Diversity of Cyanobacteria and Algae in Biological Soil Crusts of the Northern Ural Mountain Region Assessed through Morphological and Metabarcoding Approaches

Abstract

In mountain regions, biological soil crusts (BSCs) provide essential ecological services by being involved in primary production and nitrogen fixation. Eukaryotic algae and cyanobacteria are important photosynthetic components of these unique cryptogamic communities. Here, we present an overview of the eukaryotic and prokaryotic diversity of such phototrophs in BSCs in the mountain tundra of the northern Ural Mountains. Such assessment is based on morphological surveys and the first metabarcoding analysis in the region. In total, 166 taxa of Cyanobacteria and 256 eukaryotic algae (including Euglenophyta, Ochrophyta, Dinophyta, Bacillariophyta, Chlorophyta, and Charophyta) were identified. For the first time, 86 taxa new to the BSCs of the high-mountain belt of the region were discovered. Considering species composition, Cyanobacteria and Chlorophyta are the most abundant taxa in all the analyzed BSCs. The genera Nostoc, Coccomyxa, Chlamydomonas, Leptolyngbya, Stenomitos, Pycnacronema, Stigonema, and Eunotia had the highest number of taxonomic units. These groups shape the structure, function, and ecology of the BSC communities in the studied region. Our results show that BSCs in the tundras of the Ural Mountains have a high active and passive biodiversity of terrestrial cyanobacteria and algae. Both implemented methods resulted in similar results with a comparable number of algae and cyanobacteria species per sample. Metabarcoding could be implemented in future in the region to accurately screen photosynthetic organisms in BSCs.

1. Introduction

Biological soil crusts (BSCs) are primal producers of organic matter in mountain and arctic regions’ soils [1,2,3,4]. Microalgae and cyanobacteria are important components of these cryptogamic communities, playing a critical role in nutrient and nitrogen cycling and highly influencing soil oxygen and hydrological regimes. They are active in the top soil layer, forming a thin crust that helps to stabilize soil, maintain its structure, and protect against wind, thermokarst, and water erosions [1,2,3,4,5,6]. In extreme habitats such as alpine and polar ecosystems, where soils are often shallow and exposed, BSCs dominate, providing an important source of nutrition and water for small organisms that would otherwise struggle to survive. Despite the high resilience to extreme conditions of these unique communities, climate change will modify the habitats of BSCs through shifts in temperature, irradiance, and precipitation, all of which will result in a significant restructuring of BSC communities and their associated diversity and composition [7,8]. Such alternations in a leading component of the vegetation cover in mountain regions will likely trigger drastic changes in soil formation, the replacement of species, and the alteration of nutrient cycles. The taxonomic diversity and species composition of BSCs are highly sensitive to the smallest fluctuations occurring in the ecosystem, thus serving as a good indicator of the effect climate change has on polar and high-mountain ecosystems. To monitor changes in BSCs under climatic fluctuations, extensive data on their diversity, structure, and functional characteristics are required, covering a wide range of habitats, including high-mountain, arctic, and polar ecosystems. Such studies have been actively carried out on Svalbard and Antarctica [7,8,9,10,11,12,13,14,15,16,17,18] but are still rare for the Russian Arctic, even though its territories are vast and diverse [19,20,21,22,23,24,25,26,27]. Traditionally, the diversity of cyanobacteria and soil algae in BSCs is recovered through strain isolation on selective media, with further identification of species based on morphological characters. Only a fraction of the total diversity of algae and cyanobacteria can be revealed through such an approach. Modern advances in taxonomic tools have introduced DNA metabarcoding with the ability to recover hidden diversity. This method has been proven to be successful in soil samples, revealing interesting, unique, and cryptic species and benefiting from identifying multiple taxa simultaneously in a single sample from total DNA [28]. In addition, metabarcoding enables complex studies of whole communities with the potential to detect ecological and functional networks and assess differences in species richness between similar habitats [29]. DNA metabarcoding has significantly expanded the knowledge of microorganism communities (algae, bacteria, fungi, and archaea) in a wide range of natural biomes [18]. Although this method is rarely implemented in BSCs in the Arctic and mountain regions, it is slowly starting to gain popularity, with a handful of articles published with promising and interesting results, in particular in the Arctic and Antarctica [18] and in the French Alps [30]. Metabarcoding studies have revealed that BSCs in the Arctic and Antarctica form unique ecosystems with an unexpectedly high biodiversity of cyanobacteria and eukaryotic algae, which were found to be the most abundant among autotrophic organisms in the BSCs [18]. A similar pattern was also observed in the French Alps [30]. Further use of DNA metabarcoding in studies of BSCs should aim to expand their application in diverse ecosystems under vast ecological conditions, enlarging their spatial coverage.

BSCs are widespread on bare spots in mountain tundra and in open forests, common at high altitudes in the Ural mountains. This mountain chain is located in northern Eurasia, and the Polar, Subpolar, and Northern Urals are its highest regions. The Urals are known for a remarkable diversity of flora and fauna, which is attributed to its unique location between Europe and Asia. The last glaciation also had a profound impact and shaped its present-day diversity. All of this makes the region particularly interesting for diversity studies.

The diversity of algae and cyanobacteria in BSCs has been studied since 2005 [20,21,22,23,24,25,26]. Knowledge of the species richness, abundance, and functional characteristics of BSC algae was accumulated through mostly traditional methods. Data on the diversity of cyanobacteria are actively expanding through ongoing research efforts focused on previously inaccessible areas and with the implementation of novel and advanced molecular techniques [20,21,22,23,24,25,26,27].

Combining morphological studies and DNA metabarcoding, the current paper summarizes data on the taxonomic and structural diversity of cyanobacteria and eukaryotic algae in biological soil crust (BSC) communities in mountain and tundra habitats in the northern regions of the Urals.

2. Materials and Methods

2.1. BSCs Sampling Sites

The study combined a literature review and new data to make an inventory of algal and cyanobacterial species in BSCs in three regions of the Ural Mountains, located in the northern Russian Arctic (Eurasia) [20,21,22,23,24,25,26,27,31]. The sampling locations are presented in

Table 1. BSCs sampling locations in the Ural Mountains.

Region	Collection Date	Sampling Site	Elevation (m)	Coordinates
Polar Urals (PU)	August, 2011	Mount Konstantinov Kamen	483	68.48 N, 66.23 E
	August, 2011	Malyi Manisey	525	68.47 N, 66.34 E
	July 2019, 2022	Ochenyrd ridge	153–1161	67.91–68.19 N, 65.21–66.05 E
	August 2003, 2013	Chrebtovy Ridge	153	67.38 N, 64.67 E
Subpolar Urals (SU) and metabarcoding samples (SUm) *	August 2005, 2009; July, 2010, 2012, 2019, 2021 *	Maldynyrd Ridge	1538	65.22–65.31 N, 60.26–60.52 E
	August, 2005, 2009; July, 2010, 2012, 2019, 2021 *	Barkova Mountain	1366	65.21 N, 60.26 E
	July, 2010	Starik Mountain	1233	65.16 N, 60.29 E
Northern Urals (NU)	June–July, 2018–2019	Telpos-iz Ridge	495–1248	63.40–63.54 N, 58.54–59.07 E
	July, 2016, 2018	Mount Pelener	585–1067	63.38 N, 58.90 E

Note: *—samples for metabarcoding.

and Figure 1. The Polar, Subpolar, and Northern Urals lay in a zone of harsh continental climate, characterized by long cold winters, cool summers, short growing seasons, relatively high precipitation, and extremely low evaporation [32]. The average annual air temperature is −4.4 °C, with January as the coldest month (−18–21 °C) and July (8–11 °C) as the warmest. In June-July, temperatures can exceed +20–30 °C, though summers in the Urals are generally cold with unstable weather. The growing season lasts less than 80 days. The windward (western and southwestern) slopes of the Urals experience the largest rainfall due to the natural movement of the air masses from the Atlantic, and thus, they are the most humid (1000–1500 mm) [32]. The average temperatures in January and July and the annual precipitation in the Ural regions are as follows: Polar (−22 °C, +10–11 °C, 1000 mm), Subpolar (−22 °C, +12–13 °C, 1100 mm), and Northern (−21 °C, +15–17 °C, 1200 mm) [32]. The studied BSCs are located in bare spots on acidic soils with low base saturation and low nitrogen, phosphorus, and other biogenic element content (

Table 2. Environmental parameters of the soil underneath the sampled BSCs.

Parameter	PU	SU, SUm	NU
pH (H2O)	3.3–6.9	4.08–6.2	4.38–5.48
pH (KCl)	3.2–6.1	2.7–5.3	3.40–4.23
C [mg/kg]	0.42–13.9	0.22–3.9	0.35–5.8
N [mg/kg]	0.042–0.97	0.026–0.27	0.035– 0.51
P2O5 [mg/kg]	30.90–225.6	2.6–1520	15–500
Ca2+ [mg/kg]	0.71–73.71	0.26–72	<0.5–2.79
Mg2+ [mg/kg]	0.26–2.50	0.12–24	<0.10–0.64

Note: The range of values is given for the parameters according to [22].

). The soil moisture of bare spots ranges from 2.2 to 50% [22,23,24,26,27].

2.2. BSCs Sampling and Algae Cultivation

Each sample consisted of 5–6 subsamples with 3 cm × 5 cm × 2 cm dimensions. Samples were cut from the soil with a knife (flame sterilized), placed in paper bags, air-dried, and transported to the laboratory [33]. Algae and cyanobacteria diversity were revealed by studying freshly collected samples under a microscope (algae and cyanobacteria forming mass overgrowth on the soil surface were identified) and analyzing mixed/monocultures grown on liquid or solid BG11 media [33]. The protocol used to isolate and grow the strains was adapted from Andersen [33]. The cultivating conditions used for mixed and unialgal cultures were as follows: 45 μmol m⁻²s⁻¹ PAR under Uniel ULI-P11-35W/SPFR IP40 WHITE l phytolamp (Beijing, China) with 12/12 h light/dark period at 25 °C. Additional details about the methods used to study the diversity of algae and cyanobacteria in the Ural region can be found in published works [21,22,23,24,25,26,27]. The strains of the algae and cyanobacteria described in the article were deposited in the culture collection of the Institute of Biology, Komi Scientific Center, Ural Branch of the Russian Academy of Sciences (SYKOA, Syktyvkar, Russia, https://ib.komisc.ru/sykoa/eng/, accessed on 8 August 2023).

2.3. Algae and Cyanobacteria Identification

The species were visualized and identified under a Nikon 80i Nomarski DIC Microscope (Tokyo, Japan), equipped with Nikon Digital Sight Ds―2Mv camera (Tokyo, Japan). Detailed morphological descriptions and pictures for some taxa in the checklist are available at https://ib.komisc.ru/sykoa/eng/ and http://kpabg.ru/cyanopro. The algal and cyanobacteria species were described following the guidelines of Russian and international identification keys [34,35,36,37,38,39] and modern systematic reviews for individual taxa. The molecular analysis was performed for some strains of algae and cyanobacteria analyzed in this work and published [40,41,42].

The current nomenclature for algae and cyanobacteria is devised according to international database “AlgaeBase” [43].

2.4. DNA Extraction

For metabarcoding, 8 samples were taken from cryogenic spots in different mountain tundra communities in the Subpolar Urals in July 2021 (Table 1, Figure 1). The BSCs were cut into cubes (3 × 5 × 2 cm) in three replicates, placed in sterile Petri dishes, and immediately frozen at −45 °C. Before total DNA isolation, each sample was thawed, and 0.25 g of a mixed BSC sample from three replicates was taken. The total DNA was isolated using the DNeasy PowerSoil Kit according to the manufacturer’s protocol.

For eukaryotic algae, PCR amplifications targeted the SSU V9 region and ITS1. The primer pair V918S BoenF (5′–GTACACACCGCCCGTC–3′)—ITS2_broad (5′–GCTGCGTTCTTCATCGWTR–3′) was chosen, as proposed by Boenigk et al. [44] and Bock et al. [45]. These primers cover the variable V9 region of the 18S rDNA and complete ITS1, which allows them to be used both for a phylogenetic analysis of the 18S rDNA region and for the species identification of algae. Currently, for most algae groups, ITS data are required for species identification. For cyanobacteria, 16S1515F (5′–AGTCGTAACAAGGTAGCCGTACC–3′)—B23SR (5′–CTTCGCCTCTGTGTGCCTAGG–3′) was used, spanning the end of the 16S–ITS-beginning of 23S rDNA [46,47]. DNA samples were transferred to the «Evrogen» (Moscow, Russia) for subsequent sequencing.

2.5. Amplification, Library Preparation, and Sequencing

The quality of the obtained genomic DNA samples was checked on an agarose gel. Amplification of variable regions was carried out using specific primers. Sequencing was performed on Illumina MiSeq, set v3, pair end, read length 2 × 300 cycles. Libraries were prepared for sequencing according to the protocol described in the 16S Metagenomic Sequencing Library Preparation manual (Part # 15,044,223 Rev. B; Illumina). After receiving the amplicons, the libraries were purified and mixed using the SequalPrep™ Normalization Plate Kit (ThermoFisher, Cat # A10510–01). A quality control of the obtained pools of libraries was carried out using the Fragment Analyzer system, and a quantitative analysis was carried out using qPCR.

Each library was sequenced on Illumina MiSeq (read length—300 bp on both sides of the fragments) using a MiSeq Reagent Kit v3 (600 cycles). FASTQ files were generated using bcl2fastq v2.17.1.14 Conversion Software (Illumina, San Diego, USA). After filtering the data, 834,606 paired reads were obtained for 8 samples, sequenced with eukaryotic primers. For cyanobacteria, 1092254 paired reads were obtained for 8 samples. The paired reads were obtained for 8 samples. The PhiX phage library was used to control sequencing parameters. Samples were demultiplexed by the sequencing company using Illumina sequencing software (version v3).

2.6. Bioinformatic Pipeline

The base quality of the sequence reads was checked using the FastQC software [48]. The sequence filtering was performed using QIIME2 tools [49]. For filtering, denoising, dereplication, and obtaining amplicon sequence variants, the DADA2 plugin for QIIME2 was used (max_ee = 2; trunc_q = 2; pooling method = independent; chimera method = consensus). In this work, we used only forward sequences with a length of 264 bp for cyanobacteria and 259 bp for eukaryotes. Operational taxonomic units (OTUs) were delineated at a similarity of 97% for eukaryotic and 93% for prokaryotic datasets using the VSEARCH plugin for QIIME2 [49,50]. Taxonomic affiliation was determined using the GenBank database through the BLASTn algorithm to assign them to species and genus levels. For this, the SEED2 program was used [51]. For the species identification of eukaryotes, a threshold of similarity of 97% was chosen for the V918S–ITS1 sequences. In the case of presence of only 18S sequences in the GenBank database, a threshold of 99% was used. Sequences with lower values were identified at the genus level.

To identify cyanobacteria, a threshold of 93% similarity was chosen for ITS sequences, as proposed by many authors [52,53,54,55]. Sequences with lower values were identified only at a genus rank. All identifications at the species and genus level have been checked on maximum likelihood (ML) phylogenetic trees. For this, sequences have been aligned using MAFFT [56] and processed in RAML [57]. In this work, the analysis used only data on OTUs that were identified by their genus and species clades for a correct comparison with morphological data. OTUs with unclear systematic positions have not yet been considered due to the possible errors and incorrect interpretations of data that could arise due to incomplete reference databases and unclear nutritional modes of unknown organisms.

The sequences of the OTUs of cyanobacteria and eukaryotic algae are represented in the Supplementary File S1. The datasets analyzed during the current study are available in the NCBI repository (accession: PRJNA1016378).

3. Results

3.1. Diversity of Algae and Cyanobacteria in BSCs Based on Morphological Analysis

Based on the morphological analysis, 343 taxa (below the genus level) of soil algae and cyanobacteria from six phyla were discovered in BSCs from various mountain tundra communities in the northern Urals. The phyla were Cyanobacteria (135), Chlorophyta (131), Bacillariophyta (52), Charophyta (14), Ohrophyta (12), and Euglenophyta (1) (

Table 3. List of terrestrial cyanobacteria and eukaryotic algae species in BSCs in diverse mountain tundra communities in the northern regions of the Urals: morphological data for PU (Polar Urals), SU (Subpolar Urals), and NU (Northern Urals) and metabarcoding data for SUm (Subpolar Urals). N—number of OTUs.

Taxon	PU	SU	NU	SUm
Cyanobacteria
Albertania spp.				+ (N = 2)
Aliterella sp.				+ (N = 1)
Ammatoidea normanii West et G.S.West			+
Anabaena cylindrica Lemmerm.1		+
Anabaena spp.		+	+	+ (N = 1)
Ancylothrix sp.				+ (N = 1)
Aphanocapsa fuscolutea Hansg.	+
Aphanocapsa muscicola (Menegh.) Wille	+	+	+
Aphanocapsa parietina Nägeli	+	+
Aphanocapsa rivularis (Carmich.) Rabenh.	+
Aphanocapsa spp.	+	+	+
Aphanothece castagnei (Kütz.) Rabenh.		+
Aphanothece microscopica Nägeli		+
Aphanothece saxicola Nägeli	+	+	+
Aphanothece stagnina (Spreng.) A.Braun	+	+
Aphanothece pallida (Kütz.) Rabenh.	+	+
Aphanothece sp.	+
Calothrix braunii Bornet et Flahault		+	+
Calothrix clavata G.S.West		+
Calothrix elenkinii Kossinsk. 1		+
Calothrix parietina Thur. ex Bornet et Flahault	+	+	+
Calothrix spp.	+	+	+
Chamaesiphon polonicus (Rostaf.) Hansg.	+
Chlorogloea purpurea Geitler	+
Chroococcidiopsis sp.				+ (N = 1)
Chroococcus cohaerens (Bréb.) Nägeli	+	+
Chroococcus giganteus W.West		+
Chroococcus minor (Kütz.) Nägeli		+
Chroococcus minutus (Kütz.) Nägeli	+	+
Chroococcus spelaeus Erceg.	+
Chroococcus tenax (Kirchn.) Hieronymus	+
Chroococcus turgidus (Kütz.) Nägeli		+
Chroococcus varius A.Braun	+
Chroococcus spp.	+			+ (N = 2)
Cyanobacterium cedrorum (Sauv.) Komárek, Kopecky et Cepák		+
Cyanosarcina chroococcoides (Gaitler) Kováčik	+
Cyanosarcina sp.	+
Cyanothece aeruginosa (Nägeli) Komärek	+
Cyanothece spp.				+ (N = 2)
Cylindrospermum muscicola Kutz. ex Bornet et Flahault			+
Cylindrospermum spp.	+			+ (N = 2)
Dactylothamnos antarcticus Fiore, Genuario, Komárek et al.				+ (N = 1)
Dasygloea cf. lamyi (Gomont ex Gomont) Senna et Komárek 1		+
Dasygloea sp.	+
Desmonostoc muscorum (Bornet et Flahault) Hrouzek et Ventura 1	+	+	+
Desmonostoc spp.				+ (N = 5)
Dichothrix gypsophila Bornet et Flahault	+	+
Dolichospermum spp.				+ (N = 3)
Drouetiella lurida (Gomont) Mai, J.R.Johansen et Pietrasiak 1,2 [41]		+
Drouetiella ramosa Davydov, Vilnet, Patova et Novakovskaya 1,2 [58]		+
Drouetiella spp.				+ (N = 4)
Eucapsis minor (Skuja) Elenkin		+
Fischerella ambigua (Kütz. ex Bornet et Flahault) Gomont f. majuscula (Woron.) Elenkin		+
Fischerella major Gomont		+
Fischerella muscicola Gomont 1	+	+	+
Fischerella spp.		+	+
Geitlerinema sp.				+ (N = 1)
Gloeocapsa alpina Nägeli	+	+
Gloeocapsa compacta Kütz.	+	+
Gloeocapsa kuetzingiana Nägeli ex Kütz.	+
Gloeocapsa punctata Nägeli		+
Gloeocapsa ralfsii (Harvey) Lemmerm.	+
Gloeocapsa rupestris Kütz.	+	+
Gloeocapsa sanguinea (C.Agardh) Kütz.	+
Gloeocapsa violacea Kütz.	+	+
Gloeocapsopsis dvorakii (Novácek) Komárek et Anagn. ex Komárek		+	+
Gloeocapsopsis magma (Bréb.) Komárek et Anagn. ex Komárek	+	+	+
Gloeocapsopsis sp.	+
Gloeothece confluens Nägeli	+	+
Gloeothece rupestris (Lyngb.) Bornet	+	+
Gloeothece tepidariorum (A.Braun) Lagerh.	+
Haloleptolyngbya sp.				+ (N = 1)
Hapalosiphon pumilus Kirchner ex Bornet et Flahault		+
Heteroscytonema crispum (Bornet ex De Toni) G.B.McGregor et Sendall		+
Jaaginema pseudogeminatum (G.Schmid) Anagn. et Komárek		+
Kamptonema sp.				+ (N = 1)
Kovacikia sp.				+ (N = 1)
Leptolyngbya angustissima (W.West et G.S.West) Anagn. et Komárek		+
Leptolyngbya boryana (Gomont) Anagn. et Komärek			+
Leptolyngbya foveolarum (Gomont) Anagn. et Komárek	+	+	+
Leptolyngbya gracillima (Hansg.) Anagn. et Komärek	+
Leptolyngbya nostocorum (Bornet ex Gomont) Anagn. et Komárek		+
Leptolyngbya notata (Schmidle) Anagn. et Komárek		+	+
Leptolyngbya sieminskae D.Richter et Matula	+
Leptolyngbya subtilissima (Hansg.) Komárek			+
Leptolyngbya tenuis (Gomont) Anagn. et Komárek		+
Leptolyngbya spp. 1	+	+	+	+ (N = 6)
Lyngbya sp.	+
Microchaete tenera Thur. ex Bornet et Flahault		+
Microcoleus autumnalis (Gomont) Strunecky, Komarek et J.R.Johans. 1	+	+	+
Microcoleus cf. lacustris Farlow ex Gomont			+
Microcoleus fonticola (Kirchner ex Hansg.) Strunecky, Komárek et J.R.Johans.		+
Microcoleus paludosus Gomont	+	+	+
Microcoleus vaginatus Gomont	+	+		+ (N = 1)
Microcoleus spp.		+	+
Microcystis sp.		+
Nodosilinea sp.				+ (N = 1)
Nostoc commune Vaucher ex Bornet et Flahault f. ulvaceum Elenkin 1,2	+	+
Nostoc commune Vaucher ex Bornet et Flahault 1,2	+		+	+ (N = 1)
Nostoc edaphicum N.V.Kondrateva	+	+	+	+ (N = 1)
Nostoc linckia (Roth) Bornet et Flahault 1,2	+
Nostoc microscopicum Carmich. ex Bornet et Flahault	+
Nostoc paludosum Kütz. ex Bornet et Flahault	+	+
Nostoc punctiforme Har. 1,2	+	+	+
Nostoc spp.	+		+	+ (N = 30)
Nostoc sp. (photobiont of liver mosses) 1			+
Oculatella crustae-formantes P.Jung, Briegel-Williams, Mikhailyuk et Büdel				+ (N = 1)
Oculatella spp.				+ (N = 3)
Oscillatoria tenuis C.Agardh ex Gomont	+
Petalonema densum (Bornet ex Bornet et Flahault) Migula		+
Petalonema incrustans Komárek	+
Phormidesmis mollis (Gomont) Turicchia, Ventura, Komárková et Komárek 1		+
Phormidesmis nigrescens (Komarek) Raabová, L.Kovacik, Elster et Strunecký				+ (N = 1)
Phormidesmis sp.	+
Phormidium ambiguum Gomont 1	+	+
Phormidium corium Gomont 1	+	+	+
Phormidium interruptum Kütz. ex Forti		+
Phormidium kuetzingianum (Kirchn. ex Hansg.) Anagn. et Komárek	+	+
Phormidium puteale (Montagne ex Gomont) Anagn. et Komárek 1	+		+
Phormidium spp.	+	+	+	+ (N = 2)
Pleurocapsa aurantiaca Geitler			+
Porphyrosiphon fuscus Gomont ex Frémy 1		+
Porphyrosiphon lomniczensis (Kol) Anagn. et Komárek 1		+
Porphyrosiphon sp.				+ (N = 1)
Potamolinea aerugineocaerulea (Gomont) M.D.Martins et Branco 1	+	+	+
Pseudanabaena spp.	+			+ (N = 2)
Pseudophormidium hollerbachianum (Elenkin) Anagn. 1		+
Pycnacronema spp.				+ (N = 11)
Schizothrix calcicola Gomont	+
Schizothrix lardacea Gomont	+
Schizothrix fuscescens Kutz. ex Gomont		+
Schizothrix spp.	+	+	+
Scytonema hoffmannii C.Agardh ex Bornet et Flahault 1	+	+	+
Scytonema hyalinum N.L.Gardner				+ (N = 1)
Scytonema ocellatum Lyngbye ex Bornet et Flahault	+	+
Scytonema spp.	+	+	+
Scytonematopsis crustacea (Thur. ex Bornet et Flahault) Koválik et Komárek 1,2		+
Shackletoniella spp.				+ (N = 2)
Snowella sp.				+ (N = 1)
Stenomitos frigidus (F.E.Fritsch) Miscoe et J.R.Johans.	+	+	+
Stenomitos hiloensis Johansen, Gargas et Shalygin				+ (N = 1)
Stenomitos kolaensis Shalygin, Shalygina et Johansen				+ (N = 1)
Stenomitos spp. 1,2 [41]	+			+ (N = 10)
Stigonema hormoides Bornet et Flahault	+	+
Stigonema informe Kütz. ex Bornet et Flahault 1,2	+	+
Stigonema mamillosum C.Agardh ex Bornet et Flahault	+	+	+
Stigonema minutum Hassall ex Bornet et Flahault	+	+	+
Stigonema ocellatum Thur. ex Bornet et Flahault 1,2	+	+	+
Stigonema spp.	+	+	+	+ (N = 10)
Symplocastrum friesii (Gomont) Kirchn. 1	+	+	+
Synechococcus elongatus (Nägeli) Nägeli		+	+
Synechocystis crassa Woron.		+
Synechocystis fuscopigmentosa Kovácik				+ (N = 1)
Synechocystis spp.				+ (N = 2)
Tenebriella curviceps (C.Agardh ex Gomont) Hauerová, Hauer et Kaštovský				+ (N = 1)
Tildeniella alaskaensis Strunecky, Raabova, Bernardova, A.P.Ivanova, Semanova, Crossley et Kaftan				+ (N = 1)
Tildeniella sp.				+ (N = 1)
Timaviella spp.				+ (N = 8)
Tolypothrix distorta Kütz. ex Bornet et Flahault	+	+		+ (N = 1)
Tolypothrix lanata Wartm. ex Bornet et Flahault		+
Tolypothrix saviczii Kossinsk.		+
Tolypothrix tenuis Kütz. ex Bornet et Flahault 1	+	+	+
Tolypothrix fasciculata Gomont 1		+
Tolypothrix spp.	+	+		+ (N = 3)
Trichormus variabilis (Kütz. ex Bornet et Flahault) Komárek et Anagn.		+
Wilmottia sp.				+ (N = 1)
Total	83	94	44	221 OTUs Identified—135 Not identified— 86
Dinophyta
Nusuttodinium sp.				+ (N = 1)
Peridinium sp.				+ (N = 1)
Total	0	0	0	8 OTUs Identified—2 Not identified—6
Euglenophyta
Astasia sp.			+
Total	0	0	1	3 OTUs Identified—0 Not identified—3
Cryptophyta
Total				3 OTUs Identified—0 Not identified—3
Ochrophyta/Chrysophyceae
Chromulina chionophilia Stein				+ (N = 1)
Chromulina spp.				+ (N = 3)
Chrysocapsa vernalis Starmach				+ (N = 1)
Kremastochrysopsis austriaca Remias, Procházková et R.A.Andersen				+ (N = 1)
Spumella spp.				+ (N = 4)
Total	0	0	0	19 OTUs Identified—10 Not identified—9
Ochrophyta/Xanthophyceae
Botrydiopsis eriensis J.W.Snow 1		+	+
Bumilleria sicula Borzi 1		+
cf. Chlorobotrys simplex Pascher		+
Chlorobotrys sp.				+ (N = 1)
Characiopsiella minima (Pascher) R.Amaral, K.P.Fawley, Nemcová, T.Sevcíková, Lukesová, M.W.Fawley, L.M.A.Santos et M.Eliás		+
Characiopsis minutissima Pascher 1			+
Monodopsis subterranea (J.B.Petersen) D.J.Hibberd				+ (N = 1)
Pleurochloris pyrenoidosa Pascher		+
Tribonema vulgare Pascher 1	+
Tribonema sp.		+
Vischeria helvetica (Vischer et Pascher) D.J.Hibberd 1	+	+
Vischeria magna (Petersen) Kryvenda, Rybalka, Wolf et Friedl 1,2	+	+	+	+ (N = 1)
Vischeria stellata (Chodat) Pascher				+ (N = 1)
Vischeria sp.			+
Xanthonema bristolianum (Pascher) P.C.Silva 1			+
Total	3	8	5	4 OTUs Identified—4 Not identified—0
Bacillariophyta
Achnanthidium lineare W.Smith		+
Achnanthidium minutissimum (Kütz.) Czarnecki		+
Aulacoseira italica (Ehrenb.) Simonsen		+
Caloneis aerophila W.Bock		+
Cavinula cf. lapidosa (Krasske) Lange-Bert.		+
Chamaepinnularia begeri (Krasske) Lange-Bert.		+
Chamaepinnularia soehrensis (Krasske) Lange-Bert. et Krammer		+
Diatoma tenuis C.Agardh		+
Discostella sp.				+ (N = 1)
Encyonema gracile Rabenh.		+
Encyonema minutum (Hilse) D.G.Mann		+
Eunotia bilunaris (Ehrenb.) Schaarschm.		+
Eunotia diodon Ehrenb.		+
Eunotia fallax A.Cleve		+
Eunotia incisa W.Smith ex W.Gregory		+
Eunotia intermedia (Krasske ex Hustedt) Nörpel et Lange-Bert.		+
Eunotia microcephala Krasske		+
Eunotia paludosa Grunow		+
Eunotia praerupta Ehrenb.		+
Eunotia septentrionalis Østrup		+
Eunotia sp.			+
Fragilaria radians (Kütz.) D.M.Williams et Round		+
Fragilaria vaucheriae (Kütz.) J.B.Petersen		+
Fragilaria sp.		+
Gomphonema angustatum (Kütz.) Rabenh.		+
Gomphonema brebissonii Kütz.		+
Hannaea arcus (Ehrenb.) R.M.Patrick		+
Hantzschia amphioxys (Ehrenb.) Grunow	+	+	+
Hantzschia amphioxys (Ehrenb.) Grunow f. capitata O.Müll.			+
Microcostatus krasskei (Hustedt) J.R.Johans. et Sray		+
Navicula spp.	+	+	+
Neidium alpinum Hustedt		+
Neidium bisulcatum (Lagerst.) Cleve		+
Nitzschia frustulum (Kütz.) Grunow		+
Nitzschia palea (Kütz.) W.Smith		+
Nitzschia perminuta Grunow		+
Pinnularia appendiculata (C.Agardh) Schaarschm.		+
Pinnularia borealis Ehrenb.		+	+
Pinnularia cf. bullacostae Krammer et Lange-Bert.		+
Pinnularia cf. microstauron (Ehrenb.) Cleve var. rostrata Krammer		+
Pinnularia streptoraphe Cleve		+
Pinnularia subcapitata W.Gregory		+
Pinnularia subrostrata (A.Cleve) A.Cleve		+
Pinnularia spp.	+	+	+
Psammothidium helveticum (Hust.) Bukht. et Round		+
Psammothidium kryophilum (J.B.Petersen) E.Reichardt		+
Sellaphora spp.				+ (N = 3)
Stauroneis agrestis Petersen	+	+
Stauroneis anceps Ehrenb.		+
Staurosira subsalina (Hustedt) Lange-Bert.		+
Staurosirella pinnata (Ehrenb.) D.M.Williams et Round		+
Tabellaria flocculosa (Roth) Kütz.		+
Tabellaria sp.	+
Thalassiosira pseudonana Hasle et Heimdal				+ (N = 1)
Ulnaria ulna (Nitzsch) Compère		+
Total	5	49	6	11 OTUs Identified—5 Not identified—6
Chlorophyta
Apatococcus lobatus (Chodat) J.B.Petersen				+ (N = 1)
Asterochloris excentrica (Archibald) Skaloud et Peksa 1	+		+
Asterochloris italiana (Archibald) Skaloud et Peksa				+ (N = 1)
Asterococcus superbus (Cienk.) Scherff.	+
Auxenochlorella sp.				+ (N = 1)
Borodinellopsis oleifera Schwarz	+
Borodinellopsis texensis Dykstra 1			+
Botryokoryne simplex Reisigl	+
Bracteacoccus aggregatus Tereg 1,2		+
Bracteacoccus giganteus H.W.Bischoff et H.C.Bold 1,2		+	+
Bracteacoccus grandis H.W.Bischoff et H.C.Bold 1,2			+
Bracteacoccus minor (Schmidle ex Chodat) Petrová 1,2	+	+	+
Bracteacoccus pseudominor H.W. Bischoff et H.C. Bold 1,2	+		+
Bracteacoccus spp. 1,2	+	+		+ (N = 1)
Carteria sp.			+
Cecidochloris adnata (Korshikov) H.Ettl	+
Chlamydocapsa cf. maxima (Mainx) H.Ettl et Gärtner 1			+
Chlamydocapsa lobata Broady 1	+	+	+
Chlamydocapsa spp.		+		+ (N = 1)
Chlamydomonas cf. applanata E.G.Pringsh.		+
Chlamydomonas cf. asymmetrica Korshikov			+
Chlamydomonas elliptica Korshikov			+
Chlamydomonas cf. gloeogama Korshikov		+
Chlamydomonas hindakii H.Ettl 1		+
Chlamydomonas macrostellata J.W.G.Lund 1			+
Chlamydomonas cf. noctigama Korshikov		+	+
Chlamydomonas pseudagloë Pascher				+ (N = 1)
Chlamydomonas radiata T.R.Deason et Bold			+
Chlamydomonas cf. reinhardtii P.A.Dang.		+
Chlamydomonas cf. reisiglii H.Ettl 1	+	+	+
Chlamydomonas cf. thomassonii H.Ettl		+
Chlamydomonas spp.	+	+	+	+ (N = 1)
Chlorella chlorelloides (Naumann) C.Bock, L.Krienitz et T.Pröschold			+
Chlorella vulgaris W.Beij 1,2	+	+	+
Chlorella vulgaris W.Beij. f. globosa V.M.Andreeva 1,2	+	+
Chlorella sp.			+
Chlorococcum costatozygotum H.Ettl et Gärtner 1			+
Chlorococcum infusionum (Schrank) Menegh.		+
Chlorococcum isabeliense P.A.Archibald et Bold 1		+
Chlorococcum lobatum (Korshikov) F.E.Fritsch et R.P.John 1		+	+
Chlorococcum spp.		+	+
Chloroidium lichinum (Chodat) Darienko et Pröschold				+ (N = 1)
Chloroidium spp.				+ (N = 2)
Chloroidium orientalis Gontcharov, Abdullin, A.Nikulin, V.Nikulin et Bagmet				+ (N = 1)
Chloroidium saccharophilum (W.Krüger) Darienko, Gustavs, Mudimu, Menendez, Schumann, Karsten, Friedl et Proschold 1			+	+ (N = 1)
Chlorolobion lunulatum Hindák		+	+
Chlorominima sp.				+ (N = 1)
Chloromonas reticulata (Gorozh.) Gobi 1,2 [40]		+	+
Chloromonas cf. rosae H.Ettl. 1			+
Chloromonas spp.				+ (N = 2)
Chloroplana terricola Hollerb.	+
Chlororustica terrestris (Herndon) Shin Watan., N.Mezaki et Tatsuya Suzuki	+
Chlorosarcinopsis spp.	+	+	+
Chromochloris zofingiensis (Dönz) Fucíková et L.A.Lewis				+ (N = 1)
Coccomyxa confluens (Kütz.) Fott				+ (N = 1)
Coccomyxa elongata Chodat et Jaag				+ (N = 1)
Coccomyxa polymorpha T.Darienko et T.Pröschold				+ (N = 1)
Coccomyxa subellipsoidea E.Acton				+ (N = 1)
Coccomyxa subglobosa Pascher	+		+
Coccomyxa viridis Chodat 1		+		+ (N = 1)
Coccomyxa spp.				+ (N = 13)
Coelastrella aeroterrestrica Tschaikner, Gärtner et Kofler				+ (N = 1)
Coelastrella multistriata (Trenkwalder) Kalina et Punčochárová			+
Coelastrella oocystiformis (J.W.G.Lund) E.Hegewald et N.Hanagata 1,2 [42]		+	+	+ (N = 1)
Coelastrella rubescens (Vinatzer) Kaufnerová et Eliás 1,2 [42]	+	+	+	+ (N = 1)
Coelastrella terrestris (Reisigl) E.Hegewald et N.Hanagata	+		+
Coelastrella spp. 1,2 [42]			+	+ (N = 1)
Coenochloris bilobata (Broady) Hindák	+
Coenochloris signiensis (Broady) Hindák 1	+	+	+
Coenocystis cf. oleifera (Broady) Hindák var. antarctica (Broady) V.M.Andreeva		+
Coenocystis spp.				+ (N = 2)
Coleochlamys apoda Korshikov	+
Deasonia multinucleata (Deason et H.C.Bold) H.Ettl et Komárek 1	+		+
Desmodesmus abundans (Kirchner) E.Hegewald		+
Desmotetra stigmatica (T.R.Deason) T.R.Deason et G.L.Floyd 1			+
Dictyochloropsis splendida Geitler				+ (N = 1)
Dictyochloropsis spp.				+ (N = 3)
cf. Dictyococcus varians Gerneck 1	+	+
Diplosphaera chodatii Bialosukniá 1		+
Diplosphaera chodatii var. mucosa (Broady) Pröschold et Darienko		+
Elliptochloris bilobata Tscherm.-Woess 1	+	+	+
Elliptochloris reniformis H.Ettl et G.Gärtner 1		+	+
Elliptochloris subsphaerica (Reisigl) H.Ettl et G.Gärtner 1	+	+	+	+ (N = 1)
Elliptochloris spp.	+	+		+ (N = 6)
Eremochloris sp.				+ (N = 1)
Ettlia minuta (Arce et H.C.Bold) Komárek	+
Eubrownia aggregata (R.M.Brown et Bold) Shin Watan. et L.A.Lewis		+	+
Eubrownia dissociata (R.M.Brown et Bold) Shin Watan. et L.A.Lewis		+	+
Fernandinella semiglobosa (F.E.Fritsch et R.P.John) Škaloud et Leliaert			+
Gloeococcus sp.			+
Hariotina compacta Wang, Liu, Hu et Liu				+ (N = 1)
Herndonia botryoides (Hernon) Shin Watan.	+
Heterochlamydomonas uralensis Novakovskaya, Boldina, Shadrin, Patova 1,2 [59]		+
cf. Heterotetracystis intermedia Ed.R.Cox et T.R.Deason	+	+	+
Interfilum paradoxum Chodat et Topali		+
Interfilum terricola (J.B.Petersen) Mikhailyuk, Sluiman, Massalski, Mudimu, Demchenko, Friedl et Kondratyuk	+	+	+
Keratococcus bicaudatus (A.Braun ex Rabenh.) J.B.Petersen			+
Leptosira obovata Vischer				+ (N = 1)
Leptosira polychloris Reisigl 1		+	+
Leptosira spp.		+	+	+ (N = 1)
Lobochlamys culleus (H.Ettl) T.Pröschold, B.Marin, U.W.Schlösser et M.Melkonian	+	+	+
Lobosphaera incisa (Reisigl) Karsten, Friedl, Schumannn, Hoyer et Lembcke 1		+	+
Macrochloris dissecta Korshikov 1	+		+
Massjukichlorella sp.				+ (N = 1)
Microspora sp.		+
Mychonastes homosphaera (Skuja) Kalina et Punčoch. 1,2	+	+	+
Myrmecia bisecta Reisigl 1	+	+	+
Myrmecia israelensis (S.Chantanachat et H.Bold) T.Friedl				+ (N = 1)
Myrmecia macronucleata (Deason) V.M.Andreeva	+
Myrmecia pyriformis J.B.Petersen				+ (N = 1)
Myrmecia sp.				+ (N = 1)
cf. Nannochloris sp.			+
Nautococcus terrestris P.A.Archibald	+
Neochloris gelatinosa Herndon	+
Neochloris sp.		+
Neocystis broadiensis Kostikov, Darienko, Lukesova et L.Hoffm.		+
Neocystis curvata (Broady) Kostikov, Darienko, Lukesova et L.Hoffm. 1		+	+
Neocystis sp.		+
Oedogonium sp.	+
Palmellopsis gelatinosa Korshikov	+
Parietochloris alveolaris (H.C.Bold) Shin Watan. et G.L.Floyd 1	+	+	+
Parietochloris bilobata (Vinatzer) V.M.Andreeva 1	+	+	+	+ (N = 1)
Parietochloris cf. pseudoalveolaris (Deason et H.C.Bold) Shin Watan. et G.L.Floyd 1		+
Parietochloris spp. 1		+		+ (N = 1)
Planophila asymmetrica (Gerneck) Wille		+
Planophila laetevirens Gerneck				+ (N = 1)
Pleurastrum terricola (Bristol) D.M.John 1	+	+	+	+ (N = 1)
Pleurastrum sp.				+ (N = 1)
Pseudendoclonium sp.		+
Pseudodictyochloris multinucleata (Broady) H.Ettl et G.Gärtner	+
Pseudosphaerocystis sp.	+
Pseudotrochiscia areolata Vinatzer	+
Radiosphaera minuta Herndon 1	+		+
Rhexinema sp.				+ (N = 2)
Sanguina nivaloides Procházková, Leya et Nedbalová				+ (N = 1)
Scenedesmus acuminatus (Lagerheim) Chodat				+ (N = 1)
Schizochlamydella minutissima Broady 1			+
Scotiellopsis levicostata (Hollerb.) Punčoch. et Kalina	+	+
Scotinosphaera sp.				+ (N = 1)
Spongiochloris lamellata Deason et H.C.Bold	+
Sporotetras polydermatica (Kütz.) Kostikov, Darienko, Lukesová et L.Hoffm 1	+	+	+
Stichococcus bacillaris Nägeli 1		+	+
Stichococcus sp.		+
Stigeoclonium sp.				+ (N = 1)
Symbiochloris symbiontica (Tscherm.-Woess) Skaloud, Friedl, A.Beck& Dal Grande				+ (N = 1)
Tetracystis compacta K.Schwarz 1	+
Tetracystis excentrica R.M.Brown et H.C.Bold	+
Tetracystis pulchra R.M.Brown et H.C.Bold	+
Tetracystis tetraspora (Arce et H.C.Bold) R.M.Brown et H.C.Bold 1			+
Tetracystis cf. vinatzeri H.Ettl et Gärtner. 1			+
Tetracystis spp.		+	+	+ (N = 1)
Tetradesmus obliquus (Turpin) M.J.Wynne		+
Tetrasporidium javanicum Möbius	+
Trebouxia arboricola Puymaly	+
Trebouxia spp.		+	+
Ulothrix tenerrima Kutz.	+	+	+
Uvulifera mucosa (Broady et M.Ingerfeld) Molinari				+ (N = 1)
Uvulifera sp.				+ (N = 1)
Valeriella excentrica (R.C.Starr) Darienko et Pröschold	+
Valeriella incrassata (Chantanachat & H.C.Bold) Darienko et Pröschold	+
Watanabea reniformis N.Hanagata, I.Karube, M.Chihara et P.C.Silva				+ (N = 1)
Watanabea sichuanensis Shuyin Li et al.				+ (N = 1)
Xerochlorella spp.				+ (N = 2)
Total	58	68	67	80 OTUs Identified—78 Not identified—2
Charophyta
Closterium pusillum Hantzsch 1	+	+
Cosmarium anceps P.Lundell		+
Cosmarium saxicola Kaiser		+	+
Cosmarium undulatum Corda ex Ralfs			+
Cosmarium spp.	+	+
Cylindrocystis brebissonii var. turgida Schmidle	+		+
Cylindrocystis crassa De Bary	+		+
Cylindrocystis sp.		+
Euastrum binale Ehrenb. ex Ralfs	+	+
Klebsormidium crenulatum (Kütz.) Lokhorst		+
Klebsormidium dissectum (F.Gay) H.Ettl et G.Gärtner 1	+	+	+
Klebsormidium flaccidum (Kütz.) P.C.Silva, Mattox et W.H.Blackwel 1		+	+
Klebsormidium nitens (Kütz.) Lokhorst 1	+	+	+	+ (N = 1)
Mesotaenium caldariorum (Lagerh.) Hansg.		+	+
Mesotaenium endlicherianum Nägeli	+	+	+
Mesotaenium pyrenoidosum (P.A.Broady) Petlovany 1	+	+
Mesotaenium sp.		+
Total	9	14	9	2 OTUs Identified—1 Not identified—1

Note: + taxon noted; ¹—strain isolated and deposited to SYKOA culture collection; ²—molecular analyses for strain were performed; [40,41,42,58,59]—information about the strain is published in the source. The taxa within the phyla are in alphabetical order.

).

The distribution of taxa at different sampling sites is presented in Figure 2. The genera Chlamydomonas, Leptolyngbya, Eunotia, Chlorococcum, Gloeocapsa, Pinnularia, Nostoc, Aphanothece, Bracteacoccus, and Phormidium contributed significantly to the species diversity, with the largest number of species among the studied taxa (Figure 3a). Direct microscopy and cultural methods showed that natural BSC samples, on average, contain from 15 to 50 species of cyanobacteria and eukaryotic algae [27].

3.2. Diversity of Algae and Cyanobacteria in BSCs Based on Metabarcoding Data

A total of 351 OTUs were assigned to soil algae (130) and cyanobacteria (221) through metabarcoding, from which only 135 cyanobacteria OTUs and 100 OTUs of eukaryotes were identified at a species or genus level (Table 3 and Supplementary File S1). The remaining OTUs had unclear taxonomic states and were excluded from further analyses in this study. Among the cyanobacteria, 13 were identified at the species level and 122 according to their genus rank (Table 3). OTUs at the genus rank may represent either new species or species for which there is no molecular data deposited in reference databases. In our study, 47 taxa, revealed through a morphological survey (Table 3), had missed nucleotide sequences in the NCBI database (https://www.ncbi.nlm.nih.gov/, accessed on 29 August 2023). Nine cyanobacteria species were discovered for the first time in the BSCs of the Urals regions only through metabarcoding data. These species are cryptic, with similar morphology to the described taxa, and their identification without molecular data is considered challenging. Chlorophyta had 80 OTUs, of which 44 were identified only by genus rank and 34 by species rank (23 species new to the Ural region) (Table 3). Moreover, 11 OTUs were assigned to Bacillariophyta, of which four genera and one species (new to the region) were identified. Ochrophyta had 23 OTUs; 6 were identified by species rank (5 new to the region) and 8 bygenus rank. Dinophyta had 8 OTUs, and only 2 were identified to a genus rank. Cryptophyta and Euglenophyta had 3 OTUs per each group, but they were not identified. Charophyta had 2 OTUs; one was identified by species rank (Table 3).

Genera Nostoc, Coccomyxa, Stenomitos, Pycnacronema, Stigonema, Elliptochloris, Timaviella, Leptolyngbya, Chloroidium, and Desmonostoc were the most diverse in terms of the number of taxonomic units identified both among cyanobacteria and eukaryotes (Figure 3b).

The number of OTUs varied between different types of BSCs and ranged from 25 to 129 per sample, from which eukaryotes accounted for 6 to 33 OTUs and cyanobacteria from 15 to 96 OTUs.

According to morphological data, there are 55 common species in BSCs in all the studied regions (Figure 4a). According to morphological and metabarcoding data only 23 common taxa between SU and SUm regions (Figure 4b). The distribution of the identified diversity of algae and cyanobacteria for different regions in the Urals was not the same.

4. Discussion

The combination of the morphological approach with metabarcoding data provided a more comprehensive view of the current diversity of soil algae and cyanobacteria in pioneer vegetation communities of mountain tundra in the northern regions of the Urals. The diversity of the BSCs in the region was found to consist of 422 taxa (343 taxa—morphological data and 235 taxa—metabarcoding data) of soil algae and cyanobacteria (Table 3). The use of DNA metabarcoding provided complementary data, revealing the 29 cyanobacteria taxa and 42 eukaryotic algae taxa not described before in the north Ural regions. In addition, 86 OTUs of cyanobacteria and 30 OTUs of eukaryotic algae remained unidentified by species or genus rank. Our study’s findings suggest a potential species pool for BSCs in the mountain tundra of the Urals can reach more than 500 species. According to W. Büdel et al. [10], there are more than 320 species of cyanobacteria from 70 genera found in BSCs worldwide. Our results are consistent with the literature data on BSCs, which shows the diversity of soil algae and cyanobacteria in the Arctic [4,7,8,9,15,16] and mountainous regions [2,19,28,60].

The BSCs contain a variety of algal and cyanobacterial species that are rare and difficult to identify based on morphological approaches alone [52,61,62]. The DNA metabarcoding method not only confirmed the known diversity of algae groups in BSCs and typical species but also allowed for the identification of new taxonomic groups at various levels of classification, from phylum to species. This method also helped to detect hidden diversity, for example, by revealing cryptic species, taxonomically challenging species, or novel species outside their known habitat [18,45]. Specifically, the metabarcoding analysis identified algae from Dinophyta (2 taxa) and Chrysophyceae (5 taxa), and these were recorded for the first time in the soils of the northern regions of the Urals (Table 3). Chrysophyceae algae have been previously detected in BSCs from polar regions using metabarcoding [18]. Some of the identified species of cyanobacteria and algae were found to be reported outside their typical habitat and geographic distribution. For example, species from the genera Hariotina and Stigeoclonium were previously only reported in aquatic environments [43]. The cyanobacteria Dactylothamnos antarcticus were described to be in the littoral of streams and lakes and on wetted rocks in the Antarctic [13]. For example, a cryptic cyanobacteria species, Oculatella crustae-formantes, discovered in BSCs of the Urals was found in the BSCs of the Arctic Spitsbergen, Norway [62]. The green algae species in the cryptic genus Parietochloris [63] were detected in the studied BSCs (Table 3). Similarly, one species from the genus Planophila was revealed in the BSC of the Urals only through metabarcoding, since representatives of this genus have high phenotypic plasticity [64]. Moreover, metabarcoding helped to identify lichen photobionts from the genus Asterochloris (Table 3), which is a significant proportion of the BSCs [65]. The species from the genus Leptosira, revealed in the study, also characterize high hidden species diversity and high morphological variability [66]. These findings challenge the traditional concepts of some algal species distribution and highlight the importance of exploring the potential diversity of organisms in various geographic locations. Combining these two approaches can provide a more complete picture of species diversity and improve our understanding of ecosystem functioning.

Cyanobacteria and Chlorophyta had the highest number of taxonomic units, confirmed by both morphological observations and metabarcoding (Figure 2). Their dominance in this diversity study is not surprising, as these phyla are commonly found in BSCs [7,10,21,60]. The genera Nostoc, Coccomyxa, Chlamydomonas, Leptolyngbya, Stenomitos, Pycnacronema, Stigonema, and Eunotia were the most diverse in terms of the number of taxonomic units identified (Table 3), suggesting that these genera may play an important role in the ecology of the BSCs in the studied region [20,21,22,23,24,25,26] and in BSCs of other northern and mountainous regions [7,10,18]. The compositions of the leading genera obtained through cultural and metabarcoding methods have low similarity (Figure 3). This is likely due to the limited data obtained from the metabarcoding tool and the detection of a high number of species that are not distinguishable through cultural methods. It was earlier reported that BSCs are often dominated by poorly cultivated species in terms of quantitative measures [7,10].

Previous study using light and fluorescent microscopy also have shown that cyanobacteria and green algae form the phototrophic basis of BSCs, with densities ranging from 5.75 to 27.10 million cells/g of soil [27]. The study identified the dominant species in BSCs, including species from Cyanobacteria (such as Nostoc commune (Figure 5a), Stigonema minutum (Figure 5b), S. ocellatum, Gloeocapsopsis magma, Scytonema hoffmannii (Figure 5c), and species from the genera Aphanocapsa, Fischerella, Leptolyngbya, Phormidium, and Schizothrix) and Chlorophyta species (such as Chlamydocapsa lobata, Elliptochloris bilobata (Figure 5d), E. subsphaerica, Coccomyxa simplex, Sporotetras polydermatica (Figure 5e), Lobochlamys culleus (Figure 5f), and species from the genera Coelastrella, Cylindrocystis, Leptosira, Myrmecia and Mesotaenium). The listed species are typical inhabitants of BSCs in mountainous and polar regions and are highly resistant to a prolonged lack of moisture and sudden changes in soil temperature in the upper horizons, likely due to their small size, thickened cell wall, rapid reproduction, and their ability to form slimy colonies.

The alpha diversity of cyanobacteria and algae in BSCs ranged from 133 to 234 species in different regions of the Urals (Figure 2 and Figure 4; Table 3). The number of common species among all the investigated regions was 55. The highest number of species was found in the BSCs of Subpolar Urals, while the Polar Urals had the second highest species diversity. The fewest species were identified in the Northern Urals, where algae research is just beginning [22]. This suggests that different types of BSCs in different regions of the Urals have specific groups of cyanobacteria and algae, and the overall diversity of phototrophs in BSCs is not high. Among the 55 species recorded in all regions of the Northen Urals, the following 13 taxa were confirmed by metabarcoding data: cyanobacteria—Microcoleus vaginatus, Nostoc commune, N. edaphicum, and Tolypothrix distorta; and eukaryotic algae—Chloroidium saccharophilum, Coccomyxa viridis, Coelastrella oocystiformis, C. rubescens, Elliptochloris subsphaerica, Klebsormidium nitens, Parietochloris bilobate, Pleurastrum terricola, and Vischeria magna. Almost all of these species belong to the dominant complex or have a high occurrence in the biological soil crusts of the diverse mountain tundra communities of the Polar, Subpolar, and Northern Urals [20,21,22,23,24,25,26,27].

Long-term studies have shown that on average, 15–50 species of cyanobacteria and eukaryotic algae are typically found in BSCs per site in the Northern Urals [22,25,26,27]. However, according to the literature data, the diversity of algae in BSCs can highly vary depending on the region, with the number of taxa typically ranging from 18 to 65 [19,21,30,60]. Molecular data have shown that the diversity in one BSC can reach large values (from 25 to 129 taxa per sample).

5. Conclusions

Our results show that BSCs are unique microecosystems in mountain environments with a high biodiversity of phototrophic components. A morphological approach identified 343 taxa of terrestrial cyanobacteria and eukaryotic algae in BSCs from various mountain communities in the northern regions of the Urals, and using metabarcoding, 235 taxa were identified. Metabarcoding studies have supplemented the understanding of the hidden diversity of the BSC phototrophic community by 48 taxa of the generic and 38 species levels. Both methods produce data comparable in terms of the number of species per sample, which makes it possible to use the metabarcoding method for a correct assessment of diversity and monitoring. The discovered dominant groups, consisting of cyanobacteria and green algae, are also found to be the main phototrophic part of BSCs in other regions of the Earth. Overall, the study found that the diversity of algae and cyanobacteria in BSCs varies across the regions of the Urals. The study contributes to our knowledge of the passive and active biodiversity of algae and cyanobacteria in BSCs and their distribution in mountain ecosystems.

This research focuses primarily on organisms that are sufficiently well studied to enable the correct identification of genus and species from morphological and/or molecular data. However, a full analysis of the metabarcoding data reveals a very significant part of the latent diversity and reveals a common problem in the interpretation of these data at the moment. OTUs identified with unclear taxonomic positions may be new lineages, and it is unclear whether they are photosynthetic or heterotrophic organisms. These data may also include identification errors due to incomplete reference databases. One thing is certain, that further improvement to the approaches used for their study, both morphological and molecular, is necessary to more fully assess the diversity of these specific habitats.

Further studies of BSCs should aim to identify the interaction of organisms with each other, the seasonal development of BSCs, the study of various functional groups, as well as long-term succession under climate change. This is only possible with a combination of different approaches to the study of these key components of mountain and arctic ecosystems. The use of metabarcoding to study terrestrial algae and cyanobacteria will not only provide new information about their species and functional diversity but will also change our understanding of their ecology and distribution in the BSCs of the different climatic zones of the Earth. However, the successful application of metabarcoding is limited by the obvious incompleteness of the databases of the nucleotide sequences of algae and cyanobacteria. Therefore, to develop this approach, more effort is required to isolate algae and cyanobacteria into culture from different climatic zones and their taxonomic revision.