Next Article in Journal
Phylogenetic Reconstruction of the Rainforest Lineage Fontainea Heckel (Euphorbiaceae) Based on Chloroplast DNA Sequences and Reduced-Representation SNP Markers
Next Article in Special Issue
Cave-Dwelling Populations of the Monstrous Rainfrog (Craugastor pelorus) from Mexico
Previous Article in Journal
Catalyzing Red List Assessments of Underrepresented Taxa through Partner Networks and Student Engagement
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Locality for the Blind Loach, Eidinemacheilus smithi (Teleostei: Nemacheilidae) in Iranian Zagros: A Morpho-Molecular Approach

1
Department of Organisms and Ecosystems Research, National Institute of Biology, SI-1000 Ljubljana, Slovenia
2
Jovan Hadži Institute of Biology, Research Centre of the Slovenian, Academy of Sciences and Arts, SI-1000 Ljubljana, Slovenia
3
Department of Biology, Biotechnical Faculty, University of Ljubljana, SI-1000 Ljubljana, Slovenia
4
Department of Marine Biology, Faculty of Marine Sciences and Technology, Hormozgan University, Bandar Abbas 7916193145, Iran
5
Ichthyology and Molecular Systematics Research Lab., Department of Biology, College of Sciences, Shiraz University, Shiraz 7146713565, Iran
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(9), 724; https://doi.org/10.3390/d14090724
Submission received: 24 August 2022 / Revised: 27 August 2022 / Accepted: 30 August 2022 / Published: 1 September 2022
(This article belongs to the Special Issue Cave Biodiversity and Conservation)

Abstract

:
Four obligate cave fish species have been recorded from Zagros in Iran: Garra typhlops (Bruun and Kaiser, 1944), G. lorestanensis (Mousavi-Sabet and Eagderi, 2016), G. tashanensis (Mousavi-Sabet, Vatandoust, Fatemi and Eagderi, 2016) and Eidinemacheilus smithi (Greenwood, 1976). So far, the only known locality of the latter has been the Loven cave. Here, we extend the known range of the Zagros blind loach (E. smithi) by reporting a new locality, the Tuveh spring, located 31 km south of Loven. We combine morphological evidence with the calculated K2P genetic divergences of 1.39% between Tuveh and Loven to confirm that these populations are conspecific. Our discovery of the second E. smithi population has implications for the conservation of this rare and vulnerable species.

1. Introduction

Subterranean environments including caves are among the most extreme ecosystems on earth, as the restricted access to food and the conditions of darkness and humidity make these habitats challenging for living organisms to inhabit. Despite this, many taxa have colonized the subterranean environments, including arthropods and vertebrates [1,2]. The subterranean environments harbor a high diversity of animals and many of them have adapted to life in such habitats. However, regarding the low productivity of hypogean environments, the biodiversity of subterranean environments is much lower than that of the surface. To date, over 22 hotspots of troglobiotic biodiversity, each harboring more than 25 troglobiont/stygobiont species, have been reported globally [2,3,4,5]. Unlike numerous troglobiotic invertebrates, e.g., mollusks, sponges, worms, and arthropods [6,7,8], according to discoveries up to date, only two vertebrate groups, i.e., fishes and salamanders, have colonized subterranean habitats with species that show troglomorphic adaptations [9,10]. With more than 280 known species of troglobiont representatives, the cave fishes are the most species-rich vertebrates in the groundwaters of the world [11]. According to Proudlove [11], the family Nemacheilidae comprises 62 known subterranean species, all but one found in Asia.
The history of Iranian subterranean animal research coincided with railway construction in 1900 [12], with the discovery of the Loven cave in the western Iranian Lorestan Province. At the time, a new cyprinid cave-dwelling species was named Iranocypris typhlops (Bruun and Kaiser, 1944), which today is in the genus Garra [13,14,15]. Recently, Mousavi-Sabet and Eagderi [16] revealed that Garra of the Loven cave belong to two distinct species: G. typhlops (Bruun and Kaiser, 1944) and G. lorestanensis Mousavi-Sabet and Eagderi, 2016. From this locality, Greenwood [17] named another fish species, Noemacheilus smithi Greenwood, 1976 (family Nemacheilidae). Hashemzadeh Segherloo et al. [18] transferred the species to Eidinemacheilus, a genus of loaches with only two cave-dwelling species: E. smithi is endemic to an aquifer in the Karun River drainage in the Zagros Mountains, and E. proudlovei Freyhof, Abdullah, Ararat, Ibrahim and Geiger, 2016, is endemic to subterranean waters in the Little Zab River drainage in Iraqi Kurdistan [19].
Mahjoorazad and Coad [20] and Vatandoust et al. [21] reported G. typhlops and G. lorestanensis from two different localities. The first locality is about 130 km to the west of Loven, and the second one is located 31 km to the south of Loven. These reports may reveal the potential presence of a large freshwater aquifer in the Zagros Mountains. Vatandoust et al. [21] also hypothesized, based on anecdotal and photographic evidence, the presence of E. smithi in the Tuveh spring, but this has not been confirmed.
Garra tashanensis, Mousavi-Sabet, Vatandoust, Fatemi and Eagderi, 2016, is another subterranean fish species from the Tashan cave in the southeastern part of Iran in Zagros Mountains [22].
Our aims here are: (i) to report a new locality for the Iranian blind loach Eidinemacheilus smithi, (ii) to provide morphological characteristics of the collected specimens and a morphological comparison with those from the type locality (Loven cave), and (iii) to use molecular data to test the taxonomic status of these two populations from the Tuveh spring and the Loven cave.

2. Material and Methods

2.1. Taxon Sampling

Specimens were collected on 30 May 2019, using a hand net in a seasonal spring of Tuveh, close to Tuveh village, Andimeshk, Khuzestan Province (32°48′47″ N, 48°43′06″ E, altitude 495 m a.s.l.) (Figure 1). It is a seasonal spring with a high amount of water flowing during the rainy seasons, usually from November till May–June. The flowing water gets lower from April and the outlet of the spring is terminated completely in summer. The spring is a part of the Dez River drainage. The Tuveh spring is about 31 km to the south of the Loven cave, the type locality of E. smithi.

2.2. Morphological Study

Measurements were completed using a digital caliper and recorded to 0.1 mm. All of the measurements were made point to point, never by projections. Methods for counts and measurements followed Kottelat and Freyhof [23]. Standard length (SL) was measured from the tip of the snout to the end of the hypural complex. The length of the caudal peduncle was measured from behind the base of the last anal-fin ray to the end of the hypural complex, at mid-height of the caudal-fin base. The last two branched rays articulating on a single pterygiophore in the dorsal and anal fins are noted as “1½”. Caudal peduncle depth was measured at the tip of the posterior-most anal-fin ray.
Abbreviations. SL, standard length; HL, head length; ZM-CBSU, Zoological Museum of Shiraz University, Collection of Biology Department, Shiraz, Iran.

2.3. Molecular Study

DNA was isolated from the fin tissue of three specimens of E. smithi from the Tuveh spring and two specimens of each of the three species of the family Nemacheilidae: Oxynoemacheilus euphraticus (Bănărescu and Nalbant, 1964), Paraschistura ilamensis (Vatandoust and Eagderi, 2015), and Sasanidus kermanshahensis (Bănărescu and Nalbant, 1966) from Iran. From GenBank, we obtained additional COI sequences of other genera of this family (Table 1). Lefua nikkonis (Jordan and Fowler, 1903) was used as the outgroup. GenBank accession numbers are listed in Table 1.
Molecular procedures were completed at the Evolutionary Zoology Laboratory, Jovan Hadži Institute of Biology ZRC-SAZU, Ljubljana (EZ LAB, Slovenia). The DNA was isolated applying Robotic DNA extraction protocol using Mag MAX™ Express magnetic particle processor Type 700 with DNA Multisample kit (Thermo Fisher Scientific kit) and modified protocols following Vidergar et al. [24]. We amplified fragments of the mitochondrial marker: 3′end of cytochrome c oxidase subunit 1 gene (COI) using the primers: VF2_t1 (5′ TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC) and FR1d_t1 (5′ CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA) [25]. PCR reactions were executed in a 35 μL volume using EH2O: 18.8 μL, Buffer: 7.1 μL, dNTPS (2 mM): 3.5 μL, MgCl2 (25 mM): 3.2 μL, Primer (20 mM): 1 μL forward and 1 μL reverse, polymerase 0.2 μL, and BSA 0.2 μL. The following protocol was applied for PCR: 94 °C for 120 s, 35 cycles of 94 °C for 30 s, 52 °C for 40 s, and 72 °C for 60 s, with a final extension at 72 °C for 10 min. The PCR products were sent to Macrogen Europe (Amsterdam, the Netherlands) for sequencing. We used ChromasPro 2.1.3 (Technelysium, Tewantin, Australia) to assemble the sequences, as well as for editing and proofreading. We used MEGA [26] for alignments and to find the best substitutional model for Bayesian and Maximum Likelihood analyses and as well to estimate K2P Pairwise Distances. For data curation, we used Mesquite version 3.7 [27]. The matrix contained 582 bp. We conducted Bayesian inference using MrBayes v. 3.2.7a [28] to reconstruct the phylogenetic position of the new population of E. smithi from the Tuveh spring, its congeners and related genera. The Bayesian inference of phylogeny was conducted for 20 million generations with four MCMC chains and with a sampling frequency of 1000. A relative burn-in was set to 25% and checked for the MCMC chain convergence in Tracer 1.7 [29]. We generated maximum likelihood phylogenetic trees with 1000 bootstrap replicates in IQ-tree 1.6.7 [30]. The analyses were generated under the HKY+G+I model of nucleotide substitution.
TAXONOMY
Family Nemacheilidae Regan, 1911
Eidinemacheilus smithi(Greenwood, 1976)
Examined materials. ZM-CBSU es-101, 2 specimens, 24.6–25.1 mm SL., Iran: Khuzestan Province, Andimeshk, Tuveh village, Tuveh spring, 32°48′47″ N, 48°43′06″ E.
Diagnosis. Eidinemacheilus smithi is distinguished from E. proudlovei, the only other troglomorphic nemacheilid loach species in the Middle East, and the only other species in Eidinemacheilus known so far, by having 7 + 7 branched caudal-fin rays (vs. 8 + 8 or 8 + 7), adipose keel on the caudal peduncle (vs. absent), and a reduced head canal system (fully developed).
Description. See Figure 2 for general appearance and Table 2 for morphometric data. Medium sized, moderately stout species with large head. Body deepest at dorsal-fin origin, profile of back straight, or body depth slightly decreasing towards dorsal-fin origin, and slowly decreasing below dorsal-fin base and towards caudal-fin base. No hump at nape. Greatest body width at pectoral-fin base. Head conical, flattened on ventral surface. Caudal peduncle compressed laterally, 1.5–1.6 times longer than deep.
Pectoral fin reaching approximately 79–84% of distance from pectoral-fin origin to pelvic-fin origin. Pelvic axillary lobe absent. Pelvic-fin origin below unbranched or first branched dorsal-fin ray. Pelvic fin not reaching to anus. Anal-fin origin shortly behind anus. Anal-fin origin at vertical of middle between dorsal- and caudal-fin origins. A dorsal adipose crest on caudal peduncle. Margin of dorsal fin straight. Caudal fin moderately emarginated.
Dorsal fin with 7½ branched rays. Anal fin with 5½ branched rays. Caudal fin with 7 + 7 branched rays. Pectoral fin with 10 and pelvic fin with 5 branched rays. Scales absent. Lateral line complete. Anterior nostril opening on anterior side of a low, pointed, and flap-like tube. Nostrils adjacent to each other, tip of anterior nostril overlaps posterior nostril when folded backwards. No suborbital flap, Groove or slit in fishes examined. Mouth very large, slightly arched. Lips moderately thick, upper lip smooth or with fine ridges, lower lip with deep furrows. A median interruption in lower lip. Barbels short, inner rostral barbell reaching to base or slightly behind of outer rostral barbel; outer rostral barbel reaching to base or slightly behind of maxillary barbel. Maxillary barbel reaching to base of outer rostral barbel when folded to front.

3. Molecular Results

The morphological identification was confirmed by DNA barcoding of the specimen collected from the Tuveh spring. Table 3 shows the average estimates of genetic divergence (K2P) based on the COI barcode region among the studied nemacheilid species. Eidinemacheilus smithi of both localities (Tuveh and Loven) clustered together, showing a 1.39% K2P distance between these populations. This distance between E. smithi of Tuveh and Loven with E. proudlovei was 8.06 and 7.67, respectively (Table 3). The topologies from the ML and BI analyses were similar, hence the BI tree including the posterior probability estimates (PP) also plots the bootstrap values from the ML analysis for the clades that both of the analyses have in common (Figure 3). The monophyly of the genus Eidinemacheilus with the two described species is confirmed in both of the analyses. Eidinemacheilus is placed in a bigger clade containing the genera Oxynoemacheilus, Paraschistura, Schistura, Sasanidus, and Nemachilichthys. However, the relationships among these genera are unresolved. This clade is sister to the genus Triplophysa.
Distribution.Eidinemacheilus smithi is currently known from its type locality, Loven cave and Tuveh spring, Iran (Figure 2 and Figure 4).

4. Discussion

A review of available studies suggests the presence of at least eight fish species known to inhabit the subterranean environments of the Middle Eastern countries mainly in the Zagros mountains in the Irano-Anatolian hotspot [11]. These subterranean environments harbor important endemic species. In this study, we used a combined morphological and molecular approach to investigate cave-dwelling fishes of the Zagros Mts, western Iran and reported on a new locality for the Iranian blind loach, Eidinemacheilus smithi. The morphological characteristics and K2P distances indicated that the E. smithi populations in Tuveh and Loven belong to the same species, genetic and morphological variations notwithstanding. The main problem with our analyses was the unavailability of materials from the Loven cave and data on GenBank other than COI to warrant inclusion of more genetic markers.
Eidinemacheilus smithi is distinguished from its congeneric species, E. proudlovei, the only other troglomorphic nemacheilid loach species in the Middle East, and the only other species in Eidinemacheilus known so far, by having 7 + 7 branched caudal-fin rays (vs. 8 + 8 or 8 + 7), an adipose keel on the caudal peduncle (vs. absent), and a reduced head canal system (fully developed).
Vatandoust et al. [21] reported two cave Garra species (G. typhlops and G. lorestanensis) from the Tuveh spring, known already from the Loven cave which is the type locality for Garra typhlops and G. lorestanensis. Furthermore, based on the photographed specimens of E. smithi they also hypothesized the presence of that species in the Tuveh spring, now confirmed. That these three species inhabit both Tuveh and Loven implies the presence of a large aquifer. We suggest that these cave fishes may be found more widely than is currently known. During floods, for example, a number of specimens or their eggs may be washed out from the Loven cave to other streams, springs, and groundwaters, which facilitates the colonization of new habitats. That said, the 1.39% K2P detected genetic distance between the specimens from Tuveh and Loven does suggest that these populations have been isolated, and so colonization may be a rare event. Vatandoust et al. [21] reported a 0.7% K2P distance in COI between the populations of Garra lorestanensis of these two habitats.
Tuveh spring is seasonal and is completely dry during summer. Presumably, the fish specimens die or disperse into rivers. Since we are not aware of any subterranean pools, ponds, or wells around Tuveh spring, these habitats cannot receive immediate protection. Considerable genetic differences between the haplotypes of Tuveh and Loven fishes also preclude any transfers of specimens to the Loven cave. However, the vast area around should be protected to reduce the potential threats for these narrowly endemic species. The Lorestan salamander, Neurergus kaiseri Schmidt, 1952, also known from several localities in this area, is considered as vulnerable due to the limited and fragmented range of this species [31,32]. This reinforces the importance of documenting the biodiversity of this area.
Recently, we described a new obligate groundwater species of asellid crustacean from the Ganow spring, about a kilometer east of Tuveh [33], and a new species of troglobiont gastropod from this aquifer is awaiting description. These findings suggest that increased field efforts will continue to reveal more troglobiont species inhabiting this big aquifer.
In closing, the Iranian cave fishes from Loven cave are Vulnerable (VU) according to the IUCN list [34,35,36]. The discovery of new localities for these species keeps us hopeful of preventing the extinction of these vulnerable species. Scientific depredation, droughts and floods, landslides, improper dam constructions, and improper extraction of water from this area are the main threats to the Iranian cave fishes.

Author Contributions

Conceptualization, M.K. and M.J.M.-H.; methodology, Y.F., M.J.M.-H. and H.R.E.; software and formal analysis, M.J.M.-H.; all contributed to data compilation, data interpretation, writing, and editing, M.J.M.-H., Y.F., H.R.E., T.L. and M.K. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Slovenian Research Agency (J1-9163, P1-0255).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful to Hushang Arefian, Bizhan Jerang and Norallah Jerang from Tuveh village, for their hospitality and guidance during field works. We are thankful to Golnaz Sayyadzadeh for help in completing the morphometries. We thank Matjaž Gregorič and Klemen Čandek for the guidance in the molecular lab.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. White, W.; Culver, D. Encyclopedia of Caves, 2nd ed.; Academic Press: New York, NY, USA, 2011. [Google Scholar]
  2. Culver, D.C.; Deharveng, L.; Pipan, T.; Bedos, A. An Overview of Subterranean Biodiversity Hotspots. Diversity 2021, 13, 487. [Google Scholar] [CrossRef]
  3. Culver, D.C.; Sket, B. Hotspots of Subterranean Biodiversity in Caves and Wells. J. Cave Karst Stud. 2000, 62, 11–17. [Google Scholar]
  4. Pipan, T.; Deharveng, L.; Culver, D.C. Hotspots of subterranean biodiversity. Diversity 2020, 12, 209. [Google Scholar] [CrossRef]
  5. Brad, T.; Ieper, S.; Sarbu, S.M. The Chemoautotrophically Based Movile Cave Groundwater Ecosystem, a Hotspot of Subterranean Biodiversity. Diversity 2021, 13, 128. [Google Scholar] [CrossRef]
  6. Fatemi, Y.; Malek-Hosseini, M.J.; Falniowski, A.; Hofman, S.; Kuntner, M.; Grego, J. Description of a new genus and species as the first gastropod species from caves in Iran. J. Cave. Karst. Stud. 2019, 81, 233–243. [Google Scholar] [CrossRef]
  7. Romero, A. Cave Biology, Life in Darkness; Cambridge University Press: New York, NY, USA, 2009. [Google Scholar]
  8. Khalaji-Pirbalouty, V.; Fatemi, Y.; Malek-Hosseini, M.J.; Kuntner, M. A new species of Stenasellus Dollfus, 1897 from Iran, with a key to the western Asian species (Crustacea, Isopoda, Stenasellidae). ZooKeys 2018, 766, 39–50. [Google Scholar] [CrossRef]
  9. Culver, D.C.; Holsinger, J.R. How many species of troglobites are there? Natl. Speleol. Soc. Bull. 1992, 54, 79–80. [Google Scholar]
  10. Camacho, A.I. The Natural History of Biospeleology; Museo Nacional de Ciencias Naturales: Madrid, Spain, 1992. [Google Scholar]
  11. Proudlove, G.S. Subterranean Fishes of the World. Available online: https://cavefishes.org.uk/ (accessed on 21 March 2022).
  12. Bruun, A.F.; Kaiser, E.W. Iranocypris typhlops ng., n. sp., the first true cave fish from Asia. Dan. Sci. Investig. Iran Cph. 1944, 4, 1–8. [Google Scholar]
  13. Farashi, A.; Kaboli, M.; Rezaei, H.R.; Naghavi, M.R.; Rahimian, H.; Coad, B.W. Reassessment of the taxonomic position of Iranocypris typhlops Bruun & Kaiser, 1944 (Actinopterygii, Cyprinidae). ZooKeys 2014, 374, 69–77. [Google Scholar] [CrossRef]
  14. Esmaeili, H.R.; Sayyadzadeh, G.; Coad, B.W.; Eagderi, S. Review of the genus Garra Hamilton, 1822 in Iran with description of a new species: A morpho-molecular approach (Teleostei: Cyprinidae). Iran. J. Ichthyol. 2016, 3, 82–121. [Google Scholar]
  15. Sayyadzadeh, G.; Esmaeili, H.R.; Freyhof, J. Garra mondica, a new species from the Mond River drainage with remarks on the genus Garra from the Persian Gulf basin in Iran (Teleostei: Cyprinidae). Zootaxa 2015, 4048, 75–89. [Google Scholar] [CrossRef] [PubMed]
  16. Mousavi-Sabet, H.; Eagderi, S. Garra lorestanensis, a new cave fish from the Tigris River drainage with remarks on the subterranean fishes in Iran (Teleostei: Cyprinidae). FishTaxa 2016, 1, 45–54. [Google Scholar]
  17. Greenwood, P.H. A new and eyeless cobitid fish (Pisces, Cypriniformes) from the Zagros Mountains, Iran. J. Zool. 1976, 180, 129–137. [Google Scholar] [CrossRef]
  18. Hasemzadeh-Segherloo, I.; Ghaedrahmati, N.; Freyhof, J. Eidinemacheilus, a new generic name for Noemacheilus smithi Greenwood (Teleostei; Nemacheilidae). Zootaxa 2016, 4147, 466–476. [Google Scholar] [CrossRef]
  19. Freyhof, J.; Abdullah, Y.S.; Ararat, K.; Ibrahim, H.; Geiger, M.F. Eidinemacheilus proudlovei, a new subterranean loach from Iraqi Kurdistan (Teleostei; Nemacheilidae). Zootaxa 2016, 4173, 225–236. [Google Scholar] [CrossRef] [PubMed]
  20. Mahjoorazad, A.; Coad, B.W. A new cave fish locality for Iran. Electron. J. Ichthyol. 2009, 2, 30–33. [Google Scholar]
  21. Vatandoust, S.; Mousavi-Sabet, H.; Geiger, M.F.; Freyhof, J. A new record of Iranian subterranean fishes reveals the potential presence of a large freshwater aquifer in the Zagros Mountains. J. Appl. Ichthyol. 2019, 35, 1269–1275. [Google Scholar] [CrossRef]
  22. Mousavi-Sabet, H.; Vatandoust, S.; Fatemi, Y.; Eagderi, S. Tashan Cave a new cave fish locality for Iran; and Garra tashanensis, a new blind species from the Tigris River drainage (Teleostei: Cyprinidae). FishTaxa 2016, 1, 133–148. [Google Scholar]
  23. Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Kottelat, Cornol & Freyhof: Berlin, Germany, 2007. [Google Scholar]
  24. Vidergar, N.; Toplak, N.; Kuntner, M. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics. PLoS ONE 2014, 9, e113030. [Google Scholar] [CrossRef]
  25. Ivanova, N.V.; Zemlak, T.S.; Hanner, R.H.; Hebert, P.D.N. Universal primer cocktails for fish DNA barcoding. Mol. Ecol. Notes 2007, 7, 544–548. [Google Scholar] [CrossRef]
  26. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  27. Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis. Version 3.6. 2018. Available online: http://www.mesquiteproject.org (accessed on 2 June 2021).
  28. Huelsenbeck, J.P.; Ronquist, F. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed]
  29. Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
  30. Nguyen, T.; Schmidt, H.A.; Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2014, 32, 268–274. [Google Scholar] [CrossRef]
  31. Mobaraki, A.; Amiri, M.; Alvandi, R.; Tehrani, M.E.; Kia, H.Z.; Khoshnamvand, A.; Bali, A.; Forozanfar, E.; Browne, R.K. A conservation reassessment of the critically endangered, Lorestan newt Neurergus kaiseri (Schmidt 1952) in Iran. Amphib. Reptile Conserv. 2014, 9, 16–25. [Google Scholar]
  32. Ashrafzadeh, M.R.; Naghipour, A.A.; Haidarian, M.; Kusza, S.; Pilliod, D.S. Effects of climate change on habitat and connectivity for populations of a vulnerable, endemic salamander in Iran. GECCO 2019, 19, e00637. [Google Scholar] [CrossRef]
  33. Malek-Hosseini, M.J.; Jugovic, J.; Fatemi, Y.; Kuntner, M.; Kostanjšek, R.; Douady, C.J.; Malard, F. A new obligate groundwater species of Asellus (Isopoda, Asellidae) from Iran. Subterr. Biol. 2022, 42, 97–124. [Google Scholar] [CrossRef]
  34. Coad, B.W. Threatened fishes of the world: Iranocypris typhlops Bruun and Kaiser, 1944 (Cyprinidae). Environ. Biol. Fish 1996, 46, 374. [Google Scholar] [CrossRef]
  35. Coad, B.W.; Mehrani, R.; Najafpour, N. Threatened fishes of the world: Paracobitis smithi (Greenwood, 1976) (Balitoridae). Environ. Biol. Fish 2009, 84, 323. [Google Scholar] [CrossRef] [Green Version]
  36. IUCN Red List of Threatened Species. Available online: https://www.iucnredlist.org (accessed on 21 March 2022).
Figure 1. Map of Iran showing the two known Eidinemacheilus smithi localities. In addition to the previously known locality in red, this paper reports a new locality in yellow. The green circle shows the locality of Eidinemacheilus proudlovei in Iraq.
Figure 1. Map of Iran showing the two known Eidinemacheilus smithi localities. In addition to the previously known locality in red, this paper reports a new locality in yellow. The green circle shows the locality of Eidinemacheilus proudlovei in Iraq.
Diversity 14 00724 g001
Figure 2. Eidinemacheilus smithi from Tuveh spring SL: 25 mm.
Figure 2. Eidinemacheilus smithi from Tuveh spring SL: 25 mm.
Diversity 14 00724 g002
Figure 3. Bayesian and Maximum-Likelihood phylogeny reconstructed based on 582 bp of COI. The values show BI posterior probability (black) and maximum-likelihood (ML; blue) node supports. The topology is from the maximum-likelihood analysis. The values less than 60% are not shown.
Figure 3. Bayesian and Maximum-Likelihood phylogeny reconstructed based on 582 bp of COI. The values show BI posterior probability (black) and maximum-likelihood (ML; blue) node supports. The topology is from the maximum-likelihood analysis. The values less than 60% are not shown.
Diversity 14 00724 g003
Figure 4. Tuveh spring in rainy season (A) and the stream path down to the spring in dry season (B).
Figure 4. Tuveh spring in rainy season (A) and the stream path down to the spring in dry season (B).
Diversity 14 00724 g004
Table 1. Taxonomic and gene information (GenBank accession numbers) data for the taxa used in our analyses. Original sequence data are indicated in bold typeface.
Table 1. Taxonomic and gene information (GenBank accession numbers) data for the taxa used in our analyses. Original sequence data are indicated in bold typeface.
No.SpeciesVoucher Number and COI Accession Number
1Eidinemacheilus smithi (Tuveh)F-32: OP310812; F33: OP310813; F34: OP310814
2Eidinemacheilus smithi 1, 2 (Loven)KX429660 / KX461958
3Eidinemacheilus proudloveiKX774390
4Nemachilichthys rueppelliKU928278
5Oxynoemacheilus angoraeAP011233
6Oxynoemacheilus euphraticusF-39: OP310815; F-40: OP310816
7Oxynoemacheilus euphraticusMK546456
8Oxynoemacheilus parvinaeKX980092
9Paracobitis zabgawraensisMK238776
10Paraschistura ilamensisF-37: OP310817; F-38: OP310818
11Paraschistura ilamensisMN258032
12Paraschistura naumanniKY808480.
13Paraschistura nielseniKY808482
14Sasanidus kermanshahensisF-35: OP310819; F-36: OP310820
15Sasanidus kermanshahensisKU928288
16Schistura beavaniHQ219200
17Schistura khugaeKJ909375
18Schistura longaKM610912
19Schistura notostigmaNC_031585
20Schistura poculiKM610972
21Schistura savonaKJ542586
22Triplophysa gundriseriKX039656
23Triplophysa orientalisNC_030505
24Lefua nikkonisNC_027662
Table 2. Morphometric data of E. smithi. ZM-CBSU es-101, n = 2.
Table 2. Morphometric data of E. smithi. ZM-CBSU es-101, n = 2.
Measured CharactersMinMaxMeanSD
Standard length (mm)24.625.124.8
In percent of standard length
Head length2425.424.71.0
Body depth at dorsal-fin origin12.613.012.80.2
Body width at dorsal-fin origin4.65.55.10.6
Pre-dorsal length46.548.547.51.4
Post-dorsal length41.841.841.80.01
Pre-pelvic length51.851.951.80.7
Pre-anal length73.374.373.80.7
Distance between pectoral and pelvic-fin origins26.127.726.91.1
Distance between pelvic and anal-fin origins20.923.522.21.9
Depth of caudal peduncle9.89.99.80.1
Length of caudal peduncle14.616.015.30.9
Dorsal-fin length23.224.724.01.1
Pectoral-fin length21.822.021.90.1
Pelvic-fin length12.614.413.51.2
In percent of head length
Head depth at nape44.045.844.91.2
Maximum head width45.648.346.91.9
Inner rostral–barbel length17.918.918.40.7
Outer rostral–barbel length39.641.540.61.3
Maxillary–barbel length25.528.226.81.9
Table 3. Estimates of the average COI divergence (K2P distance) between examined Nemacheilidae species.
Table 3. Estimates of the average COI divergence (K2P distance) between examined Nemacheilidae species.
NOSpecies12345678910111213141516171819
1Eidinemacheilus smithi F32-Tuveh
2E. smithi 1- Loven1.39
3E. proudlovei8.06 7.67
4Nemachilichthys rueppelli 18.05 18.49 16.52
5Oxynoemacheilus angorae 19.30 18.85 19.16 18.76
6O. euphraticus_F39 20.07 19.62 18.97 19.82 13.15
7O. parvinae 20.49 20.02 18.54 22.56 15.92 12.71
8Paracobitis zabgawraensis 17.41 17.19 17.66 15.98 16.70 19.10 20.00
9Paraschistura ilamensis_F37 13.75 13.97 15.03 17.77 18.12 20.55 21.96 17.21
10P. naumanni 13.97 13.55 13.56 15.78 18.84 17.13 20.80 16.1311.43
11P. nielseni 13.62 13.84 13.80 18.31 18.62 19.21 22.98 18.877.8812.53
12Sasanidus kermanshahensis_F35 16.75 16.53 16.82 18.85 19.61 18.12 21.19 19.6814.6116.1514.95
13Schistura beavani 14.11 14.11 12.88 15.95 16.05 15.92 16.58 16.4913.6612.0112.7514.56
14S. khugae 13.08 13.29 12.07 13.57 16.33 15.15 17.35 15.2112.6211.0412.1215.146.48
15S. longa 14.13 13.92 11.81 14.05 17.44 16.42 15.98 16.9213.8812.0713.5514.757.667.27
16S. notostigma 16.69 16.91 16.05 16.51 18.71 19.76 20.42 17.5618.6916.1418.4217.3117.1914.5616.76
17S. poculi 14.53 14.32 12.03 13.61 17.41 16.61 15.95 16.4714.0712.4613.5315.157.847.070.5216.52
18S. savona 15.83 14.99 16.17 16.33 17.11 18.54 22.19 17.7415.8714.6016.4618.5914.3815.8516.3114.7116.50
19Triplophysa gundriseri 20.75 21.92 22.64 21.41 22.18 24.80 26.46 22.5221.3619.5220.5823.9517.9119.0319.4622.1519.6520.65
20T. orientalis 21.96 22.91 23.73 21.62 22.56 25.47 27.57 19.9218.4421.4020.7222.9121.7721.5222.4224.3122.6220.1910.21
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Malek-Hosseini, M.J.; Fatemi, Y.; Esmaeili, H.R.; Lokovšek, T.; Kuntner, M. A New Locality for the Blind Loach, Eidinemacheilus smithi (Teleostei: Nemacheilidae) in Iranian Zagros: A Morpho-Molecular Approach. Diversity 2022, 14, 724. https://doi.org/10.3390/d14090724

AMA Style

Malek-Hosseini MJ, Fatemi Y, Esmaeili HR, Lokovšek T, Kuntner M. A New Locality for the Blind Loach, Eidinemacheilus smithi (Teleostei: Nemacheilidae) in Iranian Zagros: A Morpho-Molecular Approach. Diversity. 2022; 14(9):724. https://doi.org/10.3390/d14090724

Chicago/Turabian Style

Malek-Hosseini, Mohammad Javad, Yaser Fatemi, Hamid Reza Esmaeili, Tjaša Lokovšek, and Matjaž Kuntner. 2022. "A New Locality for the Blind Loach, Eidinemacheilus smithi (Teleostei: Nemacheilidae) in Iranian Zagros: A Morpho-Molecular Approach" Diversity 14, no. 9: 724. https://doi.org/10.3390/d14090724

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop