A New Locality for the Blind Loach, Eidinemacheilus smithi (Teleostei: Nemacheilidae) in Iranian Zagros: A Morpho-Molecular Approach

Abstract

Four obligate cave fish species have been recorded from Zagros in Iran: Garra typhlops (Bruun and Kaiser, 1944), G. lorestanensis (Mousavi-Sabet and Eagderi, 2016), G. tashanensis (Mousavi-Sabet, Vatandoust, Fatemi and Eagderi, 2016) and Eidinemacheilus smithi (Greenwood, 1976). So far, the only known locality of the latter has been the Loven cave. Here, we extend the known range of the Zagros blind loach (E. smithi) by reporting a new locality, the Tuveh spring, located 31 km south of Loven. We combine morphological evidence with the calculated K2P genetic divergences of 1.39% between Tuveh and Loven to confirm that these populations are conspecific. Our discovery of the second E. smithi population has implications for the conservation of this rare and vulnerable species.

1. Introduction

Subterranean environments including caves are among the most extreme ecosystems on earth, as the restricted access to food and the conditions of darkness and humidity make these habitats challenging for living organisms to inhabit. Despite this, many taxa have colonized the subterranean environments, including arthropods and vertebrates [1,2]. The subterranean environments harbor a high diversity of animals and many of them have adapted to life in such habitats. However, regarding the low productivity of hypogean environments, the biodiversity of subterranean environments is much lower than that of the surface. To date, over 22 hotspots of troglobiotic biodiversity, each harboring more than 25 troglobiont/stygobiont species, have been reported globally [2,3,4,5]. Unlike numerous troglobiotic invertebrates, e.g., mollusks, sponges, worms, and arthropods [6,7,8], according to discoveries up to date, only two vertebrate groups, i.e., fishes and salamanders, have colonized subterranean habitats with species that show troglomorphic adaptations [9,10]. With more than 280 known species of troglobiont representatives, the cave fishes are the most species-rich vertebrates in the groundwaters of the world [11]. According to Proudlove [11], the family Nemacheilidae comprises 62 known subterranean species, all but one found in Asia.

The history of Iranian subterranean animal research coincided with railway construction in 1900 [12], with the discovery of the Loven cave in the western Iranian Lorestan Province. At the time, a new cyprinid cave-dwelling species was named Iranocypris typhlops (Bruun and Kaiser, 1944), which today is in the genus Garra [13,14,15]. Recently, Mousavi-Sabet and Eagderi [16] revealed that Garra of the Loven cave belong to two distinct species: G. typhlops (Bruun and Kaiser, 1944) and G. lorestanensis Mousavi-Sabet and Eagderi, 2016. From this locality, Greenwood [17] named another fish species, Noemacheilus smithi Greenwood, 1976 (family Nemacheilidae). Hashemzadeh Segherloo et al. [18] transferred the species to Eidinemacheilus, a genus of loaches with only two cave-dwelling species: E. smithi is endemic to an aquifer in the Karun River drainage in the Zagros Mountains, and E. proudlovei Freyhof, Abdullah, Ararat, Ibrahim and Geiger, 2016, is endemic to subterranean waters in the Little Zab River drainage in Iraqi Kurdistan [19].

Mahjoorazad and Coad [20] and Vatandoust et al. [21] reported G. typhlops and G. lorestanensis from two different localities. The first locality is about 130 km to the west of Loven, and the second one is located 31 km to the south of Loven. These reports may reveal the potential presence of a large freshwater aquifer in the Zagros Mountains. Vatandoust et al. [21] also hypothesized, based on anecdotal and photographic evidence, the presence of E. smithi in the Tuveh spring, but this has not been confirmed.

Garra tashanensis, Mousavi-Sabet, Vatandoust, Fatemi and Eagderi, 2016, is another subterranean fish species from the Tashan cave in the southeastern part of Iran in Zagros Mountains [22].

Our aims here are: (i) to report a new locality for the Iranian blind loach Eidinemacheilus smithi, (ii) to provide morphological characteristics of the collected specimens and a morphological comparison with those from the type locality (Loven cave), and (iii) to use molecular data to test the taxonomic status of these two populations from the Tuveh spring and the Loven cave.

2. Material and Methods

2.1. Taxon Sampling

Specimens were collected on 30 May 2019, using a hand net in a seasonal spring of Tuveh, close to Tuveh village, Andimeshk, Khuzestan Province (32°48′47″ N, 48°43′06″ E, altitude 495 m a.s.l.) (Figure 1). It is a seasonal spring with a high amount of water flowing during the rainy seasons, usually from November till May–June. The flowing water gets lower from April and the outlet of the spring is terminated completely in summer. The spring is a part of the Dez River drainage. The Tuveh spring is about 31 km to the south of the Loven cave, the type locality of E. smithi.

2.2. Morphological Study

Measurements were completed using a digital caliper and recorded to 0.1 mm. All of the measurements were made point to point, never by projections. Methods for counts and measurements followed Kottelat and Freyhof [23]. Standard length (SL) was measured from the tip of the snout to the end of the hypural complex. The length of the caudal peduncle was measured from behind the base of the last anal-fin ray to the end of the hypural complex, at mid-height of the caudal-fin base. The last two branched rays articulating on a single pterygiophore in the dorsal and anal fins are noted as “1½”. Caudal peduncle depth was measured at the tip of the posterior-most anal-fin ray.

Abbreviations. SL, standard length; HL, head length; ZM-CBSU, Zoological Museum of Shiraz University, Collection of Biology Department, Shiraz, Iran.

2.3. Molecular Study

DNA was isolated from the fin tissue of three specimens of E. smithi from the Tuveh spring and two specimens of each of the three species of the family Nemacheilidae: Oxynoemacheilus euphraticus (Bănărescu and Nalbant, 1964), Paraschistura ilamensis (Vatandoust and Eagderi, 2015), and Sasanidus kermanshahensis (Bănărescu and Nalbant, 1966) from Iran. From GenBank, we obtained additional COI sequences of other genera of this family (

Table 1. Taxonomic and gene information (GenBank accession numbers) data for the taxa used in our analyses. Original sequence data are indicated in bold typeface.

No.	Species	Voucher Number and COI Accession Number
1	Eidinemacheilus smithi (Tuveh)	F-32: OP310812; F33: OP310813; F34: OP310814
2	Eidinemacheilus smithi 1, 2 (Loven)	KX429660 / KX461958
3	Eidinemacheilus proudlovei	KX774390
4	Nemachilichthys rueppelli	KU928278
5	Oxynoemacheilus angorae	AP011233
6	Oxynoemacheilus euphraticus	F-39: OP310815; F-40: OP310816
7	Oxynoemacheilus euphraticus	MK546456
8	Oxynoemacheilus parvinae	KX980092
9	Paracobitis zabgawraensis	MK238776
10	Paraschistura ilamensis	F-37: OP310817; F-38: OP310818
11	Paraschistura ilamensis	MN258032
12	Paraschistura naumanni	KY808480.
13	Paraschistura nielseni	KY808482
14	Sasanidus kermanshahensis	F-35: OP310819; F-36: OP310820
15	Sasanidus kermanshahensis	KU928288
16	Schistura beavani	HQ219200
17	Schistura khugae	KJ909375
18	Schistura longa	KM610912
19	Schistura notostigma	NC_031585
20	Schistura poculi	KM610972
21	Schistura savona	KJ542586
22	Triplophysa gundriseri	KX039656
23	Triplophysa orientalis	NC_030505
24	Lefua nikkonis	NC_027662

). Lefua nikkonis (Jordan and Fowler, 1903) was used as the outgroup. GenBank accession numbers are listed in Table 1.

Molecular procedures were completed at the Evolutionary Zoology Laboratory, Jovan Hadži Institute of Biology ZRC-SAZU, Ljubljana (EZ LAB, Slovenia). The DNA was isolated applying Robotic DNA extraction protocol using Mag MAX™ Express magnetic particle processor Type 700 with DNA Multisample kit (Thermo Fisher Scientific kit) and modified protocols following Vidergar et al. [24]. We amplified fragments of the mitochondrial marker: 3′end of cytochrome c oxidase subunit 1 gene (COI) using the primers: VF2_t1 (5′ TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC) and FR1d_t1 (5′ CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA) [25]. PCR reactions were executed in a 35 μL volume using EH2O: 18.8 μL, Buffer: 7.1 μL, dNTPS (2 mM): 3.5 μL, MgCl2 (25 mM): 3.2 μL, Primer (20 mM): 1 μL forward and 1 μL reverse, polymerase 0.2 μL, and BSA 0.2 μL. The following protocol was applied for PCR: 94 °C for 120 s, 35 cycles of 94 °C for 30 s, 52 °C for 40 s, and 72 °C for 60 s, with a final extension at 72 °C for 10 min. The PCR products were sent to Macrogen Europe (Amsterdam, the Netherlands) for sequencing. We used ChromasPro 2.1.3 (Technelysium, Tewantin, Australia) to assemble the sequences, as well as for editing and proofreading. We used MEGA [26] for alignments and to find the best substitutional model for Bayesian and Maximum Likelihood analyses and as well to estimate K2P Pairwise Distances. For data curation, we used Mesquite version 3.7 [27]. The matrix contained 582 bp. We conducted Bayesian inference using MrBayes v. 3.2.7a [28] to reconstruct the phylogenetic position of the new population of E. smithi from the Tuveh spring, its congeners and related genera. The Bayesian inference of phylogeny was conducted for 20 million generations with four MCMC chains and with a sampling frequency of 1000. A relative burn-in was set to 25% and checked for the MCMC chain convergence in Tracer 1.7 [29]. We generated maximum likelihood phylogenetic trees with 1000 bootstrap replicates in IQ-tree 1.6.7 [30]. The analyses were generated under the HKY+G+I model of nucleotide substitution.

TAXONOMY

Family Nemacheilidae Regan, 1911

Eidinemacheilus smithi(Greenwood, 1976)

(Figure 2)

Examined materials. ZM-CBSU es-101, 2 specimens, 24.6–25.1 mm SL., Iran: Khuzestan Province, Andimeshk, Tuveh village, Tuveh spring, 32°48′47″ N, 48°43′06″ E.

Diagnosis. Eidinemacheilus smithi is distinguished from E. proudlovei, the only other troglomorphic nemacheilid loach species in the Middle East, and the only other species in Eidinemacheilus known so far, by having 7 + 7 branched caudal-fin rays (vs. 8 + 8 or 8 + 7), adipose keel on the caudal peduncle (vs. absent), and a reduced head canal system (fully developed).

Description. See Figure 2 for general appearance and

Table 2. Morphometric data of E. smithi. ZM-CBSU es-101, n = 2.

Measured Characters	Min	Max	Mean	SD
Standard length (mm)	24.6	25.1	24.8
In percent of standard length
Head length	24	25.4	24.7	1.0
Body depth at dorsal-fin origin	12.6	13.0	12.8	0.2
Body width at dorsal-fin origin	4.6	5.5	5.1	0.6
Pre-dorsal length	46.5	48.5	47.5	1.4
Post-dorsal length	41.8	41.8	41.8	0.01
Pre-pelvic length	51.8	51.9	51.8	0.7
Pre-anal length	73.3	74.3	73.8	0.7
Distance between pectoral and pelvic-fin origins	26.1	27.7	26.9	1.1
Distance between pelvic and anal-fin origins	20.9	23.5	22.2	1.9
Depth of caudal peduncle	9.8	9.9	9.8	0.1
Length of caudal peduncle	14.6	16.0	15.3	0.9
Dorsal-fin length	23.2	24.7	24.0	1.1
Pectoral-fin length	21.8	22.0	21.9	0.1
Pelvic-fin length	12.6	14.4	13.5	1.2
In percent of head length
Head depth at nape	44.0	45.8	44.9	1.2
Maximum head width	45.6	48.3	46.9	1.9
Inner rostral–barbel length	17.9	18.9	18.4	0.7
Outer rostral–barbel length	39.6	41.5	40.6	1.3
Maxillary–barbel length	25.5	28.2	26.8	1.9

for morphometric data. Medium sized, moderately stout species with large head. Body deepest at dorsal-fin origin, profile of back straight, or body depth slightly decreasing towards dorsal-fin origin, and slowly decreasing below dorsal-fin base and towards caudal-fin base. No hump at nape. Greatest body width at pectoral-fin base. Head conical, flattened on ventral surface. Caudal peduncle compressed laterally, 1.5–1.6 times longer than deep.

Pectoral fin reaching approximately 79–84% of distance from pectoral-fin origin to pelvic-fin origin. Pelvic axillary lobe absent. Pelvic-fin origin below unbranched or first branched dorsal-fin ray. Pelvic fin not reaching to anus. Anal-fin origin shortly behind anus. Anal-fin origin at vertical of middle between dorsal- and caudal-fin origins. A dorsal adipose crest on caudal peduncle. Margin of dorsal fin straight. Caudal fin moderately emarginated.

Dorsal fin with 7½ branched rays. Anal fin with 5½ branched rays. Caudal fin with 7 + 7 branched rays. Pectoral fin with 10 and pelvic fin with 5 branched rays. Scales absent. Lateral line complete. Anterior nostril opening on anterior side of a low, pointed, and flap-like tube. Nostrils adjacent to each other, tip of anterior nostril overlaps posterior nostril when folded backwards. No suborbital flap, Groove or slit in fishes examined. Mouth very large, slightly arched. Lips moderately thick, upper lip smooth or with fine ridges, lower lip with deep furrows. A median interruption in lower lip. Barbels short, inner rostral barbell reaching to base or slightly behind of outer rostral barbel; outer rostral barbel reaching to base or slightly behind of maxillary barbel. Maxillary barbel reaching to base of outer rostral barbel when folded to front.

3. Molecular Results

The morphological identification was confirmed by DNA barcoding of the specimen collected from the Tuveh spring.

Table 3. Estimates of the average COI divergence (K2P distance) between examined Nemacheilidae species.

NO	Species	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19
1	Eidinemacheilus smithi F32-Tuveh
2	E. smithi 1- Loven	1.39
3	E. proudlovei	8.06	7.67
4	Nemachilichthys rueppelli	18.05	18.49	16.52
5	Oxynoemacheilus angorae	19.30	18.85	19.16	18.76
6	O. euphraticus_F39	20.07	19.62	18.97	19.82	13.15
7	O. parvinae	20.49	20.02	18.54	22.56	15.92	12.71
8	Paracobitis zabgawraensis	17.41	17.19	17.66	15.98	16.70	19.10	20.00
9	Paraschistura ilamensis_F37	13.75	13.97	15.03	17.77	18.12	20.55	21.96	17.21
10	P. naumanni	13.97	13.55	13.56	15.78	18.84	17.13	20.80	16.13	11.43
11	P. nielseni	13.62	13.84	13.80	18.31	18.62	19.21	22.98	18.87	7.88	12.53
12	Sasanidus kermanshahensis_F35	16.75	16.53	16.82	18.85	19.61	18.12	21.19	19.68	14.61	16.15	14.95
13	Schistura beavani	14.11	14.11	12.88	15.95	16.05	15.92	16.58	16.49	13.66	12.01	12.75	14.56
14	S. khugae	13.08	13.29	12.07	13.57	16.33	15.15	17.35	15.21	12.62	11.04	12.12	15.14	6.48
15	S. longa	14.13	13.92	11.81	14.05	17.44	16.42	15.98	16.92	13.88	12.07	13.55	14.75	7.66	7.27
16	S. notostigma	16.69	16.91	16.05	16.51	18.71	19.76	20.42	17.56	18.69	16.14	18.42	17.31	17.19	14.56	16.76
17	S. poculi	14.53	14.32	12.03	13.61	17.41	16.61	15.95	16.47	14.07	12.46	13.53	15.15	7.84	7.07	0.52	16.52
18	S. savona	15.83	14.99	16.17	16.33	17.11	18.54	22.19	17.74	15.87	14.60	16.46	18.59	14.38	15.85	16.31	14.71	16.50
19	Triplophysa gundriseri	20.75	21.92	22.64	21.41	22.18	24.80	26.46	22.52	21.36	19.52	20.58	23.95	17.91	19.03	19.46	22.15	19.65	20.65
20	T. orientalis	21.96	22.91	23.73	21.62	22.56	25.47	27.57	19.92	18.44	21.40	20.72	22.91	21.77	21.52	22.42	24.31	22.62	20.19	10.21

shows the average estimates of genetic divergence (K2P) based on the COI barcode region among the studied nemacheilid species. Eidinemacheilus smithi of both localities (Tuveh and Loven) clustered together, showing a 1.39% K2P distance between these populations. This distance between E. smithi of Tuveh and Loven with E. proudlovei was 8.06 and 7.67, respectively (Table 3). The topologies from the ML and BI analyses were similar, hence the BI tree including the posterior probability estimates (PP) also plots the bootstrap values from the ML analysis for the clades that both of the analyses have in common (Figure 3). The monophyly of the genus Eidinemacheilus with the two described species is confirmed in both of the analyses. Eidinemacheilus is placed in a bigger clade containing the genera Oxynoemacheilus, Paraschistura, Schistura, Sasanidus, and Nemachilichthys. However, the relationships among these genera are unresolved. This clade is sister to the genus Triplophysa.

Distribution.Eidinemacheilus smithi is currently known from its type locality, Loven cave and Tuveh spring, Iran (Figure 2 and Figure 4).

4. Discussion

A review of available studies suggests the presence of at least eight fish species known to inhabit the subterranean environments of the Middle Eastern countries mainly in the Zagros mountains in the Irano-Anatolian hotspot [11]. These subterranean environments harbor important endemic species. In this study, we used a combined morphological and molecular approach to investigate cave-dwelling fishes of the Zagros Mts, western Iran and reported on a new locality for the Iranian blind loach, Eidinemacheilus smithi. The morphological characteristics and K2P distances indicated that the E. smithi populations in Tuveh and Loven belong to the same species, genetic and morphological variations notwithstanding. The main problem with our analyses was the unavailability of materials from the Loven cave and data on GenBank other than COI to warrant inclusion of more genetic markers.

Eidinemacheilus smithi is distinguished from its congeneric species, E. proudlovei, the only other troglomorphic nemacheilid loach species in the Middle East, and the only other species in Eidinemacheilus known so far, by having 7 + 7 branched caudal-fin rays (vs. 8 + 8 or 8 + 7), an adipose keel on the caudal peduncle (vs. absent), and a reduced head canal system (fully developed).

Vatandoust et al. [21] reported two cave Garra species (G. typhlops and G. lorestanensis) from the Tuveh spring, known already from the Loven cave which is the type locality for Garra typhlops and G. lorestanensis. Furthermore, based on the photographed specimens of E. smithi they also hypothesized the presence of that species in the Tuveh spring, now confirmed. That these three species inhabit both Tuveh and Loven implies the presence of a large aquifer. We suggest that these cave fishes may be found more widely than is currently known. During floods, for example, a number of specimens or their eggs may be washed out from the Loven cave to other streams, springs, and groundwaters, which facilitates the colonization of new habitats. That said, the 1.39% K2P detected genetic distance between the specimens from Tuveh and Loven does suggest that these populations have been isolated, and so colonization may be a rare event. Vatandoust et al. [21] reported a 0.7% K2P distance in COI between the populations of Garra lorestanensis of these two habitats.

Tuveh spring is seasonal and is completely dry during summer. Presumably, the fish specimens die or disperse into rivers. Since we are not aware of any subterranean pools, ponds, or wells around Tuveh spring, these habitats cannot receive immediate protection. Considerable genetic differences between the haplotypes of Tuveh and Loven fishes also preclude any transfers of specimens to the Loven cave. However, the vast area around should be protected to reduce the potential threats for these narrowly endemic species. The Lorestan salamander, Neurergus kaiseri Schmidt, 1952, also known from several localities in this area, is considered as vulnerable due to the limited and fragmented range of this species [31,32]. This reinforces the importance of documenting the biodiversity of this area.

Recently, we described a new obligate groundwater species of asellid crustacean from the Ganow spring, about a kilometer east of Tuveh [33], and a new species of troglobiont gastropod from this aquifer is awaiting description. These findings suggest that increased field efforts will continue to reveal more troglobiont species inhabiting this big aquifer.

In closing, the Iranian cave fishes from Loven cave are Vulnerable (VU) according to the IUCN list [34,35,36]. The discovery of new localities for these species keeps us hopeful of preventing the extinction of these vulnerable species. Scientific depredation, droughts and floods, landslides, improper dam constructions, and improper extraction of water from this area are the main threats to the Iranian cave fishes.