Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II
Abstract
1. Introduction
2. Methods and Materials
2.1. Tissue Collection
2.2. DNA Extraction
2.3. PCR Amplification and Sequencing
3. Results and Data Resources
Sequence Characteristics and Upload to BOLD and GenBank
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gostel, M.R.; Kelloff, C.L.; Wallick, K.; Funk, V.A. A workflow to preserve genome-quality tissue samples from plants in botanical gardens and arboreta. Appl. Plant. Sci. 2016, 4, 1600039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Funk, V.A.; Gostel, M.R.; Devine, A.; Kelloff, C.L.; Wurdack, K.; Tuccinardi, C.; Radosavljevic, A.; Peters, M.; Coddington, J.A. Guidelines for collecting vouchers and tissues intended for genomic work (Smithsonian Institution): Botany Best Practices. Biodivers. Data J. 2017, 5, e11625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seberg, O.; Droege, G.; Barker, K.B.; Coddington, J.A.; Funk, V.A.; Gostel, M.R.; Peterson, G.; Smith, P.P. Global Genome Biodiversity Network: Saving a blueprint of the Tree of Life—A botanical perspective. Ann. Bot. 2016, 118, 393–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Soltis, D.E.; Kersey, P.J.; Wegrzyn, J.L.; Leebens-Mack, J.H.; Gostel, M.R.; Liu, X.; Soltis, P.S. Green plant genomes: What we know in an era of rapidly expanding opportunities. Proc. Natl. Acad. Sci. USA 2022, 119, e2115640118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zúñiga, J.D.; Gostel, M.R.; Mulcahy, D.G.; Barker, K.B.; Hill, A.; Sedaghatpour, M.; Vo, S.Q.; Funk, V.A.; Coddington, J.A. Data release: DNA barcodes of plant species collected for the Global Genome Initiative for Gardens program, National Museum of Natural History, Smithsonian Institution. PhytoKeys 2017, 88, 119–122. [Google Scholar] [CrossRef] [Scilit]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costion, C.M.; Kress, W.J.; Crayn, D.M. DNA barcodes confirm the taxonomic and conservation status of a species of tree on the brink of extinction in the Pacific. PLoS ONE 2016, 11, e0155118. [Google Scholar] [CrossRef] [Scilit]
- Staats, M.; Arulandhu, A.J.; Gravendeel, B.; Holst-Jensen, A.; Scholtens, I.; Peelen, T.; Prins, T.W.; Kok, E. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 2016, 408, 4615–4630. [Google Scholar] [CrossRef] [Scilit]
- Costion, C.; Ford, A.; Cross, H.; Crayn, D.; Harrington, M.; Lowe, A. Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS ONE 2011, 6, e26841. [Google Scholar] [CrossRef] [Scilit]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Brochmann, C.; Willerslev, E. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol. 2012, 21, 2045–2050. [Google Scholar] [CrossRef] [Scilit]
- Gostel, M.R.; Zúñiga, J.D.; Kress, W.J.; Funk, V.A.; Puente-Lelievre, C. Microfluidic enrichment barcoding (MEBarcoding): A new method for high throughput plant DNA barcoding. Sci. Rep. 2020, 10, 8701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cowart, D.A.; Pinheiro, M.; Mouchel, O.; Maguer, M.; Grall, J.; Miné, J.; Arnaud-Haond, S. Metabarcoding is powerful yet still blind: A comparative analysis of morphological and molecular surveys of seagrass communities. PLoS ONE 2015, 10, e0117562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bezeng, B.S.; Davies, T.J.; Daru, B.H.; Kabongo, R.M.; Maurin, O.; Yessoufou, K.; van der Bank, H.; van der Bank, M. Ten years of barcoding at the African Centre for DNA Barcoding. Genome 2017, 60, 629–638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coissac, E.; Hollingworth, P.M.; Lavergne, S.; Taberlet, P. From barcodes to genomes: Extending the concept of DNA barcod-ing. Mol. Ecol. 2016, 25, 1423–1428. [Google Scholar] [CrossRef] [Scilit]
- Kane, N.C.; Cronk, Q. Botany without borders: Barcoding in focus. Mol. Ecol. 2008, 17, 5175–5176. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. 2015, 90, 157–166. [Google Scholar] [CrossRef] [Scilit]
- Chua, P.Y.S.; Leerhøi, F.; Langkjaer, E.M.R.; Margaryan, A.; Noer, C.L.; Richter, S.R.; Restrup, M.E.; Bruun, H.H.; Hartvig, I.; Coissac, E.; et al. Towards the extended barcode concept: Generating DNA reference data through genome skimming of danish plants. bioRxiv 2021. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wei, J.; Yang, T.; Mu, W.; Song, B.; Yang, T.; Fu, Y.; Wang, X.; Hu, G.; Li, W.; et al. Molecular digitization of a botanical garden: High-depth whole-genome sequencing of 689 vascular plant species from the Ruili Botanical Garden. GigaScience 2019, 8, giz007. [Google Scholar] [CrossRef] [Scilit]
- Linsky, J.; Gostel, M.R. The Global Genome Iniatitive for Gardens: Conservation priorities at the interface of botanic gardens and biodiversity genomics. BGJournal 2021, 18, 21–23. [Google Scholar]
- CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [Scilit]
- Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369–8374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Erickson, D.L. (Eds.) DNA Barcodes: Methods and Protocols; Humana Press: Totowa, NJ, USA; Springer Science+Publishing Media, LLC.: New York, NY, USA, 2012; Volume 858, pp. 3–8. [Google Scholar]
- Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levin, R.A.; Wagner, W.L.; Hoch, P.C.; Nepokroeff, M.; Pires, J.C.; Zimmer, E.A.; Sytsma, K.J. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. Am. J. Bot. 2003, 90, 107–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Erickson, D.L.; Jones, F.A.; Swenson, N.G.; Perez, R.; Sanjur, O.; Bermingham, E. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. USA 2009, 106, 18621–18626. [Google Scholar] [CrossRef] [Scilit]
- Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; Van Alphen Stahl, J.; Kelly, L.J.; Wikström, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 2009, 159, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Dunning, L.T.; Savolainen, V. Broad-scale amplification of matK for DNA barcoding plants, a technical note. Bot. J. Linn. Soc. 2010, 164, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [Scilit]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. PCR Protocols: A Guide to Methods and Applications; Innis, M., Gelfand, D., Sninsky, J., White, T., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Sang, T.; Crawford, D.; Stuessy, T. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef] [Scilit]
- Tate, J.; Simpson, B. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003, 28, 723. [Google Scholar]
- Lowe, A.; Jones, L.; Witter, L.; Creer, S.; de Vere, N. Using DNA Metabarcoding to Identify Floral Visitation by Pollinators. Diversity 2022, 14, 2022020018. [Google Scholar] [CrossRef] [Scilit]
- Wang, A.; Wu, H.; Zhu, X.; Lin, J. Species Identification of Conyza Bonariensis Assisted by Chloroplast Genome Sequencing. Front. Genet. 2018, 9, 374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nithaniyal, S.; Newmaster, S.G.; Ragupathy, S.; Krishnamoorthy, D.; Vassou, S.L.; Parani, M. DNA Barcode Authentication of Wood Samples of Threatened and Commercial Timber Trees within the Tropical Dry Evergreen Forest of India. PLoS ONE 2014, 9, e107669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassold, S.; Lowry, P.P.; Bauert, M.R.; Razafintsalama, A.; Ramamonjisoa, L.; Widmer, A. DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species. PLoS ONE 2016, 11, e0157881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le, D.-T.; Zhang, Y.-Q.; Xu, Y.; Guo, L.-X.; Ruan, Z.-P.; Burgess, K.S.; Ge, X.-J. The utility of DNA barcodes to confirm the identification of palm collections in botanical gardens. PLoS ONE 2020, 15, e0235569. [Google Scholar] [CrossRef] [Scilit]
| Locus | Primer Name | Forward Primer Sequence | Annealing Temperature | Citation |
|---|---|---|---|---|
| rbcL | rbcLa-F | ATGTCACCACAAACAGAGACTAAAGC | 55 °C | [24] |
| rbcLa-R | GTAAAATCAAGTCCACCRCG | [25] | ||
| matK | matK-xf | TAATTTACGATCAATTCATTC | 54 °C | [26] |
| matK-MALP | ACAAGAAAGTCGAAGTAT | [27] | ||
| ITS2 | ITS_S2F | ATGCGATACTTGGTGTGAAT | 56 °C | [28] |
| ITS4 | TCCTCCGCTTATTGATATGC | [29] | ||
| psbA-trnH | psbA3_f | GTTATGCATGAACGTAATGCTC | 64 °C | [30] |
| trnHf_05 | CGCGCATGGTGGATTCACAATCC | [31] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gostel, M.R.; Carlsen, M.M.; Devine, A.; Barker, K.B.; Coddington, J.A.; Steier, J. Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity 2022, 14, 234. https://doi.org/10.3390/d14040234
Gostel MR, Carlsen MM, Devine A, Barker KB, Coddington JA, Steier J. Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity. 2022; 14(4):234. https://doi.org/10.3390/d14040234
Chicago/Turabian StyleGostel, Morgan R., Mónica M. Carlsen, Amanda Devine, Katharine B. Barker, Jonathan A. Coddington, and Julia Steier. 2022. "Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II" Diversity 14, no. 4: 234. https://doi.org/10.3390/d14040234
APA StyleGostel, M. R., Carlsen, M. M., Devine, A., Barker, K. B., Coddington, J. A., & Steier, J. (2022). Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity, 14(4), 234. https://doi.org/10.3390/d14040234

