1 secondary structures and two CBCs in the conserved regions of ITS2. Another additional CBC was found in the conserved regions of ITS2 between N. thermophila ITBB HTA 1–65 and C. volutis CCAP 211/120. Since even one CBC is a rare evolutionary event within the Chlorella clade [10,13,38], the results of the analysis of the internally transcribed spacers undoubtedly indicate the independent species status of each of these strains. In addition, unique CBCs in ITS1 (1st bp, helix IV) and ITS2 (7th bp, helix III) were found in all Neochlorella species, which distinguish them from all other Chlorella clade genera. In our opinion, they can be considered molecular signatures of the genus Neochlorella.
Hoshina et al. [14,38] found that when analyzing ITS2, it is important to take into account not only CBCs and secondary structure features but also genetic distances. For two organisms to be compared, the difference between the ITS2 sequences is usually either less than 2% or more than 10%. In the first case, the organisms are representatives of the same species, and in the second case, they belong to different species [14,38]. The genetic difference between N. semenenkoi IPPAS C-1210 and N. thermophila ITBB HTA 1–65 is 17.6%, and between N. semenenkoi IPPAS C-1210 and C. volutis CCAP 211/120, it is 20.4%. Such values unambiguously correspond to the interspecific level within the Chlorella clade.

4.4. Physiology

The representatives of the cluster under study have different habitat preferences (Table 3). N. semenenkoi IPPAS C-1210 and C. volutis CCAP 211/120 are free-living inhabitants of freshwater reservoirs, as are most members of the Chlorella clade [6,13]. In contrast, rooftops as a typical habitat are indicated for the strain N. thermophila ITBB HTA 1–65 [7]. Therefore, it can be assumed that it has an aerophytic life strategy, but this needs to be clarified.
N. semenenkoi IPPAS C-1210 is moderately thermotolerant, as evidenced by its ability to grow at 36 ± 1 °C and maintain viability after one to two days of incubation at 41 ± 1 °C. The best growth was observed at 30 ± 1 °C and a high irradiance of 500 μmol of photons m−2 s−1.
The optimum pH was determined to be in the range of 8–9, but the strain grows normally at higher pH values, acidifying the medium. N. semenenkoi IPPAS C-1210 grows well in media with 0–0.4 M of NaCl or 0–0.2 M of NaHCO3 and could withstand higher concentrations of NaCl up to 2 M and NaHCO3 up to 1.2 M. It can be concluded that N. semenenkoi IPPAS C-1210 is halotolerant and is capable of using bicarbonate as a carbon source.
It has also been shown that N. semenenkoi IPPAS C-1210 is able to use nitrate, ammonium salts, and urea as nitrogen sources; yeast extract, casamino acids, and tryptone as nitrogen and carbon sources; and glucose, galactose, and acetate as carbon sources for mixotrophic and heterotrophic growth.
Thus, N. semenenkoi IPPAS C-1210 is characterized by thermotolerance, halotolerance, alkaliphily, and ability to use a wide range of carbon and nitrogen sources. These properties make the strain especially attractive for biotechnological applications. For example, the cultivation of microalgae in closed photobioreactors requires temperature control to avoid overheating, which is very expensive in the case of large-scale cultivation, but using thermotolerant strains helps to reduce temperature control costs [72]. Robust species that are able to grow in a wide range of temperatures are also suitable for outdoor cultivation with significant daily temperature fluctuations [73]. Halotolerant strains may be grown without using fresh water, and seawater or brackish water can be used instead. Alkaliphily is a beneficial trait in biotechnology because intensively growing microalgae raise the pH of their media, and a high pH will not inhibit the growth of an alkaliphilic strain. In addition, many contaminants do not survive at high pH. The ability to use bicarbonate as a carbon source helps solve the problem of carbon supply in large-scale cultivation [74]. The ability of the strain to use a wide range of carbon and nitrogen sources allows its growth in heterotrophic and mixotrophic cultures with a high cell density. In addition, such strain can be used for wastewater remediation [75].
The physiological characteristics of other authentic strains of the species assigned to the genus Chlorella have been studied to a lesser extent (Table 3). In terms of the resistance of algae to biotic and abiotic stresses, one of the most studied is resistance to high temperatures. Currently, among the representatives of the Chlorella clade, for which the reaction to exposure to high temperatures has been studied, C. sorokiniana 7-11-05 (=SAG 211-8k) has the highest thermal stability, growing at temperatures up to 42 °C [51,57]. The strain N. thermophila ITBB HTA 1–65 is considered the second most thermally stable since it has an optimal growth temperature of 33°C and could grow at 42 °C, although at a relatively low rate. In addition, this strain could tolerate heat up to 45 °C for at least three hours a day [7]. The studied strain IPPAS C-1210 also demonstrates thermotolerant properties, which, however, are somewhat lower than those of C. sorokiniana and N. thermophila. For comparison, C. vulgaris CCAP 211/11B (=SAG 211-11b) could grow at temperatures no higher than 30 °C [61,65]. Thus, it is likely that thermotolerance is characteristic for the genus Neochlorella.
Other notable physiological features of N. semenenkoi are its halotolerance (up to 2 M NaCl) and alkaliphily (optimal pH 8–9, upper limit pH 11). In comparison, the type species of the genus Chlorella, C. vulgaris SAG 211-11b, can tolerate only 3–4% of NaCl (0.6–0.7 M) [59,76], and its optimal pH is in the range of 5–8, with an upper limit pH of 9.5 [63]. The more closely related C. sorokiniana SAG 211-8k is also less halotolerant, surviving only in 1–3% of NaCl (0.2–0.6 M) [59], but we were not able to find information about its upper pH limit. No available information was found on the pH and salt effects on the growth of other closely related Chlorella-like strains, including the sister species N. thermophila ITBB HTA 1–65.
The ability to use different nitrogen and carbon sources was suggested as a taxonomic marker for species delimitation by Shihira and Krauss [51]. The ability to grow mixotrophically and heterotrophically using various organic substrates is common to many strains of the Chlorella clade [51,64]. Acetate can be used as a carbon source for heterotrophic and mixotrophic growth by N. semenenkoi IPPAS C-1210 and C. vulgaris UTEX 259 (=SAG 211-11b) [64]. Ma et al. [7] grew N. thermophila ITBB HTA 1–65 in TAP medium containing acetate. Thus, we can assume the ability of N. thermophila to use acetate as a carbon source, but this has yet to be proven. C. sorokiniana 7-11-05 (=SAG 211-8k) is not able to use acetate for its growth in darkness [51]. Glucose can be used as a carbon source for heterotrophic and mixotrophic growth by N. semenenkoi IPPAS C-1210, C. vulgaris SAG 211-11b [63,64], and C. sorokiniana 7-11-05 [51]. Galactose can be used by N. semenenkoi IPPAS C-1210 and C. sorokiniana 7-11-05 [51]. Mannose inhibits the growth of C. sorokiniana 7-11-05 [51] and has no effect on N. semenenkoi IPPAS C-1210. Glycerol inhibits the growth of N. semenenkoi IPPAS C-1210, while C. vulgaris UTEX 259 uses it as a carbon source in light [64]. No information on the heterotrophic growth of C. volutis CCAP 211/120 and C. lewinii CCAP 211/90 is available. In addition, it is very important to check the ability of N. thermophila ITBB HTA 1–65 to grow autotrophically.
N. semenenkoi and all related strains under study are able to use nitrate as a nitrogen source; the only exception is N. thermophila ITBB HTA 1–65 because it was grown in TAP media with ammonium as a nitrogen source, and its ability to use nitrate has not yet been studied. Ammonia is a suitable nitrogen source for N. semenenkoi IPPAS C-1210, N. thermophila ITBB HTA 1–65 [7], and C. sorokiniana 7-11-05 [51], and no information about other strains is available. Furthermore, C. sorokiniana 7-11-05 can use casamino acids [51], C. vulgaris SAG 211-11b can use triptone and peptone [1], while N. semenenkoi IPPAS C-1210 can use all of them. It remains to be investigated whether other relative strains can utilize organic nitrogen. The ability to utilize different carbon and nitrogen sources seems to be a possible taxonomic marker, being easy for testing and useful for biotechnological purposes.

5. Conclusions

The results of this study have again demonstrated the need for a thorough revision of the algal strains with Chlorella-like morphology that are mistakenly assigned to the genus Chlorella. The morphological and ultrastructural studies showed that the studied strain IPPAS C-1210 has a typical Chlorella-like morphology and ultrastructure. It differs from closely related strains only by cell size and thickness of cell wall.
The phylogenetic analysis based on 18S–ITS1–5.8S–ITS2 sequences revealed that the studied strain IPPAS C-1210 groups in a highly supported cluster with the authentic strain of C. thermophila ITBB HTA 1–65. A related phylogenetic lineage is formed by C. volutis CCAP 211/120. This cluster occupies a unique phylogenetic position within the Chlorella clade and is clearly separated from the cluster containing C. vulgaris, the type species of the genus Chlorella, as well as from other genera of the Chlorella clade. Based on genetic distances and CBCs in ITS1 and ITS2 secondary structures, we describe a new Trebouxiophycean genus, Neochlorella gen. nov. Within this genus, two new species are described: N. semenenkoi sp. nov. (autentic strain IPPAS C-1210) and N. thermophila comb. nov. (authentic strain ITBB HTA 1–65). A more complete study of the related strain C. volutis CCAP 211/120 is required to clarify its taxonomic identity.
Our study shows that the newly described N. semenenkoi IPPAS C-1210 is characterized by thermotolerance, halotolerance, alkaliphily, and ability to use a wide range of carbon and nitrogen sources. These properties make the strain especially attractive for biotechnological applications.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/d15040513/s1. Figure S1: Cell morphology of Neochlorella semenenkoi IPPAS C-1210 after the grazing test: a 3-day-old culture grown in BG-11 with the phycophagus Brachionus rotundiformis; Figure S2: Growth of Neochlorella semenenkoi IPPAS C-1210 at different pH. The error bars show standard deviations of the mean (n = 3). The variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05). The second experiment out of two is shown; Figure S3: Growth of Neochlorella semenenkoi IPPAS C-1210 in the concentration matrix NaHCO3 and NaCl. The second experiment out of two is shown.

Author Contributions

Conceptualization, E.S.K., L.A.B., A.D.T. and M.A.S.; investigation, E.S.K., L.A.B., A.D.T., A.G.M., D.A.G. and M.A.S.; resources, E.S.K., A.D.T. and M.A.S.; data curation, E.S.K. and L.A.B.; writing—original draft preparation, E.S.K., L.A.B. and M.A.S.; writing—review and editing, E.S.K., A.D.T. and M.A.S.; visualization, E.S.K. and L.A.B.; supervision, E.S.K., A.D.T. and M.A.S.; funding acquisition, E.S.K. and M.A.S. All authors have read and agreed to the published version of the manuscript.

Funding

E.K. was funded by the Russian Foundation for Basic Research (RFBR), grant no. 19-34-60002, which covered the morphological and phylogenetic studies; L.B., D.G. and M.S. were funded by the Russian Science Foundation (RSF), grants no. 20-14-00280, which covered the ultrastructural study and physiological tests. The deposition and maintenance of the strain IPPAS C-1210 in the collection IPPAS was supported by the Ministry of Science and Higher Education of the Russian Federation (theme no. 122042700045-3).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The sequence data are available under the given accession numbers in GenBank. The alignment used in the current study is available upon request.

Acknowledgments

In this work, the large-scale research facilities of the Collection of microalgae and cyanobacteria IPPAS (K.A. Timiryazev Institute of Plant Physiology RAS, Moscow, Russia) were used.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Beijerinck, M. Culturversuche mit Zoochlorellen, Lichenengonidien und anderen niederen Algen. Bot. Ztg. 1890, 48, 781–788. [Google Scholar]
  2. Krienitz, L.; Hegewald, E.H.; Hepperle, D.; Huss, V.A.R.; Rohr, T.; Wolf, M. Phylogenetic relationship of Chlorella and Parachlorella gen. nov. (Chlorophyta, Trebouxiophyceae). Phycologia 2004, 43, 529–542. [Google Scholar] [CrossRef] [Scilit]
  3. Yamamoto, M.; Kurihara, I.; Kawano, S. Late type of daughter cell wall synthesis in one of the Chlorellaceae, Parachlorella kessleri (Chlorophyta, Trebouxiophyceae). Planta 2005, 221, 766–775. [Google Scholar] [CrossRef] [Scilit]
  4. Luo, W.; Proschold, T.; Bock, C.; Krienitz, L. Generic concept in Chlorella-related coccoid green algae (Chlorophyta, Trebouxiophyceae). Plant Biol. 2010, 12, 545–553. [Google Scholar] [CrossRef] [Scilit]
  5. Pröschold, T.; Bock, C.; Luo, W.; Krienitz, L. Polyphyletic distribution of bristle formation in Chlorellaceae: Micractinium, Diacanthos, Didymogenes and Hegewaldia gen. nov. (Trebouxiophyceae, Chlorophyta). Phycol. Res. 2010, 58, 1–8. [Google Scholar] [CrossRef] [Scilit]
  6. Bock, C.; Krienitz, L.; Proeschold, T. Taxonomic reassessment of the genus Chlorella (Trebouxiophyceae) using molecular signatures (barcodes), including description of seven new species. Fottea 2011, 11, 293–312. [Google Scholar] [CrossRef] [Scilit]
  7. Ma, S.; Han, B.; Huss, V.A.R.; Hu, X.; Sun, X.; Zhang, J. Chlorella thermophila (Trebouxiophyceae, Chlorophyta), a novel thermo-tolerant Chlorella species isolated from an occupied rooftop incubator. Hydrobiologia 2015, 760, 81–89. [Google Scholar] [CrossRef] [Scilit]
  8. Hoshina, R.; Kobayashi, M.; Suzaki, T.; Kusuoka, Y. Brandtia ciliaticola gen. et sp. nov. (Chlorellaceae, Trebouxiophyceae) a common symbiotic green coccoid of various ciliate species. Phycol. Res. 2018, 66, 76–81. [Google Scholar] [CrossRef] [Scilit]
  9. Hoshina, R.; Nakada, T. Carolibrandtia nom. nov. as a replacement name for Brandtia Hoshina (Chlorellaceae, Trebouxiophyceae). Phycol. Res. 2018, 66, 82–83. [Google Scholar] [CrossRef] [Scilit]
  10. Chae, H.; Lim, S.; Kim, H.S.; Choi, H.-G.; Kim, J.H. Morphology and phylogenetic relationships of Micractinium (Chlorellaceae, Trebouxiophyceae) taxa, including three new species from Antarctica. Algae 2019, 34, 267–275. [Google Scholar] [CrossRef] [Scilit]
  11. Krivina, E.; Temraleeva, A.; Sinetova, M. New species Micractinium kostikovii (Chlorellaceae, Trebouxiophyceae) from Russia. Phycol. Res. 2022, 70, 22–34. [Google Scholar] [CrossRef] [Scilit]
  12. Heeg, J.S.; Wolf, M. ITS2 and 18S rDNA sequence-structure phylogeny of Chlorella and allies (Chlorophyta, Trebouxiophyceae, Chlorellaceae). Plant Gene 2015, 4, 20–28. [Google Scholar] [CrossRef] [Scilit]
  13. Krivina, E.; Temraleeva, A. Identification problems and cryptic diversity of Chlorella-clade microalgae (Chlorophyta). Microbiology 2020, 89, 720–732. [Google Scholar] [CrossRef] [Scilit]
  14. Hoshina, R.; Tsukii, Y.; Harumoto, T.; Suzaki, T. Characterization of a green Stentor with symbiotic algae growing in an extremely oligotrophic environment and storing large amounts of starch granules in its cytoplasm. Sci. Rep. 2021, 11, 2865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Warburg, O. Über die Geschwindigkeit der photochemischen Kohlensäurezersetzung in lebenden Zellen. In Über die Katalytischen Wirkungen der Lebendigen Substanz: Arbeiten aus dem Kaiser Wilhelm-Institut für Biologie, Berlin-Dahlem; Warburg, O., Ed.; Springer: Berlin/Heidelberg, Germany, 1919; pp. 308–340. [Google Scholar]
  16. Yamada, T.; Sakaguchi, K. Comparative studies on Chlorella cell walls: Induction of protoplast formation. Arch. Microbiol. 1982, 132, 10–13. [Google Scholar] [CrossRef] [Scilit]
  17. Borowitzka, M.A. Energy from Microalgae: A Short History. In Algae for Biofuels and Energy; Borowitzka, M.A., Moheimani, N.R., Eds.; Springer: Dordrecht, The Netherlands, 2013; pp. 1–15. [Google Scholar]
  18. Masojídek, J.; Torzillo, G. Mass Cultivation of Freshwater Microalgae. In Encyclopedia of Ecology; Jørgensen, S.E., Fath, B.D., Eds.; Academic Press: Oxford, UK, 2008; pp. 2226–2235. [Google Scholar]
  19. Semenenko, V.E.; Rudova, T.S. On the mechanism of biosynthesis reorientation in Chlorella under the influence of factors limiting cellular division. Arch. Hydrobiol. Suppl. 1976, 49, 185–198. [Google Scholar]
  20. Sinetova, M.A.; Sidorov, R.A.; Starikov, A.Y.; Voronkov, A.S.; Medvedeva, A.S.; Krivova, Z.V.; Pakholkova, M.S.; Bachin, D.V.; Bedbenov, V.S.; Gabrielyan, D.A.; et al. Assessment of biotechnological potential of cyanobacteria and microalgae strains from the IPPAS culture collection. Appl. Biochem. Microbiol. 2020, 56, 36–50. [Google Scholar] [CrossRef] [Scilit]
  21. Andersen, R.A. (Ed.) Algal Culturing Techniques; Elsevier Academic Press: London, UK, 2005. [Google Scholar]
  22. Stanier, R.Y.; Kunisawa, R.; Mandel, M.; Cohen-Bazire, G. Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol. Rev. 1971, 35, 171–205. [Google Scholar] [CrossRef]
  23. Gorman, D.S.; Levine, R.P. Cytochrome f and plastocyanin: Their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 1965, 54, 1665–1669. [Google Scholar] [CrossRef] [Scilit]
  24. Komárek, J.; Fott, B. Chlorococcales. Das Phytoplankton des Süßwassers, Vol. 7; Schweizerbart: Stuttgart, Germany, 1983; 1043 p. [Google Scholar]
  25. Andreyeva, V.M. Terrestrial and Aerophilic Green algae (Chlorophyta: Tetrasporales, Chlorococcales, Chlorosarcinales); NAUKA: St. Petersburg, Russia, 1998; 349 p. [Google Scholar]
  26. Červený, J.; Sinetova, M.A.; Zavřel, T.; Los, D.A. Mechanisms of high temperature resistance of Synechocystis sp. PCC 6803: An impact of histidine kinase 34. Life 2015, 5, 676–699. [Google Scholar] [CrossRef] [Scilit]
  27. Adar, O.; Kaplan-Levy, R.N.; Banet, G. High temperature Chlorellaceae (Chlorophyta) strains from the Syrian-African Rift Valley: The effect of salinity and temperature on growth, morphology and sporulation mode. Eur. J. Phycol. 2016, 51, 387–400. [Google Scholar] [CrossRef] [Scilit]
  28. Chen, M.; Chen, F.; Yu, Y.; Ji, J.; Kong, F. Genetic diversity of eukaryotic microorganisms in Lake Taihu, a large shallow subtropical lake in China. Microb. Ecol. 2008, 56, 572–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Friedl, T. Evolution of the polyphyletic genus Pleurastrum (Chlorophyta): Inferences from nuclear-encoded ribosomal DNA sequences and motile cell ultrastructure. Phycologia 1996, 35, 456–469. [Google Scholar] [CrossRef] [Scilit]
  30. White, T.J.; Bruns, T.; Lee, S. Taylor, Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press, Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  31. Guiry, M.D.; Guiry, G.M. AlgaeBase. World-Wide Electronic Publication, National University of Ireland, Galway. Available online: http://www.algaebase.org (accessed on 27 April 2022).
  32. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  33. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit]
  34. Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Scilit]
  35. Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 2012, 29, 1969–1973. [Google Scholar] [CrossRef] [Scilit]
  36. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
  37. Darienko, T.; Rad-Menéndez, C.; Campbell, C.; Pröschold, T. Are there any true marine Chlorella species? Molecular phylogenetic assessment and ecology of marine Chlorella-like organisms, including a description of Droopiella gen. nov. Syst. Biodivers. 2019, 17, 811–829. [Google Scholar] [CrossRef] [Scilit]
  38. Hoshina, R.; Iwataki, M.; Imamura, N. Chlorella variabilis and Micractinium reisseri sp. nov. (Chlorellaceae, Trebouxiophyceae): Redescription of the endosymbiotic green algae of Paramecium bursaria (Peniculia, Oligohymenophorea) in the 120th year. Phycol. Res. 2010, 58, 188–201. [Google Scholar] [CrossRef] [Scilit]
  39. Luo, W.; Pflugmacher, S.; Proschold, T.; Walz, N.; Krienitz, L. Genotype versus phenotype variability in Chlorella and Micractinium (Chlorophyta, Trebouxiophyceae). Protist 2006, 157, 315–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Pröschold, T.; Darienko, T.; Silva, P.C.; Reisser, W.; Krienitz, L. The systematics of Zoochlorella revisited employing an integrative approach. Environ. Microbiol. 2011, 13, 350–364. [Google Scholar] [CrossRef] [Scilit]
  41. Pröschold, T.; Pitsch, G.; Darienko, T. Micractinium tetrahymenae (Trebouxiophyceae, Chlorophyta), a new endosymbiont isolated from ciliates. Diversity 2020, 12, 200. [Google Scholar] [CrossRef] [Scilit]
  42. Coleman, A.W. ITS2 is a double-edged tool for eukaryote evolutionary comparisons. Trends Genet. 2003, 19, 370–375. [Google Scholar] [CrossRef] [Scilit]
  43. Coleman, A.W. Is there a molecular key to the level of “biological species” in eukaryotes? A DNA guide. Mol. Phylogenet. Evol. 2009, 50, 197–203. [Google Scholar] [CrossRef] [Scilit]
  44. Coleman, A.W. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure. Trends Genet. 2015, 31, 157–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Caisova, L.; Marin, B.; Melkonian, M. A consensus secondary structure of ITS2 in the Chlorophyta identified by phylogenetic reconstruction. Protist 2013, 164, 482–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Seibel, P.N.; Müller, T.; Dandekar, T.; Schultz, J.; Wolf, M. 4SALE–a tool for synchronous RNA sequence and secondary structure alignment and editing. BMC Bioinform. 2006, 7, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Seibel, P.N.; Müller, T.; Dandekar, T.; Wolf, M. Synchronous visual analysis and editing of RNA sequence and secondary structure alignments using 4SALE. BMC Res. Notes 2008, 1, 1–7. [Google Scholar] [CrossRef] [Scilit]
  48. Hoshina, R.; Fujiwara, Y. Molecular characterization of Chlorella cultures of the National Institute for Environmental Studies culture collection with description of Micractinium inermum sp. nov., Didymogenes sphaerica sp. nov., and Didymogenes soliella sp. nov. (Chlorellaceae, Trebouxiophyceae). Phycol. Res. 2013, 61, 124–132. [Google Scholar] [CrossRef] [Scilit]
  49. Gabrielyan, D.A.; Sinetova, M.A.; Gabrielian, A.K.; Bobrovnikova, L.A.; Bedbenov, V.S.; Starikov, A.Y.; Zorina, A.A.; Gabel, B.V.; Los, D.A. Laboratory system for intensive cultivation of microalgae and cyanobacteria. Rus. J. Plant. Physiol. 2023; in press.
  50. Mikhodyuk, O.; Gerasimenko, L.; Akimov, V.; Ivanovsky, R.; Zavarzin, G. Ecophysiology and polymorphism of the unicellular extremely natronophilic cyanobacterium Euhalothece sp. Z-M001 from Lake Magadi. Microbiology 2008, 77, 717–725. [Google Scholar] [CrossRef] [Scilit]
  51. Shihira, I.; Krauss, R.W. Physiology and Taxonomy of Forty-One Isolates; University of Maryland: College Park, MD, USA, 1965; pp. 1–92. [Google Scholar]
  52. Henley, W.J.; Hironaka, J.L.; Guillou, L.; Buchheim, M.A.; Buchheim, J.A.; Fawley, M.W.; Fawley, K.P. Phylogenetic analysis of the ‘Nannochloris-like’ algae and diagnoses of Picochlorum oklahomensis gen. et sp. nov. (Trebouxiophyceae, Chlorophyta). Phycologia 2004, 43, 641–652. [Google Scholar] [CrossRef] [Scilit]
  53. Krienitz, L.; Huss, V.A.; Bock, C. Chlorella: 125 years of the green survivalist. Trends Plant. Sci. 2015, 20, 67–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Hodac, L.; Hallmann, C.; Spitzer, K.; Elster, J.; Fasshauer, F.; Brinkmann, N.; Lepka, D.; Diwan, V.; Friedl, T. Widespread green algae Chlorella and Stichococcus exhibit polar-temperate and tropical-temperate biogeography. FEMS Microbiol. Ecol. 2016, 92, fiw122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Malavasi, V.; Škvorová, Z.; Němcová, Y.; Škaloud, P. Laetitia sardoa gen. & sp. nov., a new member of the Chlorellales (Trebouxiophyceae, Chlorophyta) isolated from Sardinia Island. Phycologia 2022, 61, 375–383. [Google Scholar] [CrossRef] [Scilit]
  56. Pröschold, T.; Rieser, D.; Darienko, T.; Nachbaur, L.; Kammerlander, B.; Qian, K.; Pitsch, G.; Bruni, E.P.; Qu, Z.; Forster, D.; et al. An integrative approach sheds new light onto the systematics and ecology of the widespread ciliate genus Coleps (Ciliophora, Prostomatea). Sci. Rep. 2021, 11, 5916. [Google Scholar] [CrossRef] [Scilit]
  57. Sorokin, C. Tabular comparative data for the low-and high-temperature strains of Chlorella. Nature 1959, 184, 613–614. [Google Scholar] [CrossRef] [Scilit]
  58. Mizuno, Y.; Sato, A.; Watanabe, K.; Hirata, A.; Takeshita, T.; Ota, S.; Sato, N.; Zachleder, V.; Tsuzuki, M.; Kawano, S. Sequential accumulation of starch and lipid induced by sulfur deficiency in Chlorella and Parachlorella species. Bioresour. Technol. 2013, 129, 150–155. [Google Scholar] [CrossRef] [Scilit]
  59. Kessler, E.; Huss, V.A.R. Comparative physiology and biochemistry and taxonomic assignment of the Chlorella (Chlorophyceae) strains of the Culture Collection of the University of Texas at Austin. J. Phycol. 1992, 28, 550–553. [Google Scholar] [CrossRef] [Scilit]
  60. Němcová, Y.; Kalina, T. Cell wall development, microfibril and pyrenoid structure in type strains of Chlorella vulgaris, C. kessleri, C. sorokiniana compared with C. luteoviridis (Trebouxiophyceae, Chlorophyta). Arch. Hydrobiol. Suppl. Bd. Algol. Stud. 2000, 100, 95–105. [Google Scholar] [CrossRef] [Scilit]
  61. Serra-Maia, R.; Bernard, O.; Gonçalves, A.; Bensalem, S.; Lopes, F. Influence of temperature on Chlorella vulgaris growth and mortality rates in a photobioreactor. Algal. Res. 2016, 18, 352–359. [Google Scholar] [CrossRef] [Scilit]
  62. Stephenson, A.L.; Dennis, J.S.; Howe, C.J.; Scott, S.A.; Smith, A.G. Influence of nitrogen-limitation regime on the production by Chlorella vulgaris of lipids for biodiesel feedstocks. Biofuels 2010, 1, 47–58. [Google Scholar] [CrossRef] [Scilit]
  63. Sakarika, M.; Kornaros, M. Effect of pH on growth and lipid accumulation kinetics of the microalga Chlorella vulgaris grown heterotrophically under sulfur limitation. Bioresour. Technol. 2016, 219, 694–701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Liang, Y.; Sarkany, N.; Cui, Y. Biomass and lipid productivities of Chlorella vulgaris under autotrophic, heterotrophic and mixotrophic growth conditions. Biotechnol. Lett. 2009, 31, 1043–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Kessler, E. Upper limits of temperature for growth in Chlorella (Chlorophyceae). Plant Syst. Evol. 1985, 151, 67–71. [Google Scholar] [CrossRef] [Scilit]
  66. Rosen, B.H.; Berliner, M.D.; Petro, M.J. Protoplast induction in Chlorella pyrenoidosa. Plant Sci. 1985, 41, 23–30. [Google Scholar] [CrossRef] [Scilit]
  67. Takeda, H. Sugar composition of the cell wall and the taxonomy of Chlorella (Chlorophyceae). J. Phycol. 1991, 27, 224–232. [Google Scholar] [CrossRef] [Scilit]
  68. Takeda, H. Chemical composition of cell walls as a taxonomical marker. J. Plant Res. 1993, 106, 195–200. [Google Scholar] [CrossRef] [Scilit]
  69. Vorobyev, K.; Andronov, E.; Rautian, M.; Skoblo, I.; Migunova, A.; Kvitko, K. An atypical Chlorella symbiont from Paramecium bursaria. Protistology 2009, 6, 39–44. [Google Scholar]
  70. Krivina, E.S.; Temraleeva, A.D.; Bukin, Y.S. Species delimitation and cryptic diversity analysis of Parachlorella-clade microalgae (Chlorophyta). Microbiology 2021, 90, 455–469. [Google Scholar] [CrossRef] [Scilit]
  71. Müller, J.; Friedl, T.; Hepperle, D.; Lorenz, M.; Day, J.G. Distinction between multiple isolates of Chlorella vulgaris (Chlorophyta, Trebouxiophyceae) and testing for conspecificity using amplified fragment length polymorphism and its rDNA sequences. J. Phycol. 2005, 41, 1236–1247. [Google Scholar] [CrossRef] [Scilit]
  72. Barten, R.; Djohan, Y.; Evers, W.; Wijffels, R.; Barbosa, M. Towards industrial production of microalgae without temperature control: The effect of diel temperature fluctuations on microalgal physiology. J. Biotechnol. 2021, 336, 56–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Ras, M.; Steyer, J.-P.; Bernard, O. Temperature effect on microalgae: A crucial factor for outdoor production. Rev. Environ. Sci. Bio/Technol. 2013, 12, 153–164. [Google Scholar] [CrossRef] [Scilit]
  74. Zhu, C.; Chen, S.; Ji, Y.; Schwaneberg, U.; Chi, Z. Progress toward a bicarbonate-based microalgae production system. Trends Biotechnol. 2022, 40, 180–193. [Google Scholar] [CrossRef] [Scilit]
  75. Bassi, A.; Saxena, P.; Aguirre, A.-M. Mixotrophic Algae Cultivation for Energy Production and Other Applications. In Algal Biorefineries: Volume 1: Cultivation of Cells and Products; Bajpai, R., Prokop, A., Zappi, M., Eds.; Springer: Dordrecht, The Netherlands, 2014; pp. 177–202. [Google Scholar]
  76. Kessler, E. Comparative physiology, biochemistry, and the taxonomy of Chlorella (Chlorophyceae). Plant Syst. Evol. 1976, 125, 129–138. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Cell morphology of Neochlorella semenenkoi IPPAS C-1210. Intensively growing three-day-old culture in liquid BG-11 medium (a); twenty-day-old culture grown on BG-11 plates (b); five-day-old (c) and six-month-old (d) cultures grown in liquid TAP medium; and cells with four (e), eight (f) and two autospores (g). The arrows indicate parent cell envelopes, and the asterisks indicate lipid droplets. Scale bars: 10 μm.
Figure 1. Cell morphology of Neochlorella semenenkoi IPPAS C-1210. Intensively growing three-day-old culture in liquid BG-11 medium (a); twenty-day-old culture grown on BG-11 plates (b); five-day-old (c) and six-month-old (d) cultures grown in liquid TAP medium; and cells with four (e), eight (f) and two autospores (g). The arrows indicate parent cell envelopes, and the asterisks indicate lipid droplets. Scale bars: 10 μm.
Diversity 15 00513 g001
Figure 2. Cell ultrastructure of Neochlorella semenenkoi IPPAS C-1210 in exponential (ac) and stationary (df) growth phases. Young ellipsoid cell with thin cell wall (a); mature spherical cell (b); parent cell with autospores (c); cell in stationary growth phase with thickened cell wall (d); and thickened cell walls of old cells (e,f). Ch: chloroplast; CW: cell wall; ACW: autospore cell wall; LB: lipid body; PCW: parent cell wall; N: nucleus; Nu: nucleolus; P: pyrenoid; S: starch grain; SE: starch envelope. The arrows point to the thylakoid pair penetrating the pyrenoids. Scale bars: 0.5 μm.
Figure 2. Cell ultrastructure of Neochlorella semenenkoi IPPAS C-1210 in exponential (ac) and stationary (df) growth phases. Young ellipsoid cell with thin cell wall (a); mature spherical cell (b); parent cell with autospores (c); cell in stationary growth phase with thickened cell wall (d); and thickened cell walls of old cells (e,f). Ch: chloroplast; CW: cell wall; ACW: autospore cell wall; LB: lipid body; PCW: parent cell wall; N: nucleus; Nu: nucleolus; P: pyrenoid; S: starch grain; SE: starch envelope. The arrows point to the thylakoid pair penetrating the pyrenoids. Scale bars: 0.5 μm.
Diversity 15 00513 g002
Figure 3. A Bayesian phylogenetic tree of the Chlorella clade (Trebouxiophyceae, Chlorophyta) based on the comparison of the nucleotide sequences of the SSU-ITS1-5.8S-ITS2 region (2611 bp). The support values are given for Bayesian Inference and Maximum Likelihood (PP/BP). The cut-off values for BI and ML are 0.7 and 70%, respectively. The model of nucleotide substitutions: GTR + I + G. The newly sequenced strain IPPAS C-1210 is highlighted in bold. Members of the genus Neochlorella gen. nov. are highlighted by a gray box. The strains of C. vulgaris, which is the type species of the genus Chlorella, are enclosed by a rectangle. The authentic strain C. vulgaris SAG 211-11b is in bold. Designations: *—authentic strain; T—type species; black square—forms colonies; white square—single cells; white triangle—does not produce bristles; black triangle—produces bristles; white circle—a free-living organism; black circle—an endosymbiotic organism; “−”—no information; Int—presence of introns, and the number of introns is indicated next to it; “–”—no intron. Scale bar: 0.04 substitutions/site.
Figure 3. A Bayesian phylogenetic tree of the Chlorella clade (Trebouxiophyceae, Chlorophyta) based on the comparison of the nucleotide sequences of the SSU-ITS1-5.8S-ITS2 region (2611 bp). The support values are given for Bayesian Inference and Maximum Likelihood (PP/BP). The cut-off values for BI and ML are 0.7 and 70%, respectively. The model of nucleotide substitutions: GTR + I + G. The newly sequenced strain IPPAS C-1210 is highlighted in bold. Members of the genus Neochlorella gen. nov. are highlighted by a gray box. The strains of C. vulgaris, which is the type species of the genus Chlorella, are enclosed by a rectangle. The authentic strain C. vulgaris SAG 211-11b is in bold. Designations: *—authentic strain; T—type species; black square—forms colonies; white square—single cells; white triangle—does not produce bristles; black triangle—produces bristles; white circle—a free-living organism; black circle—an endosymbiotic organism; “−”—no information; Int—presence of introns, and the number of introns is indicated next to it; “–”—no intron. Scale bar: 0.04 substitutions/site.
Diversity 15 00513 g003
Figure 4. ITS1 secondary structure of Neochlorella semenenkoi IPPAS C-1210, N. thermophila ITBB HTA 1–65, and C. volutis CCAP 211/120. Black arrow—CBC.
Figure 4. ITS1 secondary structure of Neochlorella semenenkoi IPPAS C-1210, N. thermophila ITBB HTA 1–65, and C. volutis CCAP 211/120. Black arrow—CBC.
Diversity 15 00513 g004
Figure 5. ITS2 secondary structure of Neochlorella semenenkoi. IPPAS C-1210, N. thermophila ITBB HTA 1–65, and C. volutis CCAP 211/120. Black arrow—CBC.
Figure 5. ITS2 secondary structure of Neochlorella semenenkoi. IPPAS C-1210, N. thermophila ITBB HTA 1–65, and C. volutis CCAP 211/120. Black arrow—CBC.
Diversity 15 00513 g005
Figure 6. Growth curves of Neochlorella semenenkoi IPPAS C-1210 at different temperatures under 100 (a) and 500 (b) μmol photons m−2 s−1. The error bars show standard deviations of the mean (n = 3). The temperature variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05).
Figure 6. Growth curves of Neochlorella semenenkoi IPPAS C-1210 at different temperatures under 100 (a) and 500 (b) μmol photons m−2 s−1. The error bars show standard deviations of the mean (n = 3). The temperature variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05).
Diversity 15 00513 g006
Figure 7. Growth of Neochlorella semenenkoi IPPAS C-1210 at different initial pH values. The error bars show standard deviations of the mean (n = 3). The variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05). One representative experiment out of two is shown.
Figure 7. Growth of Neochlorella semenenkoi IPPAS C-1210 at different initial pH values. The error bars show standard deviations of the mean (n = 3). The variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05). One representative experiment out of two is shown.
Diversity 15 00513 g007
Figure 8. Growth of Neochlorella semenenkoi IPPAS C-1210 in the concentration matrix of NaHCO3 and NaCl. One representative experiment out of two is shown.
Figure 8. Growth of Neochlorella semenenkoi IPPAS C-1210 in the concentration matrix of NaHCO3 and NaCl. One representative experiment out of two is shown.
Diversity 15 00513 g008
Figure 9. Growth of Neochlorella semenenkoi IPPAS C-1210 in modified BG-11 media with 20mM HEPES (pH 7.5) and different N sources. The error bars show standard deviations of the mean (n = 3). The variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05).
Figure 9. Growth of Neochlorella semenenkoi IPPAS C-1210 in modified BG-11 media with 20mM HEPES (pH 7.5) and different N sources. The error bars show standard deviations of the mean (n = 3). The variants with the same letter are not significantly different (one-way ANOVA analysis, post hoc Tukey HSD test; p < 0.05).
Diversity 15 00513 g009
Figure 10. Growth of Neochlorella semenenkoi IPPAS C-1210 on modified BG-11 agar media with different C and N sources. A series of 5 tenfold dilutions were spotted on the modified BG-11 media with 20 mM HEPES (pH 7.5) and containing different nitrogen sources (nitrate, 0.01% yeast extract, 0.01% casamino acids, and 0.01% tryptone) and carbon sources (atmospheric carbon dioxide, 0.1% glucose, 0.1% mannose, 0.1% lactose, 0.1% galactose, 0.1% glycerol, 0.001 M acetate, and 0.01 M acetate). The variants grown on standard BG-11 medium with 20 mM HEPES (pH 7.5) were used as a control. One of three repetitions is shown.
Figure 10. Growth of Neochlorella semenenkoi IPPAS C-1210 on modified BG-11 agar media with different C and N sources. A series of 5 tenfold dilutions were spotted on the modified BG-11 media with 20 mM HEPES (pH 7.5) and containing different nitrogen sources (nitrate, 0.01% yeast extract, 0.01% casamino acids, and 0.01% tryptone) and carbon sources (atmospheric carbon dioxide, 0.1% glucose, 0.1% mannose, 0.1% lactose, 0.1% galactose, 0.1% glycerol, 0.001 M acetate, and 0.01 M acetate). The variants grown on standard BG-11 medium with 20 mM HEPES (pH 7.5) were used as a control. One of three repetitions is shown.
Diversity 15 00513 g010
Table 1. Cultivation conditions of the strain IPPAS C-1210 for microscopy.
Table 1. Cultivation conditions of the strain IPPAS C-1210 for microscopy.
#MediumLight/μmol Photons m−2 s−1TemperatureAerationTime of Sampling
1solid BG-1130, 12:12 h L/D22 °Cnone20 days
2liquid BG-11
+20 mM HEPES, pH 7.5
100, continuous light32 °C1.5–2% CO23 days
3liquid TAP30, continuous light32° C
22 °C
none5 days
6 months
Table 2. Primers and PCR conditions for the SSU and ITS1-5.8S-ITS2 regions.
Table 2. Primers and PCR conditions for the SSU and ITS1-5.8S-ITS2 regions.
Amplified SequencePrimerSequence (5′–3′)PCR ConditionsReference
SSU
~2200 bp
EukA FAACCTGGTTGATCCTGCCAGT95 °C 10 min; 35 cycles (95 °C 30 s, 62 °C 30 s, and 72 °C 2 min); and 72 °C 6 min[28]
18L RCACCTACGGAAACCTTGTTACGACTT[29]
ITS1-5.8S-
ITS2
785 bp
ITS5 FGGAAGTAAAAGTCGTAACAAGG95 °C 10 min; 35 cycles (95 °C 30 s, 55 °C 30 s, and 72 °C 1 min); and 72 °C 6 min[30]
ITS4 RTCCTCCGCTTATTGATATGC
Table 3. Comparative characteristics of some Chlorella clade representatives.
Table 3. Comparative characteristics of some Chlorella clade representatives.
CharacteristicsN. semenenkoi
IPPAS C-1210
N. thermophila
ITBB HTA 1–65
C. volutis
CCAP 211/120
C. sorokiniana
SAG 211-8k
C. lewinii
CCAP 211/90
C. vulgaris
SAG 211-11b
Cellssolitary
Bristleno
Mucilageno
Adult cell shapespherical or ellipsoidalspherical or ellipsoidalsphericalellipsoidal or sphericaloval and egg
shaped
always spherical
Young cell shapespherical to ellipsoidalspherical to ellipsoidalspherical to slightly ovalellipsoidalovalspherical
Cell size (μm)3.5−6.31.5−2.55.0−6.54.5–5.5 × 3.5–5.44.0–6.02–6
Chloroplastsingle, parietal, and cup-shapedsingle, parietal, and cup-shapedsingle, parietal, and cup- or saucer-shapedsingle, shallow, and cup-shapedsingle, parietal, and cup-, girdle- or saucer-shapedsingle and deep cup-shaped
Pyrenoidsingle, spherical, and 0.4−0.8 μm in diametersingle, spherical, and 0.4−0.6 μm in diametersingle, ellipsoid to sphericalsinglesingle andbroadly
ellipsoidal to spherical
single
Starch envelopetwo starch halves
Cell wall20–40 nm single-layer in young cells, and
100–200 nm non-homogenous in mature cells
~60–80 nm and double-layeredND22 nm and single-layered in young cells; 60 nm and multilayered in older cellsND180–200 nm
Main storage productsLipids and starchStarchNDStarch and lipidsNDLipids and starch
Reproductionby 2–8 autosporesby 2–4 (sometimes more, needs clarification) autosporesNDby 2–8 (16) autosporesNDby 2–16 autospores
Intron in the SSU440 bpnonononono
Type locationfreshwater
reservoir
rooftopsfreshwater
reservoir
freshwater
reservoir
soil in pondfreshwater
reservoir
NaCl optimum/limits0 M/2MNDNDND/1–3% (0.2–0.6 M)NDND/3–4% (=0.6–0.7 M)
Temperature optimum/limits30 °C/36 °C (41 °C–43 h)33 °C/42 °C (45–3h)ND38–39 °C/42 °CND20–25 °C/28–30 °C
pH optimum/lower, upper limits8–9/4, 11NDNDND/3.5–5ND5–8/4, 9.5
Organic C sources acetate
glucose
galactose
mannose
glycerol

+
+
+


+?
N/D
N/D
N/D
N/D
ND

+
+

N/D
ND
+
+
N/D
N/D
+ (under light)
N sources
nitrate
ammonium
urea
tryptone/peptone
yeast extract
casamino acids

+
+
+
+
+
+

N/D
+
N/D
N/D
N/D
N/D

+
N/D
N/D
N/D
N/D
N/D

+
+
N/D
N/D

+

+
N/D
N/D
N/D
N/D
N/D

+
N/D
N/D
+
N/DN/D
ReferencesPresent study[7][6][3,51,57,58,59,60][6][1,59,60,61,62,63,64,65]
ND = no data.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Krivina, E.S.; Bobrovnikova, L.A.; Temraleeva, A.D.; Markelova, A.G.; Gabrielyan, D.A.; Sinetova, M.A. Description of Neochlorella semenenkoi gen. et. sp. nov. (Chlorophyta, Trebouxiophyceae), a Novel Chlorella-like Alga with High Biotechnological Potential. Diversity 2023, 15, 513. https://doi.org/10.3390/d15040513

AMA Style

Krivina ES, Bobrovnikova LA, Temraleeva AD, Markelova AG, Gabrielyan DA, Sinetova MA. Description of Neochlorella semenenkoi gen. et. sp. nov. (Chlorophyta, Trebouxiophyceae), a Novel Chlorella-like Alga with High Biotechnological Potential. Diversity. 2023; 15(4):513. https://doi.org/10.3390/d15040513

Chicago/Turabian Style

Krivina, Elena S., Lidia A. Bobrovnikova, Anna D. Temraleeva, Alexandra G. Markelova, David A. Gabrielyan, and Maria A. Sinetova. 2023. "Description of Neochlorella semenenkoi gen. et. sp. nov. (Chlorophyta, Trebouxiophyceae), a Novel Chlorella-like Alga with High Biotechnological Potential" Diversity 15, no. 4: 513. https://doi.org/10.3390/d15040513

APA Style

Krivina, E. S., Bobrovnikova, L. A., Temraleeva, A. D., Markelova, A. G., Gabrielyan, D. A., & Sinetova, M. A. (2023). Description of Neochlorella semenenkoi gen. et. sp. nov. (Chlorophyta, Trebouxiophyceae), a Novel Chlorella-like Alga with High Biotechnological Potential. Diversity, 15(4), 513. https://doi.org/10.3390/d15040513

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop