Next Article in Journal
Spatial Shifts in Species Richness in Response to Climate and Environmental Change: An Adaption of the EUROMOVE Model in the Czech Republic
Next Article in Special Issue
Using DNA Metabarcoding to Identify Floral Visitation by Pollinators
Previous Article in Journal / Special Issue
The Efficiency of DNA Barcoding in the Identification of Afromontane Forest Tree Species
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II

by
Morgan R. Gostel
1,2,*,
Mónica M. Carlsen
3,
Amanda Devine
2,
Katharine B. Barker
2,
Jonathan A. Coddington
2 and
Julia Steier
2
1
Botanical Research Institute of Texas, Fort Worth, TX 76132, USA
2
National Museum of Natural History, Smithsonian Institution, P.O. Box 37012, Washington, DC 20013, USA
3
Missouri Botanical Garden, St. Louis, MO 63110, USA
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(4), 234; https://doi.org/10.3390/d14040234
Submission received: 11 February 2022 / Revised: 14 March 2022 / Accepted: 18 March 2022 / Published: 23 March 2022
(This article belongs to the Special Issue Plant DNA Barcodes, Community Ecology, and Species Interactions)

Abstract

The Global Genome Initiative for Gardens (GGI-Gardens) is an international partnership of botanic gardens and arboreta that aims to preserve and understand the genomic diversity of plants on Earth. GGI-Gardens has organized a collection program focused on the living collections that partner institutions and supports the preservation of herbarium and genomic vouchers. Collections made through GGI-Gardens are deposited in recognized herbaria and Global Genome Biodiversity Network-partnered biorepositories worldwide, meaning that they are made available to the public. With support from its parent organization, the Global Genome Initiative (GGI), plant DNA barcode sequencing is performed using tissues collected through this partnership that represent taxa without barcode sequences in GenBank. This is the second data release published by GGI-Gardens and constitutes 2722 barcode sequences from 174 families and 702 genera of land plants. All DNA barcodes generated in this study are now available through the Barcode of Life Data Systems (BOLD) and GenBank.

1. Introduction

Founded in 2015, the Global Genome Initiative for Gardens (GGI-Gardens, [1]) is an international partnership of botanic gardens and arboreta that aims to preserve and understand Earth’s genomic diversity of plants. GGI-Gardens supports the collection of both herbarium and genomic voucher material from the living collections in these partner gardens following best practices for herbarium and genomics research [2]. Collections made through this program are stored in Global Genome Biodiversity Network (GGBN)-partnered DNA banks [3], meaning that they can be utilized for applications ranging from whole genome sequencing [4] to DNA barcoding [5], as well as other genomic research.
Since their conception in 2003 [6], DNA barcode sequences have been used as powerful tools that enable the large-scale and rapid taxonomic identification of species for myriad purposes, including conservation [7], forensics [8], and the quantification of species diversity [9], among others. Emerging techniques, such as metabarcoding [10,11], leverage high-throughput sequencing technology and are capable of sequencing a mixed or pooled sample of species and identify them from their barcode sequence.
An important limiting factor for these and other studies that utilize DNA barcode sequences, however, is the representation of species diversity in reference databases [12]. DNA barcode reference databases are growing in both their taxonomic and geographic scope thanks to a number of large initiatives, which often focus on a particular branch of the tree of life or geographic area. For example, since 2005, the African Centre for DNA Barcoding has been contributing DNA barcode reference sequences from Africa to facilitate improved DNA barcoding applications from this continent [13]. The basic concept of DNA barcoding has also expanded during recent years, thanks to high-throughput sequencing (HTS) technology and methods to “extend” the traditional barcode concept include the use of so-called “genome-skim” data [14] or whole organelle genome sequences as “super-” [15] or “ultra-barcodes” [16]. Clade-based approaches are contributing large-scale DNA barcode reference sequences for entire groups of organisms that are often regionally focused [17] or even hyper locally focused (e.g., sequencing living collections from botanic gardens, [18]), and in this paper we provide a large contribution from collections made by the GGI-Gardens program.
Facilitated by the Global Genome Initiative based at Smithsonian Institution (https://naturalhistory.si.edu/research/global-genome-initiative, accessed on 30 January 2022), new families and genera collected by GGI-Gardens partners to date have been extracted and sequenced using four plant DNA barcode loci (rbcL, matK, ITS2, and psbA-trnH). Past collections made through the GGI-Gardens program have been published as part of large DNA barcode “data releases”, the first of which included the publication of nearly 2000 barcode sequences [5]. This manuscript represents the second data release for samples collected through the GGI-Gardens program and will serve as a significant contribution to available plant DNA barcode sequences in public repositories. These barcode sequences will facilitate future plant biodiversity research by improving the ability of researchers to use DNA barcode sequences to accurately identify species from DNA barcode reference databases through general plant inventories, ecological studies, and metabarcoding studies.

2. Methods and Materials

2.1. Tissue Collection

DNA barcode sequences published as part of this data release comprise collections conducted from two GGI-Gardens partners—the Botanical Research Institute of Texas (BRIT) and the Missouri Botanical Garden (MOBOT) between 2017 and 2020. A total of 817 collections (from 788 species) are represented in this data release, and these include 174 families and 702 genera (Supplementary Table S1). All collections were conducted following published best practices [2] and include herbarium vouchers, as well as genomic vouchers that include tissue preserved in silica gel and flash frozen in liquid nitrogen. Collections were prioritized using the GGI Gap Analysis Tool (https://globalgeno.me, accessed on 30 January 2022) following the scheme proposed in Linsky and Gostel [19] and whether DNA barcode quality sequences were available in GenBank. Silica-dried leaf tissues were sampled to generate DNA barcode sequences published in this study.

2.2. DNA Extraction

Silica-preserved leaf tissues (~10 µg of each sample) were sampled with 25 µL ETOH (to mitigate static) into a 96-well plate preloaded with glass and ceramic beads and then disrupted using a FastPrep 96 instrument (MP Biomedicals, Santa Ana, CA, USA). Whole genomic DNA was isolated using an AutoGenprep 965 (Autogen, Holliston, MA, USA) automatic extractor following the manufacturer’s protocol for plant tissue.

2.3. PCR Amplification and Sequencing

Four standard plant DNA barcode loci (Table 1) were amplified, including the two core barcoding regions for land plants, rbcL and matK [20] and two additional loci that have been proposed as additional plant DNA barcoding loci, ITS2 and psbA-trnH [21,22,23]. PCR was performed using Bioline Taq polymerase (New England Biolabs, Ipswich, MA, USA) and a standard thermal cycling profile including an initial denaturation for 5 min at 95 °C, 35 cycles each including 95 °C denaturation for 30 s, a locus-specific annealing temperature (see Table 1) for 30 s, and an extension cycle at 72 °C for 40 s, followed by a final extension of 72 °C for 10 min. Amplified PCR products were cleaned using ExoSAP-IT (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s protocols. Cycle sequencing was performed in 96-well plates using the same PCR primers, the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems®, Norwalk, CT, USA), and sequenced on the Automated ABI3730 Sequencer (Life Technologies, Carlsbad, CA, USA). Raw chromatograms were edited in Geneious Prime (2021, https://www.geneious.com, accessed on 15 January 2022) and annotated before uploading to BOLD (https://www.boldsystems.org, accessed on 30 January 2022) and GenBank (See Supplementary Table S1 for accession numbers).

3. Results and Data Resources

Sequence Characteristics and Upload to BOLD and GenBank

A total of 2722 DNA barcode sequences were generated and uploaded to the BOLD and GenBank reference databases (both publicly available, Supplementary Table S1). Most DNA barcode sequences represented the rbcL locus (789), and the fewest sequences were generated for the matK locus (597 sequences). Overall, 650 and 686 sequences were generated for ITS2 and psbA-trnH, respectively. Among the DNA barcode sequences presented in this data release are 12 families, 292 genera, and 604 species that previously did not have barcode sequence data available in GenBank. All sequences uploaded to BOLD are contained within the BOLD projects GRDTX and GRDMO. All sequences uploaded to GenBank are part of the GGI-Gardens Bio-Projects (ID: PRJNA791936 & PRJNA485943).
These sequences represent important resources for biodiversity studies and will facilitate rapid species identification and ecological studies that seek to understand plant community composition [9] and species interactions [32], as well as conservation assessments that depend upon DNA barcoding to identify and control invasive species, e.g., [33] and enforce policies regarding the trade in endangered plants, e.g., [34,35]. Expanding the plant DNA barcode sequence reference library can also help botanic gardens to accurately identify species in their living collections, i.e., [36]. We hope this work encourages others who work with plant DNA barcodes to contribute to growing DNA barcode reference databases to improve these public resources.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d14040234/s1. Table S1. List of samples collected for the Global Genome Initiative for Gardens projects selected for DNA barcoding in this study, with GenBank accession numbers and genomic voucher identification numbers. All the sequences are included in the GGI-Gardens BioProjects PRJNA791936 and PRJNA485943 in GenBank and BOLD projects GRDTX and GRDMO. Each Collector Number includes a link to the digital genomic voucher record stored in the Smithsonian Biorepository.

Author Contributions

Conceptualization, M.R.G. and J.S.; methodology, M.R.G., M.M.C. & J.S.; software, A.D.; formal analysis, J.S.; resources, K.B.B. and J.A.C.; data curation, J.S.; writing—original draft preparation, M.R.G.; writing—review and editing, J.S., M.M.C., M.R.G., A.D., K.B.B., J.A.C.; project administration, M.R.G., K.B.B., J.A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Global Genome Initiative under grants GGI-Gardens-2019-206, GGI-Gardens-2020-246, and GGI-Partnerships-2017-167.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in Supplementary Table S1.

Acknowledgments

All laboratory work was conducted in the Laboratories for Analytical Biology (LAB) at the National Museum of Natural History in Washington, DC and at the Museum Support Center in Suitland, MD. Genomic vouchers are deposited in the Smithsonian Institution Biorepository as well as the DNA banks at the Botanical Research Institute of Texas (BRIT) and the Missouri Botanical Garden (MO). Herbarium vouchers for samples associated with Genbank Projects PRJNA791936 and PRJNA485943 have been deposited in the BRIT and MO herbaria, respectively. M.R.G. thanks Faranhoz Khojayori, Seth Hamby, and Jerrod Stone for their assistance with the collection of samples used in this work from BRIT. M.M.C. thanks Danielle Hopkins, Stephanie Keil, Ella Ludwig, and Gabrielle McAuley for their assistance with collections made at the Missouri Botanical Garden. The sequences published as part of thisfFigur work were supported by the Global Genome Initiative, with assistance from Jose Zúñiga. Any paper(s) resulting directly from this specimen-processing project should reference support from the Global Genome Initiative and the Laboratories of Analytical Biology, National Museum of Natural History, Smithsonian Institution.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gostel, M.R.; Kelloff, C.L.; Wallick, K.; Funk, V.A. A workflow to preserve genome-quality tissue samples from plants in botanical gardens and arboreta. Appl. Plant. Sci. 2016, 4, 1600039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Funk, V.A.; Gostel, M.R.; Devine, A.; Kelloff, C.L.; Wurdack, K.; Tuccinardi, C.; Radosavljevic, A.; Peters, M.; Coddington, J.A. Guidelines for collecting vouchers and tissues intended for genomic work (Smithsonian Institution): Botany Best Practices. Biodivers. Data J. 2017, 5, e11625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Seberg, O.; Droege, G.; Barker, K.B.; Coddington, J.A.; Funk, V.A.; Gostel, M.R.; Peterson, G.; Smith, P.P. Global Genome Biodiversity Network: Saving a blueprint of the Tree of Life—A botanical perspective. Ann. Bot. 2016, 118, 393–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kress, W.J.; Soltis, D.E.; Kersey, P.J.; Wegrzyn, J.L.; Leebens-Mack, J.H.; Gostel, M.R.; Liu, X.; Soltis, P.S. Green plant genomes: What we know in an era of rapidly expanding opportunities. Proc. Natl. Acad. Sci. USA 2022, 119, e2115640118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Zúñiga, J.D.; Gostel, M.R.; Mulcahy, D.G.; Barker, K.B.; Hill, A.; Sedaghatpour, M.; Vo, S.Q.; Funk, V.A.; Coddington, J.A. Data release: DNA barcodes of plant species collected for the Global Genome Initiative for Gardens program, National Museum of Natural History, Smithsonian Institution. PhytoKeys 2017, 88, 119–122. [Google Scholar] [CrossRef] [Scilit]
  6. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Costion, C.M.; Kress, W.J.; Crayn, D.M. DNA barcodes confirm the taxonomic and conservation status of a species of tree on the brink of extinction in the Pacific. PLoS ONE 2016, 11, e0155118. [Google Scholar] [CrossRef] [Scilit]
  8. Staats, M.; Arulandhu, A.J.; Gravendeel, B.; Holst-Jensen, A.; Scholtens, I.; Peelen, T.; Prins, T.W.; Kok, E. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 2016, 408, 4615–4630. [Google Scholar] [CrossRef] [Scilit]
  9. Costion, C.; Ford, A.; Cross, H.; Crayn, D.; Harrington, M.; Lowe, A. Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS ONE 2011, 6, e26841. [Google Scholar] [CrossRef] [Scilit]
  10. Taberlet, P.; Coissac, E.; Pompanon, F.; Brochmann, C.; Willerslev, E. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol. 2012, 21, 2045–2050. [Google Scholar] [CrossRef] [Scilit]
  11. Gostel, M.R.; Zúñiga, J.D.; Kress, W.J.; Funk, V.A.; Puente-Lelievre, C. Microfluidic enrichment barcoding (MEBarcoding): A new method for high throughput plant DNA barcoding. Sci. Rep. 2020, 10, 8701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Cowart, D.A.; Pinheiro, M.; Mouchel, O.; Maguer, M.; Grall, J.; Miné, J.; Arnaud-Haond, S. Metabarcoding is powerful yet still blind: A comparative analysis of morphological and molecular surveys of seagrass communities. PLoS ONE 2015, 10, e0117562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Bezeng, B.S.; Davies, T.J.; Daru, B.H.; Kabongo, R.M.; Maurin, O.; Yessoufou, K.; van der Bank, H.; van der Bank, M. Ten years of barcoding at the African Centre for DNA Barcoding. Genome 2017, 60, 629–638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Coissac, E.; Hollingworth, P.M.; Lavergne, S.; Taberlet, P. From barcodes to genomes: Extending the concept of DNA barcod-ing. Mol. Ecol. 2016, 25, 1423–1428. [Google Scholar] [CrossRef] [Scilit]
  15. Kane, N.C.; Cronk, Q. Botany without borders: Barcoding in focus. Mol. Ecol. 2008, 17, 5175–5176. [Google Scholar] [CrossRef] [Scilit]
  16. Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. 2015, 90, 157–166. [Google Scholar] [CrossRef] [Scilit]
  17. Chua, P.Y.S.; Leerhøi, F.; Langkjaer, E.M.R.; Margaryan, A.; Noer, C.L.; Richter, S.R.; Restrup, M.E.; Bruun, H.H.; Hartvig, I.; Coissac, E.; et al. Towards the extended barcode concept: Generating DNA reference data through genome skimming of danish plants. bioRxiv 2021. [Google Scholar] [CrossRef] [Scilit]
  18. Liu, H.; Wei, J.; Yang, T.; Mu, W.; Song, B.; Yang, T.; Fu, Y.; Wang, X.; Hu, G.; Li, W.; et al. Molecular digitization of a botanical garden: High-depth whole-genome sequencing of 689 vascular plant species from the Ruili Botanical Garden. GigaScience 2019, 8, giz007. [Google Scholar] [CrossRef] [Scilit]
  19. Linsky, J.; Gostel, M.R. The Global Genome Iniatitive for Gardens: Conservation priorities at the interface of botanic gardens and biodiversity genomics. BGJournal 2021, 18, 21–23. [Google Scholar]
  20. CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [Scilit]
  21. Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369–8374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Kress, W.J.; Erickson, D.L. (Eds.) DNA Barcodes: Methods and Protocols; Humana Press: Totowa, NJ, USA; Springer Science+Publishing Media, LLC.: New York, NY, USA, 2012; Volume 858, pp. 3–8. [Google Scholar]
  23. Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Levin, R.A.; Wagner, W.L.; Hoch, P.C.; Nepokroeff, M.; Pires, J.C.; Zimmer, E.A.; Sytsma, K.J. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. Am. J. Bot. 2003, 90, 107–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Kress, W.J.; Erickson, D.L.; Jones, F.A.; Swenson, N.G.; Perez, R.; Sanjur, O.; Bermingham, E. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. USA 2009, 106, 18621–18626. [Google Scholar] [CrossRef] [Scilit]
  26. Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; Van Alphen Stahl, J.; Kelly, L.J.; Wikström, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 2009, 159, 1–11. [Google Scholar] [CrossRef] [Scilit]
  27. Dunning, L.T.; Savolainen, V. Broad-scale amplification of matK for DNA barcoding plants, a technical note. Bot. J. Linn. Soc. 2010, 164, 1–9. [Google Scholar] [CrossRef] [Scilit]
  28. Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [Scilit]
  29. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. PCR Protocols: A Guide to Methods and Applications; Innis, M., Gelfand, D., Sninsky, J., White, T., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  30. Sang, T.; Crawford, D.; Stuessy, T. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef] [Scilit]
  31. Tate, J.; Simpson, B. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003, 28, 723. [Google Scholar]
  32. Lowe, A.; Jones, L.; Witter, L.; Creer, S.; de Vere, N. Using DNA Metabarcoding to Identify Floral Visitation by Pollinators. Diversity 2022, 14, 2022020018. [Google Scholar] [CrossRef] [Scilit]
  33. Wang, A.; Wu, H.; Zhu, X.; Lin, J. Species Identification of Conyza Bonariensis Assisted by Chloroplast Genome Sequencing. Front. Genet. 2018, 9, 374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Nithaniyal, S.; Newmaster, S.G.; Ragupathy, S.; Krishnamoorthy, D.; Vassou, S.L.; Parani, M. DNA Barcode Authentication of Wood Samples of Threatened and Commercial Timber Trees within the Tropical Dry Evergreen Forest of India. PLoS ONE 2014, 9, e107669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Hassold, S.; Lowry, P.P.; Bauert, M.R.; Razafintsalama, A.; Ramamonjisoa, L.; Widmer, A. DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species. PLoS ONE 2016, 11, e0157881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Le, D.-T.; Zhang, Y.-Q.; Xu, Y.; Guo, L.-X.; Ruan, Z.-P.; Burgess, K.S.; Ge, X.-J. The utility of DNA barcodes to confirm the identification of palm collections in botanical gardens. PLoS ONE 2020, 15, e0235569. [Google Scholar] [CrossRef] [Scilit]
Table 1. Locus information for each plant DNA barcoding marker used in this study, including forward and reverse primer names, primer sequences, annealing temperature, and citation.
Table 1. Locus information for each plant DNA barcoding marker used in this study, including forward and reverse primer names, primer sequences, annealing temperature, and citation.
LocusPrimer NameForward Primer SequenceAnnealing TemperatureCitation
rbcLrbcLa-FATGTCACCACAAACAGAGACTAAAGC55 °C[24]
rbcLa-RGTAAAATCAAGTCCACCRCG[25]
matKmatK-xfTAATTTACGATCAATTCATTC54 °C[26]
matK-MALPACAAGAAAGTCGAAGTAT[27]
ITS2ITS_S2FATGCGATACTTGGTGTGAAT56 °C[28]
ITS4TCCTCCGCTTATTGATATGC[29]
psbA-trnHpsbA3_fGTTATGCATGAACGTAATGCTC64 °C[30]
trnHf_05CGCGCATGGTGGATTCACAATCC[31]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gostel, M.R.; Carlsen, M.M.; Devine, A.; Barker, K.B.; Coddington, J.A.; Steier, J. Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity 2022, 14, 234. https://doi.org/10.3390/d14040234

AMA Style

Gostel MR, Carlsen MM, Devine A, Barker KB, Coddington JA, Steier J. Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity. 2022; 14(4):234. https://doi.org/10.3390/d14040234

Chicago/Turabian Style

Gostel, Morgan R., Mónica M. Carlsen, Amanda Devine, Katharine B. Barker, Jonathan A. Coddington, and Julia Steier. 2022. "Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II" Diversity 14, no. 4: 234. https://doi.org/10.3390/d14040234

APA Style

Gostel, M. R., Carlsen, M. M., Devine, A., Barker, K. B., Coddington, J. A., & Steier, J. (2022). Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative for Gardens (GGI-Gardens) II. Diversity, 14(4), 234. https://doi.org/10.3390/d14040234

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop