One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta)
Abstract
1. Introduction
2. Materials and Methods
2.1. Taxon Sampling
2.2. DNA Isolation, Amplification, and Sequencing
2.3. Phylogenetic Analyses
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choi, S.S.; Bakalin, V.A.; Sun, B.-Y. Scapania and Macrodiplophyllum in the Russian Far East. Bot. Pacifica 2012, 1, 31–95. [Google Scholar] [CrossRef]
- Heinrichs, J.; Bombosch, A.; Feldberg, K.; Kreier, H.-P.; Hentschel, J.; Eckstein, J.; Long, D.; Zhu, R.-L.; Schäfer-Verwimp, A.; Schmidt, A.R.; et al. A phylogeny of the northern temperate leafy liverwort genus Scapania (Scapaniaceae, Jungermanniales). Mol. Phylogenetics Evol. 2012, 62, 973–985. [Google Scholar] [CrossRef] [PubMed]
- Schljakov, R.N. Hepatics of the North USSR; Nauka: Leningrad, Russia, 1981; Volume 4, p. 221. [Google Scholar]
- Klimova, K.G.; Bakalin, V.A. Two Scapania Species (Scapaniaceae) Newly Recorded from Kamchatka. Arctoa 2017, 26, 125–131. [Google Scholar] [CrossRef]
- Ignatov, M.S.; Maksimov, A.I.; Fedorova, A.V.; Ignatova, E.A. On the Taxonomy of Fontinalis Gracilis (Fontinalaceae, Bryophyta) and Superficially Similar Species. Nova Hedwig. Beih. Beih. 2020, 150, 243–264. [Google Scholar] [CrossRef] [PubMed]
- Ignatova, E.A.; Kuznetsova, O.I.; Shafigullina, N.R.; Fedosov, V.E.; Ignatov, M.S. The Genus Pylaisia (Pylaisiaceae, Bryophyta) in Russia. Arctoa 2020, 29, 135–178. [Google Scholar] [CrossRef]
- Ignatova, E.A.; Czernyadjeva, I.V.; Fedorova, A.V.; Ignatov, M.S. A Morphologocal and Molecular Phylogengetic Study of the Genus Calliergon (Calliergonaceae, Bryophyta) in Russia. Arctoa 2021, 30, 8–24. [Google Scholar] [CrossRef]
- Vilnet, A.A.; Konstantinova, N.A.; Troitsky, A.V. Molecular Insight on Phylogeny and Systematics of the Lophoziaceae, Scapaniaceae, Gymnomitriaceae and Jungermanniaceae. Arctoa 2010, 19, 31–50. [Google Scholar] [CrossRef]
- Feldberg, K.; Váňa, J.; Krusche, J.; Kretschmann, J.; Patzak, S.D.F.; Pérez-Escobar, O.A.; Rudolf, N.R.; Seefelder, N.; Schäfer-Verwimp, A.; Long, D.G.; et al. A Phylogeny of Cephaloziaceae (Jungermanniopsida) Based on Nuclear and Chloroplast DNA Markers. Org. Divers. Evol. 2016, 16, 727–742. [Google Scholar] [CrossRef]
- Friedl, T. Evolution of the Polyphyletic Genus Pleurastrum (Chlorophyta): Inferences from Nuclear-Encoded Ribosomal DNA Sequences and Motile Cell Ultrastructure. Phycologia 1996, 35, 456–469. [Google Scholar] [CrossRef]
- Milyutina, I.A.; Goryunov, D.V.; Ignatov, M.S.; Ignatova, E.A.; Troitsky, A.V. The Phylogeny of Schistidium (Bryophyta, Grimmiaceae) Based on the Primary and Secondary Structure of Nuclear RDNA Internal Transcribed Spacers. Mol. Biol. 2010, 44, 883–897. [Google Scholar] [CrossRef]
- Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal Primers for Amplification of Three Non-Coding Regions of Chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef] [PubMed]
- Bakalin, V.; Maltseva, Y.; Vilnet, A.; Choi, S.S. The Transfer of Tritomaria koreana to Lophozia Has Led to Recircumscription of the Genus and Shown Convergence in Lophoziaceae (Hepaticae). Phytotaxa 2021, 512, 41–56. [Google Scholar] [CrossRef]
- Pacak, A.; Szweykowska-Kulińska, Z. Molecular Data Concerning Alloploid Character and the Origin of Chloroplast and Mitochondrial Genomes in the Liverwort Pellia borealis. Plant Biotechnol. J. 2000, 2, 101–108. [Google Scholar]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Huson, D.H.; Bryant, D. Application of Phylogenetic Networks in Evolutionary Studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
- Clement, M.; Snell, Q.; Walke, P.; Posada, D.; Crandall, K. TCS: Estimating Gene Genealogies. In Proceedings of the Proceedings 16th International Parallel and Distributed Processing Symposium, Washington, DC, USA, 15–19 April 2002; IEEE: Fort Lauderdale, FL, USA, 2002; p. 33. [Google Scholar]
- Leigh, J.W.; Bryant, D. Popart: Full-feature Software for Haplotype Network Construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Pisarenko, O.Y. Mosses of the Bolshoi Annachag Range (Magadan Province, Russian Far East). Arctoa 2015, 24, 187–193. [Google Scholar] [CrossRef]
- Potemkin, A.D. Evolution, Phylogeny and Classification of Scapaniaceae Family (Hepaticae). Ph.D. Dissertation, Botanical Institute, Saint-Petersburg, Russia, 2001. [Google Scholar]
- Potemkin, A.D. On the Origin, Evolution and Classification of the Genus Scapania (Dum.) Dum. (Hepaticae). J. Hallori. Bot. Lab. 1998, 85, 33–61. [Google Scholar]
Specimen | Specimen Voucher | GenBank Accession Number, ITS1–2 |
---|---|---|
Scapania compacta (Roth) Dumort. | Germany, Saxony Anhalt, Treseburg-Thale, Eckstein 1409 (GOET) | JN631398 |
Scapania compacta (Roth) Dumort. | Spain, La Palma, Cubo de Galga, Huneck JE-H3294 (JE) | JN631399 |
Scapania compacta (Roth) Dumort. | United Kingdom, Argyll, Glencoe, Long & Murray 11492 (JE) | JN631400 |
Scapania crassiretis Bryhn | Russia, Russian Far East, Primorsky Territory, V.A. Bakalin, P-18-10-12 (VBGI) | OP654513 |
Scapania crassiretis Bryhn | Russia, Russian Far East, Primorsky Territory, K.G. Klimova and V.A. Bakalin, Prim-16-15-16 (VBGI) | OP654514 |
Scapania kaurinii Ryan | Russia, Chitinskaya Province, V.A. Bakalin, 11-1-00 (KPABG) | EU791759 |
Scapania kaurinii Ryan | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-30-6-11 (VBGI) | OP654517 |
Scapania kaurinii Ryan | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-22-11-13 (VBGI) | OP654515 |
Scapania kaurinii Ryan | Russia, Russian Far East, Magadan Province, Yagodninsky District, V.A. Bakalin, Mag-25-27-14 (VBGI) | OP654516 |
Scapania kaurinii Ryan | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-35-33-11 (VBGI) | OP654518 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Kamchatka Territory, K.G. Klimova, Kam-62-4-16 (VBGI) | OP654519 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-19-6-10 (VBGI) | OP654520 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-22-7-13 (VBGI) | OP654521 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-61-40-11 (VBGI) | OP654523 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-61-42-11 (VBGI) | OP654524 |
Scapania magadanica S.S. Choi, Bakalin & B.-Y Sun | Russia, Russian Far East, Magadan Province, V.A. Bakalin, Mag-61-35-11 (VBGI) | OP654522 |
Scapania spitsbergensis (Lindb.) Müll. Frib. | Norway, Spitsbergen, Konstantinova 90-2-06 (KPABG) | EU791761 |
Scapania spitsbergensis (Lindb.) Müll. Frib. | Russia, Buryatiya Rep., Konstantinova 121-6-02 (KPABG) | EU791760 |
Locus | Sequence (5′-3′) | Direction | Annealing Temperature (°C) | Reference |
---|---|---|---|---|
ITS 1–2 nrDNA | CGTTGTGAGAAGTTCATTAAACC | forward | 64 | Feldberg et al., 2016 [9] |
ITS 1–2 nrDNA | ACCTGCGGAAGGATCATTG | forward | 58 | Friedl, 1996 [10] |
ITS 1–2 nrDNA | GATATGCTTAAACTCAGCGG | reverse | 58 | Milyutina et al., 2010 [11] |
trnL–F cpDNA | CGAATTCGGTAGACGCTACG | forward | 62 | Taberlet et al., 1991 [12] |
trnL–F cpDNA | CGAAATTGGTAGACGCTGCG | forward | 62 | Bakalin et al., 2021 [13] |
trnL–F cpDNA | ATTTGAACTGGTGACACGAG | reverse | 58 | Taberlet et al., 1991 [12] |
trnL–F cpDNA | TGCCAGAAACCAGATTTGAAC | reverse | 58 | Bakalin et al., 2021 [13] |
trnG-intron cpDNA | ACCCGCATCGTTAGCTTG | forward | 56 | Pacak et al., 2000 [14] |
trnG-intron cpDNA | GCGGGTATAGTTTAGTGG | reverse | 54 | Pacak et al., 2000 [14] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maltseva, Y.D.; Fedosov, V.E.; Bakalin, V.A.; Klimova, K.G.; Choi, S.S. One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta). Diversity 2023, 15, 205. https://doi.org/10.3390/d15020205
Maltseva YD, Fedosov VE, Bakalin VA, Klimova KG, Choi SS. One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta). Diversity. 2023; 15(2):205. https://doi.org/10.3390/d15020205
Chicago/Turabian StyleMaltseva, Yulia D., Vladimir E. Fedosov, Vadim A. Bakalin, Ksenia G. Klimova, and Seung Se Choi. 2023. "One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta)" Diversity 15, no. 2: 205. https://doi.org/10.3390/d15020205
APA StyleMaltseva, Y. D., Fedosov, V. E., Bakalin, V. A., Klimova, K. G., & Choi, S. S. (2023). One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta). Diversity, 15(2), 205. https://doi.org/10.3390/d15020205