Next Article in Journal
Responses of Benthic Macroinvertebrate Communities of Two Tropical, High-Mountain Lakes to Climate Change and Deacidification
Next Article in Special Issue
Phenetic and Genetic Variability of Continental and Island Populations of the Freshwater Copepod Mastigodiaptomus ha Cervantes, 2020 (Copepoda): A Case of Dispersal?
Previous Article in Journal
Mesofauna at the Soil-Scree Interface in a Deep Karst Environment
Previous Article in Special Issue
Integrative Taxonomy Reveals That the Marine Brachyuran Crab Pyromaia tuberculata (Lockington, 1877) Reached Eastern Atlantic
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Record of Caromiobenella (Copepoda, Monstrilloida) in Brazil and Discovery of the Male of C. brasiliensis: Morphological and Molecular Evidence

by
Judson da Cruz Lopes da Rosa
1,*,
Cristina de Oliveira Dias
2,
Eduardo Suárez-Morales
3,*,
Laura Isabel Weber
4 and
Luciano Gomes Fischer
1,4
1
Programa de Pós-Graduação em Ciências Ambientais e Conservação (PPG-CiAC), Universidade Federal do Rio de Janeiro (UFRJ), Macaé, Rio de Janeiro, RJ 27965-045, Brazil
2
Laboratório Integrado de Zooplâncton e Ictioplâncton or Programa de Engenharia Ambiental-PEA, Departa-mento de Zoologia, Instituto de Biologia, Escola Politécnica, Universidade Federal do Rio de Janeiro (UFRJ), Cidade Universitária, Rio de Janeiro, RJ 21941-590, Brazil
3
El Colegio de la Frontera Sur (ECOSUR), Av. Centenario Km. 5.5, Chetumal, Quintana Roo 77014, Mexico
4
Instituto de Biodiversidade e Sustentabilidade (NUPEM), Universidade Federal do Rio de Janeiro (UFRJ), Macaé, Rio de Janeiro, RJ 27965-045, Brazil
*
Authors to whom correspondence should be addressed.
Diversity 2021, 13(6), 241; https://doi.org/10.3390/d13060241
Submission received: 22 April 2021 / Revised: 14 May 2021 / Accepted: 20 May 2021 / Published: 31 May 2021
(This article belongs to the Special Issue Aquatic Organisms Research with DNA Barcodes)

Abstract

Monstrilloid copepods are protelean parasites with a complex life cycle that includes an endoparasitic juvenile phase and free-living early naupliar and adult phases. The monstrilloid copepod genus Caromiobenella Jeon, Lee and Soh, 2018 is known to contain nine species, each one with a limited distribution; except for two species, members of this widespread genus are known exclusively from males. Hitherto, members of Caromiobenella have not been recorded from tropical waters of the South Western Atlantic (SWA). The nominal species Monstrilla brasiliensis Dias and Suárez-Morales, 2000 was originally described from female specimens collected in coastal waters of Espírito Santo and Rio de Janeiro (Brazil), but the male remained unknown. The failure to reliably link both sexes of monstrilloid species is one of the main problems in the current taxonomy of the group, thus leading to a separate treatment for each sex. New zooplankton collections in coastal waters and intertidal rocky pools of the SWA yielded several male and female monstrilloid copepods tentatively identified as Monstrilla brasiliensis. Our results of both morphologic and molecular (mtCOI) analyses allowed us to confirm that these males and females were conspecific. We also found evidence suggesting that Caromiobenella is not a monophyletic taxon. Our male specimens are morphologically assignable to Caromiobenella, therefore, females of the nominal species Monstrilla brasiliensis, are matched here with the aforementioned males and, thus, the species should be known as C. brasiliensis comb. nov. (Dias and Suárez-Morales, 2000). This finding represents the third documented discovery of a female of Caromiobenella, the first record of the genus in the Southwestern Atlantic, and the first documented record of monstrilloids from coastal tidepools. With the addition of C. brasiliensis, Caromiobenella now includes 10 valid species worldwide. This work represents the second successful use of molecular methods to link both sexes of a monstrilloid copepod. The male of C. brasiliensis is herein described, and a key to the known species of Caromiobenella and data on the habitat and local abundance of C. brasiliensis are also provided.

1. Introduction

Monstrilloid copepods are protelean parasites of benthic invertebrates, including polychaetes, molluscs, and sponges [1,2,3]; most juvenile stages are endoparasitic and free-living adult individuals lacking mouthparts are non-feeding reproductive forms that briefly become part of the zooplankton community [1]. As endoparasites they can cause strong inflammatory processes to their hosts [4]. Because of their rarity in the plankton and taxonomic and nomenclatural complexity [5,6], there are large geographic areas in which the monstrilloid copepod fauna remain largely unknown [2,7]. According to a previous analysis of their known diversity and distribution [2], the regions with the highest number of monstrilloid records are the Northeastern Atlantic (32 species), the northwestern Tropical Atlantic (including the Caribbean Sea and the Gulf of Mexico) (24), and the Indonesia-Malaysia-Philippines, and Japan Seas region (23+). The Brazilian-Argentinean coasts are known to harbor a relatively low monstrilloid diversity (16 species).
The Brazilian monstrilloid copepods have been studied for more than 20 years [4,8,9,10,11,12]. Several new species of Monstrilloida have been described from Brazilian coastal waters, some of them from females only (i.e., Monstrilla pustulata Suarez-Morales and Dias, 2001, M. satchmoi Suárez-Morales and Dias, 2001, M. careli Suarez-Morales and Dias, 2000, M. brasiliensis Dias and Suárez-Morales, 2000, and M. bahiana Suarez-Morales and Dias, 2001), others from males (i.e., Monstrillopsis fosshageni Suárez-Morales and Dias, 2001, Cymbasoma rochai Suárez-Morales and Dias, 2001). These taxonomic works [8,9,10] also include a new geographic record of M. brevicornis Isaac, 1974 in the Atlantic Ocean [9,10], ecological aspects of a species of Cymbasoma [11], and the discovery and description of the female of C. rochai [12]. The male specimens collected in the surveyed area were tentatively identified as Monstrilla and presumed to belong to one of the Brazilian species previously known only from females. A more detailed analysis allowed us to recognize our males as members of Caromiobenella. Both morphologic and molecular analyses were performed on our male and female specimens to reveal if they are conspecific.
Matching both sexes of monstrilloid species has been raised as one of the main obstacles to determine the true diversity of the group [2,13]. Individuals of both sexes are mixed with those of other species in the plankton samples. Reliable methods to link the sexes of a species include: (1) particular autapomorphies shared by males and females of a species, (2) finding them emerging from the same host and mating, and (3) the use of molecular tools.
The goals of this survey were to: (1) to reveal the taxonomic identity of the male specimens collected from the Rio de Janeiro area, and reliably link them to the female through morphological and molecular analyses; (2) present data about their habitat and local abundance; (3) provide an updated identification key to the known species of Caromiobenella.

2. Materials and Methods

2.1. Sampling

Zooplankton samples were collected monthly between August 2017 and December 2018 in marine coastal waters and rocky tidepools at five localities in the State of Rio de Janeiro, Southeastern Brazilian coast (Figure 1). Some of these samples contained male and female monstrilloid copepods that were taxonomically examined. Monstrilloids were firstly found in three rocky tidepools of the municipality of Rio das Ostras (Areias Negras beach: 22°31′47.60″ S, 41°55′32.22″ W, Remanso beach: 22°31′40.57″ S, 41°55′21″ W) and Armação de Búzios (Rasa beach: 22°43′59.6″ S, 41°57′26.2″ W), and subsequently in a shallow costal area in the municipality of Rio das Ostras (Cemitério beach: 22°31′52.21″ S, 41°56′32.18″ W) (Figure 1, Table 1).
The water in the rocky tidepools was drained with an electric bilge pump (12 V) and the zooplankton was retained in a 100 µm mesh filter attached to the end of the water pipe. The drained water volume was recorded to calculate the zooplankton densities (individuals/m3). The water temperature and salinity were recorded with a thermosalinometer (YSI Yellow Spring Pro 2030). The samples used in taxonomic examination and descriptions were fixed in 4% formaldehyde, analyzed in a stereomicroscope, and quantified in a Dollfus chamber.
To complete the genetic analysis, five additional collections were carried out between September and December 2018 (Table 1) in Cemiterio beach, coastal region beyond the surf zone, in an area without rocky shores. These collections were made with a 100 µm mesh plankton net towed by a kayak without using a flowmeter, thus without density estimates. These samples were preserved in 92.8° GL ethanol and monstrilloids were sorted and taxonomically examined in the laboratory.

2.2. Morphologic Analysis

A few male specimens, including those presented here, were tentatively assigned to the genus Monstrilla Dana, 1849. A reexamination of these male individuals allowed us to recognize them as a species of Caromiobenella, largely known from males and with distinctive morphological characters [3]. One of these specimens (MNRJ30136) was selected to be described. Our description of this male followed the current upgraded descriptive standards in monstrilloid taxonomy [1,13,14] and included the distinctive characters of Caromiobenella [3,15]. The morphologic terminology follows Huys and Boxshall (1991) [16]. The Brazilian male specimens were deposited in the collections of the Museu Nacional-Federal University of Rio de Janeiro (MNRJ) and Invertebrate Collection of the Instituto de Biodiversidade e Sustentabilidade (NUPEM/UFRJ) (CIN-NPM), where they are available for inspection.

2.3. Molecular Analysis

Total DNA was extracted from four females and two male copepods by the Chelex resin protocol [17,18] as follows. Ethanol-preserved copepods were picked up with plastic pipettes under a stereomicroscope and then transferred to 0.6 mL Eppendorf vials. The excess of ethanol was then removed and left to dry at room temperature for at least 1 h. Afterwards, 10 µL proteinase-k (10 mg/µL) was added directly over the copepod body, followed by 75 µL lysis buffer 2x (0.1 mM Tris, 0.01 mM EDTA, pH 8.0), 75 µL 12% chelating resin (Chelex 100), SIGMA, shaken in vortex, and incubated overnight at 55 °C.
The anterior region of the mitochondrial cytochrome c-oxidase, subunit I (COI) was amplified by the polymerase chain reaction (PCR) from 5 and 10 µL of extracted DNA, using Folmer et al. (1994) [19] primers, HCO2198 (TAAACTTCAGGGT GACCAAAAAATCA) and LCO1490 (GGTCAACAAATCATAAAGATATTGG) in a 25 µL final reaction volume containing 1x reaction buffer, 3 mM MgCl2, 0.24 µM of each dNTP, 0.12% Triton-X-100, 0.4 µM of each primer, 2 U of DNA polymerase. PCR was performed in a thermocycler (Gradient Mastercycler, Eppendorf) as follows: 1 cycle at 94 °C for 4 min; 35 cycles at 94 °C, 48 °C and 72 °C for 1 min each; and a final cycle at 72 °C for 7 min. DNA fragments were visualized after electrophoresis over ultraviolet (UV) light using the fluorescent stain UniSafe dye (Uniscience) and PUC19 ladder for fragment size determination. Amplicons were sequenced by the automation system of capillary electrophoresis sequencing (ABI 3730xl System; Sanger method). Sequences were edited using the Chromas Pro, v. 2.1.8 software and then aligned with Clustal W online tool. Edited and revised sequences were analyzed by the Basic Local Alignment Search Tool (BLAST) to find similar sequences deposited in GenBank and verify their proximity to the expected taxonomic group. Multiple alignment and gap insertions were performed retaining conserved coding regions at the same positions.
Pair-wise p-distances and Tamura-Nei distances were obtained for the Brazilian group. For comparisons with species from different genera, Tamura-Nei and Kimura-2 parameters distances were used. Maximum likelihood (ML) trees were obtained using Tamura-Nei distance and using 1000 bootstrap iterations for the branch confidence. A parsimony tree was also obtained. Phylogenetic and molecular evolutionary were conducted using MEGA version 6 [20,21]. Sequences of copepod species of other genera obtained from GenBank were used for comparisons and to verify the position of sequences of local copepods. Some of the sequences of other monstrilloid genera available in GenBank were shorter than those found in the present study for the Brazilian copepods. Therefore, to include a greater number of species in the comparison, it was necessary to work with a smaller region, but present in all of them. These comparisons were only possible at over 582 bp DNA fragment of the Brazilian copepods. It was not possible to include Caromiobenella ohtsukai (MH638358) and Monstrillopsis longilobata (MF447160; MF447163) because they were shorter at the 5′ end.

3. Results

3.1. Taxonomy

  • Subclass Copepoda Milne-Edwards, 1840
  • Order Monstrilloida Thorell, 1859
  • Family Monstrillidae Dana, 1849
  • Genus Caromiobenella Jeon, Lee and Soh, 2018
  • Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov.

3.1.1. Material Examined

Eight adult males: 08/08/2017 (1♂ NPM-00020, 2♂ lost in shipping), 10/16/2017 (1♂ NPM-00022, 1♂ MNRJ30136, and 1♂ dissected), 02/03/2018 (1♂ dissected), and 09/19/2018 (1♂ MNRJ28990). Specimens NPM-00020, NPM-00022, and MNRJ28990 fixed in 4% formaldehyde and 1 ♂ undissected, mounted on semi-permanent slide with glycerin, sealed with acrylic varnish.

3.1.2. Type Locality

Camburi, Baía do Espírito Santo (20°16.383′ S, 40°15.900′ W) [8]

3.1.3. Diagnosis (Female and Male)

Female Monstrilla with medium-sized, robust body, cephalothorax with dorsal and ventral scattered fields of striae. Urosome 4-segmented, ovigerous spines short: fifth legs elongate, bilobed, divergent; outer lobe long, slender, with three setae, inner lobe short, cylindrical, with single seta. Antennule 4-segmented, first segment partially fused to cephalothorax, segments 3–4 fused; combined third segment with outer surface produced, forming proximal rounded process furnished with field of coarse cuticular ridges. Caudal rami with 6 setae. Male: Monstrilla-like, medium-sized, body segmentation as in Caromiobenella (body length ~0.98 mm), cephalothorax representing ~49% of total body length. Pedigerous somites 2–4 representing 39% of total body length. Oral papilla at 34% of way back along ventral surface of cephalothorax. Cephalothorax with dorsal and ventral scattered pores and fields of cuticular striae. Antennules 5-segmented, representing ~35.6% of total body length, geniculated between segments 4–5; first segment partially fused to cephalothorax; second segment with outer margin produced into rounded process ornamented with field of deep transverse wrinkles. Distal antennulary segment with usual armature of genus. Fifth pedigerous somite with reduced fifth legs represented by pair of knob-like processes. Preanal somite with medial pair of small keel-like acute processes on postero-ventral surface. Genital complex of type I, represented by short robust shaft with short, thick distal lappets, branches separated by deep longitudinal slit. Caudal rami armed with 6 setae including short, slender biserially plumose innermost seta.

3.1.4. Description of Adult Male

Body shape and tagmosis as in Caromiobenella (see Jeon et al., 2018) (Figure 2A–C). Body robust, total body length of examined individual = 0.98 mm, measured from anterior end of cephalothorax to posterior margin of anal somite. Additional measurements in Table 2 Body short, robust, cephalothorax incorporating first pedigerous somite representing ~49% of total body length. Succeeding pedigerous somites 2–4 each bearing pair of biramous swimming legs; pedigerous somites 2–4 combined accounting for 39% of total body length in dorsal view. Dorsal surface of pedigerous somites 2 and 3 each with pair of “crater-like” cuticular processes; those on third somite being smaller (Figure 2A,C). Cephalic region of cephalothorax wide, smooth, bilaterally protuberant in dorsal view, slightly narrower than cephalothorax; outer margin of cephalic protuberances weakly corrugate. Pair of small dorsal pit setae between antennulary bases. Forehead moderately produced, weakly rounded, with transverse striation fields on dorsal anterior and lateral surfaces; no other cephalic ornamentation was observed on dorsal anterior surface (Figure 2A). Cephalothorax robust, 0.36 mm long, representing almost 37% of total body length; dorsal surface with scattered dorsal pores (Figure 2A). Anterior ventral surface with rounded preoral projection (Figure 3C) between antennule bases and oral papilla, visible in lateral view. Oral papilla at 34% of way back along ventral surface of cephalothorax, with adjacent field of transverse cuticular striae (Figure 3C). Cephalothorax with eyes consisting of relatively small, unpigmented paired lateral cups separated medially by length of less than one eye diameter plus medial cup slightly larger than lateral cups. One pair of relatively small nipple-like cuticular processes present on anterior ventral surface between antennule bases and oral papilla (arrowed in Figure 2B); nipple-like cuticular processes surrounded by field of wrinkles (Figure 2A).
Antennule length = 0.35 mm, representing ~35.6% of total body length. Antennule relatively short, 5-segmented, type III [16] representing 36% of total body length, and 73% of cephalothorax length; antennules indistinctly 5-segmented, segments 1–4 separated by incomplete sutures. First antennulary segment subrectangular, partially fused to cephalothorax proximally and to second segment distally. Second segment with bulging lateral process on outer proximal half; process furnished with deep transverse cuticular wrinkles (arrow in Figure 3A). Fourth segment being longest, representing 37% of total antennulary length. Geniculation between segments 4 and 5 (Figure 3A). In terms of the pattern described by Grygier and Ohtsuka (1995) [14] for antennular armature of segments 1–4 and complemented with Huys et al.’s (2007) [1] nomenclature for elements on the male fifth antennule segment, element 1 present on first segment; element spiniform, lightly pinnate, relatively short, barely reaching midlength of succeeding second segment. Second segment armed with long, lightly plumose elements 2d1,2, 2v1–3, and slender seta IId. Third segment partially fused with second, subquadrate, armed with setiform elements 3, IIId, and IIIv. Setal element 3 lightly pinnate, reaching proximal 1/3 of succeeding fourth segment. Fourth segment subrectangular, elongate, about 3.5 times as long as wide, bearing normally developed elements 4d1,2 and 4v1,2 as well as long setae IVd and IVv; long, slender aesthetasc 4aes on mid-ventral position. Elements of group 4v short, setiform, lightly pinnate; element 4v3 not discernible in the specimen examined. Distal segment with conspicuous proximal geniculation, armed with 11 setal elements (sensu Huys et al., 2007) including elements 1–5 and A–E plus apical aesthetasc 5aes.
Intercoxal sclerites of legs 1–4 subrectangular, smooth. As in other members of Caromiobenella [3,15], basis with inner margins produced, forming rounded expansions (arrows in Figure 4A–D); outer margin of basipods of legs 1–4 with lightly setulose basipodal seta; on leg 3, basipodal seta about twice as long as and slightly thicker than in other legs (Figure 4C). Endopodites and exopodites of legs 1–4 triarticulated, outer margins of exopodites smooth. Third exopodal segment of legs 1–4 with 6 setal elements (Figure 3E) except for leg 1 with only 5 elements (Figure 3D). Ramus setae all biserially plumose except for robust apical spiniform seta on exopodal segment 3 (Figure 3D,E); spiniform apical seta on legs 1–4 long, with inner margin spinulose and outer margin lightly setulose (Figure 3D,E). Intercoxal plates of legs 1–4 rectangular, smooth. Armature of legs 1–4 as in Table 3.
Urosome relatively short, representing about 19% of total body length, consisting of fifth pedigerous somite, genital somite (carrying genital complex), and two short free postgenital somites (Figure 5A–C). Anal somite short, with straight outer margins. Fifth pedigerous somite ventrally produced, carrying reduced fifth legs represented by pair of knob-like processes (Figure 5B,C) and proximal half (Figure 5C). Genital somite slightly shorter than preceding fifth pedigerous somite; genital complex of type I [15,20], represented by short, robust, ventrally expanded shaft; genital complex with short, medially conjoined lappets, both tapering distally into apical subtriangular opercular process (Figure 5C–E). Lappets with rugose anterior surface and coarsely striated distal half, branches parallel, separated medially by deep smooth slit (Figure 5E). Preanal somite slightly longer than anal somite, furnished with pair of small keel-like processes on postero-ventral surface, visible in lateral view (arrow in Figure 5C). Caudal rami subrectangular, approximately 1.3 times as long as wide, about 1.3 times as long as anal somite. Each ramus armed with five subequally long caudal setae (setae I–V) [16] plus short, slender, lightly setose caudal seta VI (Figure 5A,B).

3.1.5. Additional Male Specimens Measured

Five specimens: 3♂ collected in 08/08/2017 (NPM-00020), 1♂ 10/16/2017 (NPM-00022), 1♂ 02/03/2018 (dissected). Body length ranged from 0.878 to 1.170 mm. Cephalothorax length ranged from 0.339 to 0.475 mm representing between 38.6% to 44.2% of the total body length (see Table 2). Antennule length between 0.330 to 0.373 mm representing 51.8% to 97.3% of the cephalothorax and between 22.9% to 37.6% of the total body length. Urosome representing 19.4–22.6% of total body length.

3.1.6. Female Specimens Measured

Based on the examination of the additional specimens: 1♀ 10/21/2018, 1♀ 09/19/, 1 ♀ 10/28/2018. Total body length was measured from anterior end of cephalic somite to posterior margin of anal somite. The body length of three females ranged between 2.08 and 2.35 mm. Cephalothorax length ranged between 0.863 and 1.044 mm, thus representing 41.6–44.7% of total body length. Antennule length representing 41.2–52.2% of cephalothorax length and 18.3–21.7% of total body length. Urosome representing 20.5–23.5% of total body length. Caudal rami length between 0.11 and 0.13 mm.

3.2. Molecular Analysis

Six monstrilloid copepods including four females (identified as M. brasiliensis) and two males (tentatively assigned to M. brasiliensis), underwent molecular analysis to verify that they belong to the same species. We amplified all specimens’ 5′ end of the COI gene successfully, corresponding to a fragment of 681 bp (Table S1). The region showed 21 variable sites including 12 that were phylogenetically informative (shared). These copepods are conspecific, as shown by the distances among them (Table 4) with mean distances of 0.014 ± 0.003, characteristic of intraspecific individuals. The male MZ223434 clustered with MZ223430 female and the male MZ223435 clustered with the other females (Figure 6), confirming that the males belong to the same species of the studied females.
The branch in the ML tree (Figure 6) that contains exclusively the six Brazilian copepods (Rio das Ostras, RJ, Brazil) was 100% supported by bootstrap. This Brazilian branch appears as a sister group of Monstrilla ilhoii (see Table 5), followed by Caromiobenella branch, which includes also in its branch the species Caromiobenella hamatapex (Monstrilla hamatapex in Genbank and in Figure 6). More distantly is grouped Caromiobenella helgolandica (as Monstrilla helgolandica in Genbank and in Figure 6) and the branch of Maemonstrilla. The most distant group from the examined Brazilian copepods was the genus Cymbasoma and Monstrillopsis longilobata (KR049000 and KY553229).

4. Discussion

The males examined herein can be morphologically identified as members of Caromiobenella Jeon, Lee and Soh, 2018 by their possession of distinctive genus characters [3], as follows: (1) the modified distal half of the male fifth antennulary segment, with a series of brush-like processes is the main distinguishing character of Caromiobenella [3] and our specimens clearly have this character (Figure 3A,B); (2) the body shape and tagmosis and the urosome segmentation are also typical of Caromiobenella [3] (see Figure 1A–C); (3) the presence of 6 caudal setae with innermost apical caudal seta VI clearly shorter and slenderer than the others is another synapomorphic character shared with Caromiobenella ([3], Figure 5A,B); the male genital complex is also of the same type (type I) as that described for this genus ([3] Figure 5B–E). The results of our mtCOI analysis and comparison support the designation of our specimens as a species of Caromiobenella.
A reliable morphologic method to link the sexes of a monstrilloid species consists of finding particular autapomorphies shared by both sexes [2]. Thus, having a complete description of both sexes of the nominal M. brasiliensis ([8], present data), it was possible to use this morphologic criterion. It was previously applied to designate a male preliminarily identified as a subspecies of M. wandelli Suárez-Morales and Islas-Landeros, 1993 as the true male of M. mariaeugeniae Suárez-Morales, 1994 [23]. During our examination of the males and females from our samples, we were able to find a distinctive autapomorphy shared by both sexes of Caromiobenella brasiliensis comb. nov. This key character is the peculiar wrinkled protuberance on the male and female antennules; it is sexually dimorphic, present on segment 2 in the male and on segment 3 in the female ([8], Figure 4A,B); this character has not been observed in any other monstrilloid species. In addition, both sexes of C. brasiliensis share a short, spiniform element 1 ([8,14], Figure 3A) and a first antennulary segment partially fused with the cephalothorax ([8], Figure 3B and Figure 5A). Another option to link both sexes is by using molecular and genetic markers, a method that was successfully tested to match males and females of Korean monstrilloid copepods [24]. Overall, Caromiobenella brasiliensis can be morphologically distinguished from its known congeners by the distinctive process on the second antennulary segment and by the paired keel-like processes on the ventral surface of the preanal somite.
Currently, there are nine species of Caromiobenella recorded from different geographic regions: C. polluxea Jeon, Lee and Soh, 2018, C. castorea Jeon, Lee and Soh, 2018, and C. ohtsukai Jeon, Lee and Soh, 2019 from South Korea, C. helgolandica (Claus, 1863) and C. serricornis (Sars, 1921) from Europe and Canada, C. arctica (Davis and Green, 1974) from northern Canada, C. hamatapex (Grygier and Ohtsuka, 1995) from Japan and Korea, C. pygmaea (Suárez-Morales, 2000) from the Mediterranean, C. patagonica (Suárez-Morales, Ramírez and Derisio, 2008) from the Beagle Channel, and now C. brasiliensis (Suárez-Morales and Dias, 2000) from off Southeast Brazil (Southwestern Atlantic).

4.1. Ecology

As far as we are aware of, monstrilloids have not been hitherto reported from tidal pools of rocky reefs. Rocky reefs are coastal shores made from solid rock and considered reef-like ecosystems. Monstrilloids parasitize of marine benthic invertebrates including benthic polychaetes, but also pyramidellid and vermetid gastropods [1,2] and mussel [4]. Interestingly, the largest known aggregations of monstrilloids have been recorded from reef-related areas [25,26,27].
In addition, the occurrence of monstrilloids in this coastal region, and particularly in the rocky tide pools, may be related to the abundance of host species. So far, the hosts of C. brasiliensis remain unknown, but a potential, locally abundant host species is the brown mussel Perna perna (Linnaeus, 1758), previously found, either directly [4] or indirectly [28], in association with Monstrilla sp. in southern Brazil.
Most (78.3%) individuals of C. brasiliensis from both coastal waters and rocky tidepools were collected during spring. In the rocky tidepools, the densities of C. brasiliensis ranged between 2.5 and 15 ind./m3 and contributed up to 6% of the total copepod community in August (Table 1). Caromiobenella brasiliensis was found in water with temperatures ranging between 20.4 and 28.8 °C and salinities between 28.1 and 32.0.

4.2. Molecular Remarks

The genetic analysis based on the 681 bp COI fragment confirmed that the six copepods from Rio das Ostras (State of Rio de Janeiro, Brazil) investigated here form a single intraspecific group, and confirm that males showing the described morphology are conspecific with the females found in the surveyed area, designated here as Caromiobenella brasiliensis comb. nov. The phylogenetic tree (Tamura–Nei), based on 582 pb COI fragment, showed that the Brazilian species clustered in a major branch (69% bootstrap confidence) containing Monstrilla ilhoii, the most closely related species (D = 0.299, Kimura-2-Parameter), followed by a distance of 0.302 (D, Kimura-2-Parameter) by the branch containing three species of Caromiobenella, C. polluxea, C. castorea (the type species), and C. hamatapex. All other groups showed distances over 0.450 (D, Kimura-2-Parameter) with respect to the Brazilian copepods. The obtained phylogenetic tree (ML) suggests that the genus Caromiobenella is not monophyletic.

4.3. Key to Known Species of Caromiobenella (Males)

1.
Antennule with wrinkled protuberance on second antennulary segment............................................................. C. brasiliensis (Dias and Suárez-Morales, 2000)
1A.
Antennule lacking special processes on second segment ............................................. 2
2.
Element 1 (sensu Grygier and Ohtsuka, 1995) long, reaching well beyond midlength of succeeding second segment.................................... C. polluxea Jeon, Lee and Soh, 2018
2A.
Element 1(sensu Grygier and Ohtsuka, 1995) not as long, not reaching halfway of second segment .......................................................... C. ohtsukai Jeon, Lee and Soh, 2019
3.
Element 2d2 (sensu Grygier and Ohtsuka, 1995) remarkably long, reaching halfway of fourth segment...................................................... C. castorea Jeon, Lee and Soh, 2018
3A.
Element 2d2 (sensu Grygier and Ohtsuka, 1995) not as long, barely reaching distal margin of third segment or shorter.................................................................................................................................... 4
4.
Body length (excluding caudal rami) less than 0.5 mm, 5 caudal setae.......................... ........................................................................................ C. pygmaea (Suárez-Morales, 2000)
4A.
Body length (excluding caudal rami) more than 1.0 mm, 6 caudal setae.................... 5
5.
Elements 2v1–3 (sensu Grygier and Ohtsuka, 1995) relatively long, elements 2v2,3 reaching beyond halfway of succeeding third segment ........................................................... 6
5A.
Elements 2v1–3(sensu Grygier and Ohtsuka, 1995) short, barely reaching halfway of third segment................................................................................. C. serricornis (Sars, 1921)
6.
Antennulary segment 4 with proximal bulging process.............................................. ............................................. C. patagonica (Suárez-Morales, Ramírez and Derisio, 2008)
6A.
Antennulary segment 4 lacking proximal bulging process............................................7
7.
Fifth leg present.................................................................................................................... 8
7A.
Fifth leg absent...................................................................................................................... 9
8.
Fifth leg 1- lobed, inner margin straight............................. C. helgolandica (Claus, 1863)
8A.
Fifth leg 1-lobed, with two setae, inner margin produced............................................... ........................................................................ C. hamatapex (Grygier and Ohtsuka, 1995)
9.
Antennulary setae A–D (sensu Huys et al., 2007) branched...................................... ........................................................................................ C. arctica (Davis and Green, 1974)

5. Conclusions

The integrative taxonomy approach proved to be useful in solving this particular case among the Monstrilloida by allowing us to: (1) confirm its identity as a member of Caromiobenella and (2) reliably match females and males of C. brasiliensis. This nominal species has remained as Monstrilla brasiliensis for the last 21 years, but the molecular analysis does not support Caromiobenella as a monophyletic genus. Therefore, our findings of the males and those from molecular analysis, allowed us to place the Brazilian species in Caromiobenella, thus representing the first discovery of this genus in the Southwestern Atlantic Ocean and the first record of monstrilloids from a restricted habitat (i.e., coastal rocky tidepools). This work represents the second successful use of integrative taxonomy (molecular + morphologic) methods to link both sexes of a monstrilloid copepod. Caromiobenella now includes 10 species worldwide.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/d13060241/s1, Table S1: GenBank sequences used for comparisons with Brazilian copepods sequences (present study) and for the construction of Maximum Likelihood Tree.

Author Contributions

Conceptualization, J.C.L.R., E.S.-M., C.O.D., L.I.W. and L.G.F.; methodology, J.C.L.R., E.S.-M., C.O.D., L.I.W. and L.G.F.; software, J.C.L.R. and L.I.W.; formal analysis, J.C.L.R., E.S.-M., C.O.D. and L.I.W.; investigation, J.C.L.R., E.S.-M., C.O.D., L.I.W. and L.G.F.; writing—original draft preparation, E.S.-M., J.C.L.R. and C.O.D.; writing—review and editing, E.S.-M., J.C.L.R., C.O.D., L.I.W. and L.G.F.; resources, L.G.F. and L.I.W.; supervision, L.G.F. and L.I.W.; project administration, L.G.F.; funding acquisition, L.G.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research and the sample collection was carried out within the scope of the Projeto Costões Rochosos (Project Rocky Shores)/FUNBIO, and was supported by an environmental offset measure established through a Consent Decree/Conduct Adjustment Agreement between Chevron Brazil and the Brazilian Ministry for the Environment, with the Brazilian Biodiversity Fund—FUNBIO as implementer. JCLR received a Ph.D. grant from Project Rocky Shores)/FUNBIO. The Invertebrate Collection of the Institute de Biodiversity and Sustainability (NUPEM/UFRJ) of the Federal University of Rio de Janeiro is supported by the Projects Multipesca and Rocky Shores through “Programa de Apoio à Pesquisa Marinha e Pesqueira—FUNBIO”, Brazil.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request.

Acknowledgments

J.C.L.R. thanks the Project Rocky Shores/FUNBIO for providing a PhD fellowship during this study and to Lucas Lemos Batista, Eduardo Hugo de Morais and other project members for help in field collections. Our gratitude to Bárbara Teixeira Villarins for her valuable help in the molecular analysis.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Huys, R.; Llewellyn-Hughes, J.; Conroy-Dalton, S.; Olson, P.D.; Spinks, J.N.; Johnston, D.A. Extraordinary host switching in siphonostomatoid copepods and the demise of the Monstrilloida: Integrating molecular data, ontogeny and antennulary morphology. Mol. Phylogenet. Evol. 2007, 43, 368–378. [Google Scholar] [CrossRef] [Scilit]
  2. Suárez-Morales, E. Diversity of the Monstrilloida (Crustacea: Copepoda). PLoS ONE 2011, 6, e22915. [Google Scholar] [CrossRef] [Scilit]
  3. Jeon, D.; Lee, W.; Soh, H.Y. New genus and two new species of monstrilloid copepods (Copepoda: Monstrillidae): Inte-grating morphological, molecular phylogenetic, and ecological evidence. J. Crust. Biol. 2018, 38, 45–65. [Google Scholar] [CrossRef] [Scilit]
  4. Suárez-Morales, E.; Scardua, M.P.; da Silva, P.M. Occurrence and histopathological effects of Monstrilla sp. (Cope-poda: Monstrilloida) and other parasites in the brown mussel Perna perna from Brazil. J. Mar. Biol. Assoc. U. K. 2010, 90, 953–958. [Google Scholar] [CrossRef] [Scilit]
  5. Grygier, M.J. Identity of Thaumatoessa (= Thaumaleus) typica Krøyer, the first described monstrilloid copepod. Sarsia 1993, 78, 235–242. [Google Scholar] [CrossRef] [Scilit]
  6. Grygier, M.J.; Suárez-Morales, E. Recognition and partial solution of nomenclatural issues involving copepods of the family Monstrillidae (Crustacea: Copepoda: Monstrilloida). Zootaxa 2018, 4486, 497–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Suárez-Morales, E.; Grygier, M.J. Mediterranean and Black Sea Monstrilloid copepods (Copepoda: Monstrilloida): Rediscovering the diversity of transient zooplankters. Water 2021, 13, 1–11. [Google Scholar]
  8. Suárez-Morales, E.; Dias, C. Two new species of Monstrilla (Copepoda: Monstrilloida) from Brazil. J. Mar. Biol. Assoc. U. K. 2000, 80, 1031–1039. [Google Scholar] [CrossRef] [Scilit]
  9. Suárez-Morales, E.; Dias, C. A new species of Monstrilla (Crustacea: Copepoda: Monstrilloida) from Brazil with notes on M. brevicornis Isaac. Proc. Biol. Soc. Wash. 2001, 114, 219–228. [Google Scholar]
  10. Suárez-Morales, E.; Dias, C. Taxonomic report of some monstrilloids (Copepoda: Monstrilloida) from Brazil with description of four new species. Bull. Inst. Royal Sci. Nat. Belg. Biologie. 2001, 71, 65–81. [Google Scholar]
  11. Leite, N.R.; Pereira, L.C.; Abrunhosa, F.; Pires, M.A.; Da Costa, R.M. Occurrence of Cymbasoma longispinosum Bourne, 1890 (Copepoda: Monstrilloida) in the Curuçá River estuary (Amazon Littoral). An. Acad. Bras. Ciências 2010, 82, 577–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Suárez-Morales, E.; Dias, C.O.; Bonecker, S.L. Discovery of the female of Cymbasoma rochai Suárez-Morales & Dias, 2001 (Copepoda, Monstrilloida, Monstrillidae), the first Brazilian member of the C. longispinosum species-group. Crustaceana 2020, 93, 1091–1101. [Google Scholar] [CrossRef] [Scilit]
  13. Grygier, M.J.; Ohtsuka, S. A new genus of monstrilloid copepods (Crustacea) with anteriorly pointing ovigerous spines and related adaptations for subthoracic brooding. Zool. J. Linn. Soc. 2008, 152, 459–506. [Google Scholar] [CrossRef] [Scilit]
  14. Grygier, M.J.; Ohtsuka, S. Sem Observation of the Nauplius of Monstrilla hamatapex, new species, from Japan and an example of Upgraded descriptive standards for monstrilloid copepods. J. Crust. Biol. 1995, 15, 703. [Google Scholar] [CrossRef] [Scilit]
  15. Jeon, D.; Lee, W.; Soh, H.Y. New species of Caromiobenella Jeon, Lee & Soh, 2018 (Crustacea, Copepoda, Monstrilloida) from Chuja Island, Korea. ZooKeys 2019, 814, 33–51. [Google Scholar] [CrossRef] [Scilit]
  16. Huys, R.; Boxshall, G.A. Copepod Evolution; The Ray Society: London, UK, 1991; pp. 1–468. [Google Scholar]
  17. Harris, S.A.; Hoelzel, A.R. Molecular Genetic Analysis of Populations. A Practical Approach. J. Appl. Ecol. 1993, 30, 197. [Google Scholar] [CrossRef] [Scilit]
  18. Casquet, J.; Thebaud, C.; Gillespie, R.G. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol. Ecol. Resour. 2012, 12, 136–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  20. Tamura, S.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
  21. Raupach, M.J.; Barco, A.; Steinke, D.; Beermann, J.; Laakmann, S.; Mohrbeck, I.; Neumann, H.; Kihara, T.C.; Pointner, K.; Raulovici, A.; et al. The Application of DNA Barcodes for the Identification of Marine Crustaceans from the North Sea and Adjacent Regions. PLoS ONE 2015, 10, e0139421. [Google Scholar] [CrossRef] [Scilit]
  22. Unal, E.; Frost, B.W.; Armbrust, V.; Kideys, A.E. Phylogeography of Calanus helgolandicus and the Black Sea copepod Calanus euxinus, with notes on Pseudocalanus elongatus (Copepoda, Calanoida). Deep. Sea Res. Part II Top. Stud. Oceanogr. 2006, 53, 1961–1975. [Google Scholar] [CrossRef] [Scilit]
  23. Suárez-Morales, E. On the male of Monstrilla mariaeugeniae Suárez-Morales & Islas-Landeros (Copepoda: Monstrilloida) from the Mexican Caribbean Sea. Crustaceana 1998, 71, 360–362. [Google Scholar]
  24. Jeon, D.; Lim, D.; Lee, W.; Soh, H.Y. First use of molecular evidence to match sexes in the Monstrilloida (Crustacea: Copepoda), and taxonomic implications of the newly recognized and described, partly Maemonstrilla-like females of Monstrillopsis longilobata Lee, Kim & Chang, 2016. PeerJ 2018, 6, e4938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Sale, P.F.; McWilliam, P.S.; Anderson, D.T. Composition of the near-reef zooplankton at Heron Reef, Great Barrier Reef. Mar. Biol. 1976, 34, 59–66. [Google Scholar] [CrossRef] [Scilit]
  26. Suárez-Morales, E. An aggregation of monstrilloid copepods in a western Caribbean reef area: Ecological and conceptual implications. Crustaceana 2001, 74, 689–696. [Google Scholar] [CrossRef] [Scilit]
  27. Suárez-Morales, E. Taxonomic report on a collection of monstrilloids (Copepoda: Monstrilloida) from Banco Chinchorro, Mexico with description of a new species. An. Inst. Biol. Univ. Nac. Autón. Mex. Ser. Zool. 2001, 72, 9–28. [Google Scholar]
  28. Dias, C.O.; Bonecker, S.L.C. Study of Monstrilloida distribution (Crustacea: Copepoda) in the Southwest Atlantic. Panamjas 2007, 2, 270–278. [Google Scholar]
Figure 1. Map showing zooplankton sampling sites in the Rio de Janeiro coast, SW Atlantic, with the coastal municipalities where monstrilloid copepods were collected. Dots: collection in tidepools of rocky shores. Solid triangle: collection in shallow coastal zone (<5 m depth). (A) Remanso beach, (B) Areias Negras Beach, (C) Cemiterio beach, (D) Rasa beach.
Figure 1. Map showing zooplankton sampling sites in the Rio de Janeiro coast, SW Atlantic, with the coastal municipalities where monstrilloid copepods were collected. Dots: collection in tidepools of rocky shores. Solid triangle: collection in shallow coastal zone (<5 m depth). (A) Remanso beach, (B) Areias Negras Beach, (C) Cemiterio beach, (D) Rasa beach.
Diversity 13 00241 g001
Figure 2. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Habitus, dorsal view; (B) Habitus, lateral view; (C) Same, ventral view. Arrows indicate antero-ventral nipple-like cuticular processes. Legend: pp = preoral process, op = oral papilla.
Figure 2. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Habitus, dorsal view; (B) Habitus, lateral view; (C) Same, ventral view. Arrows indicate antero-ventral nipple-like cuticular processes. Legend: pp = preoral process, op = oral papilla.
Diversity 13 00241 g002
Figure 3. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Right antennule, dorsal view showing setal elements (segments 1–4 [14], segment 5 [1]; (B) Left fifth antennulary segment; (C) Anterior part of cephalothorax, lateral view (pp = preoral process, op = oral papilla); (D) Leg 1 exopod; (E) Leg 3 exopod. Arrow indicates wrinkled outer process on second segment. Legend: pp = preoral process, op = oral papilla.
Figure 3. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Right antennule, dorsal view showing setal elements (segments 1–4 [14], segment 5 [1]; (B) Left fifth antennulary segment; (C) Anterior part of cephalothorax, lateral view (pp = preoral process, op = oral papilla); (D) Leg 1 exopod; (E) Leg 3 exopod. Arrow indicates wrinkled outer process on second segment. Legend: pp = preoral process, op = oral papilla.
Diversity 13 00241 g003
Figure 4. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Leg 1; (B) Leg 2; (C) Leg 3; (D) Leg 4. Arrows indicate expanded inner margins of basipod.
Figure 4. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., from Rio de Janeiro area, adult male (MNRJ30136). (A) Leg 1; (B) Leg 2; (C) Leg 3; (D) Leg 4. Arrows indicate expanded inner margins of basipod.
Diversity 13 00241 g004
Figure 5. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., adult male (MNRJ30136). (A) Urosome, dorsal view; (B) Urosome, ventral view showing reduced knob-like fifth legs (arrows); (C) Urosome, lateral view showing genital complex with ventral keel-like processes arrowed; (D) Detail of genital lappets, lateral view; (E) Genital lappets, ventral view.
Figure 5. Caromiobenella brasiliensis (Dias and Suárez-Morales, 2000) comb. nov., adult male (MNRJ30136). (A) Urosome, dorsal view; (B) Urosome, ventral view showing reduced knob-like fifth legs (arrows); (C) Urosome, lateral view showing genital complex with ventral keel-like processes arrowed; (D) Detail of genital lappets, lateral view; (E) Genital lappets, ventral view.
Diversity 13 00241 g005
Figure 6. Maximum likelihood tree (Tamura-Nei) showing the position of Brazilian copepods from Rio de Janeiro coast in relation to other monstrilloid genera and species obtained from GenBank. Female Brazilian copepods in red and males in blue. See Table S1 for specific names and GenBank accession numbers for the partial sequences of C. brasiliensis used. Caromiobenella hamatapex and C. helgolandica appear as Monstrilla in GenBank.
Figure 6. Maximum likelihood tree (Tamura-Nei) showing the position of Brazilian copepods from Rio de Janeiro coast in relation to other monstrilloid genera and species obtained from GenBank. Female Brazilian copepods in red and males in blue. See Table S1 for specific names and GenBank accession numbers for the partial sequences of C. brasiliensis used. Caromiobenella hamatapex and C. helgolandica appear as Monstrilla in GenBank.
Diversity 13 00241 g006
Table 1. Collection sites data. TD = Tidepool drainage, PN = Plankton net in shallow coastal area, M = male, F = female, temp = water surface temperature (°C), sal = surface water salinity. NA = no data available. Collections at Cemiterio beach were not made in tidepools, but in the coastal zone without using a flowmeter, thus without volume and density estimates.
Table 1. Collection sites data. TD = Tidepool drainage, PN = Plankton net in shallow coastal area, M = male, F = female, temp = water surface temperature (°C), sal = surface water salinity. NA = no data available. Collections at Cemiterio beach were not made in tidepools, but in the coastal zone without using a flowmeter, thus without volume and density estimates.
DateSiteCollection TypeC. brasiliensisZoopl. Density (ind. m3)Tidepool Volume (L)Drained Volume (L)Catalog NumberTempSal
N°, SexDensity (ind. m3)
08.08.17A.NegrasTD3M15.0155345200NPM00020 (1M *), (2M * lost%)24.230.0
21.09.17RemansoTD2F5.02061900400NPM000021 (1F), (1F lost%)20.434.3
16.10.17RemansoTD1 M5.099119002001M (dissected)21.533.2
16.10.17RemansoTD2M10.0335600200NPM00022 (1M *), MNRJ30136 (1M *)21.233.6
31.10.17RasaTD1F2.5771440400NPM00023 (1F)22.628.1
03.02.18RemansoTD1M2.587019004001M * (dissected)28.832.0
19.09.18CemiterioPN1F/2MNANANANAMNRJ28990 (1M), 1M #, 1F $ *--
20.10.18CemiterioPN1F/1MNANANANA1M #, 2F $--
21.10.18CemiterioPN2F/1FNANANANA2F #, 1F $ *--
28.10.18CemiterioPN1FNANANANA1F # *--
24.11.18CemiterioPN2FNANANANAMNRJ28991 (1F), 1F #--
25.11.18CemiterioPN1FNANANANANPM00024 (1F)--
02.12.18CemiterioPN1FNANANANANPM00025 (1F)--
* used in morphometrics, # used in DNA analysis with success; % lost in handling.
Table 2. Additional measurements of male specimens of Caromiobenella brasiliensis observed in this study (1♂ NPM-00020, 1♂ NPM-00022, 1♂ MNRJ30136, 1♂ 03/02/2018 (dissected).
Table 2. Additional measurements of male specimens of Caromiobenella brasiliensis observed in this study (1♂ NPM-00020, 1♂ NPM-00022, 1♂ MNRJ30136, 1♂ 03/02/2018 (dissected).
MeasureMin (mm)Max (mm)Mean (mm)
Total length0.8161.1701.004
Antennule length0.1870.3730.323
Cephalothorax height0.1860.2690.240
Cephalothorax length0.3390.4750.413
Cephalothorax width0.2830.4560.381
Metasome length0.1720.2390.211
Urosome length0.8161.1701.004
Incorporated pediger0.1800.2560.225
Free pediger 10.2110.2940.266
Free pediger 20.1640.2200.200
Free pediger 30.1310.2030.178
Genital somite0.0820.8100.273
Preanal somite0.0650.6600.216
Caudal ramus length0.0530.0660.059
Caudal ramus width0.0360.0580.046
Table 3. Armature of legs 1–4 including basis, exopods and endopods. Roman numerals indicate spiniform elements, Arabic numbers indicate setiform elements [13,14].
Table 3. Armature of legs 1–4 including basis, exopods and endopods. Roman numerals indicate spiniform elements, Arabic numbers indicate setiform elements [13,14].
LegBasisEndopodExopod
Leg 11–0I-1; 0–1; 2, 2, 1I-1; 0–1; 2, 2, 1, I
Legs 2–41–00–1; 0–1; 2, 2, 1I-1; 0–1; 2, 2, 1, I
Table 4. Pair-wise genetic distances between monstrilloid copepods from Rio das Ostras (Sate of Rio de Janeiro, Brazil) based on 681 pb COI (cytochrome c-oxidase, subunit I) fragment. Distances: (below diagonal) p-distance; (above diagonal) Tamura-Nei distance.
Table 4. Pair-wise genetic distances between monstrilloid copepods from Rio das Ostras (Sate of Rio de Janeiro, Brazil) based on 681 pb COI (cytochrome c-oxidase, subunit I) fragment. Distances: (below diagonal) p-distance; (above diagonal) Tamura-Nei distance.
FemaleFemaleFemaleFemaleMaleMale
GenBank
Accesion
MZ223430MZ223431MZ223432MZ223433MZ223434MZ223435
MZ223430 0.0180.0190.0230.0150.006
MZ2234310.018 0.0100.0100.0090.018
MZ2234320.0200.010 0.0060.0100.019
MZ2234330.0220.0100.006 0.0130.019
MZ2234340.0150.0090.0100.013 0.015
MZ2234350.0060.0180.0190.0190.015
Table 5. Mean pair-wise genetic distances over 582 pb COI fragment among different monstrilloid genera or branches as shown in Figure 6 for the comparisons with Brazilian copepods from Rio de Janeiro coast. See Table S1 for sequences obtained from GenBank. Distances: (below the diagonal) Kimura-2 Parameter; (above the diagonal) Tamura–Nei distance.
Table 5. Mean pair-wise genetic distances over 582 pb COI fragment among different monstrilloid genera or branches as shown in Figure 6 for the comparisons with Brazilian copepods from Rio de Janeiro coast. See Table S1 for sequences obtained from GenBank. Distances: (below the diagonal) Kimura-2 Parameter; (above the diagonal) Tamura–Nei distance.
Branches/Spp12345678
(1) C. brasiliensis 0.305 ± 0.0260.308 ± 0.0230.470 ± 0.0380.366 ± 0.0310.464 ± 0.0300.505 ± 0.0410.535 ± 0.036
(2) M. ilhoii0. 299± 0.025 0.401 ± 0.0280.459 ± 0.0390.388 ± 0.0330.446 ± 0.0300.595 ± 0.0540.576 ± 0.038
(3) Caromiobenella0.302 ± 0.0220.390 ± 0.027 0.443 ± 0.0310.417 ± 0.0310.503 ± 0.0280.540 ± 0.0410.545 ± 0.035
(4) C. helgolandica0.452 ± 0.0350. 435± 0.0350.428 ± 0.029 0. 398± 0.0330.542 ± 0.0370.573 ± 0.0540.620 ± 0.043
(5) Maemonstrilla0.353 ± 0.0280.374 ± 0.0290.406 ± 0.0290.385 ± 0.031 0.489 ± 0.0320.550 ± 0.0520.579 ± 0.041
(6) Cymbasoma0.451 ± 0.0280.434 ± 0.0280.488 ± 0.0270.517 ± 0.0330.471 ± 0.030 0.596 ± 0.0420.593 ± 0.034
(7) M. longilobata0.481 ± 0.0360.543 ± 0.0410.515 ± 0.0260.519 ± 0.0400.500 ± 0.0390. 561± 0.034 0.397 ± 0.027
(8) External group0.522 ± 0.0340.554 ± 0.0340.532 ± 0.0330.588 ± 0.0370.553 ± 0.0350.573 ± 0.0320.388 ± 0.025
(1) Brazilian Copepods (females: MZ223430, MZ223431, MZ223432, MZ223433 and males: MZ223434, MZ223435); (2) Monstrilla ilhoii (KY553214); (3) C. hamatapex (KR048992), C. castorea (KY553209, type species) and C. polluxea (KY553211); (4) C. helgolandica (KT209330 and KT209379); (5) Maemonstrilla sp. (KY553231, KY553232) and Maemonstrilla simplex (KR049003); (6) Cymbasoma sp. (KR048989), Cymbasoma reticulatum (KR048990) and Monstrillopsis longilobata (KY553229); (7) Monstrillopsis longilobata (KR049000); (8) Tigriopus japonicus (KR049009), Lepeophtheirus salmonis (KR049053) and the planktonic [22] Calanus helgolandicus (AY604521), Caromiobenella hamatapex and C. helgolandica appear as Monstrilla in GenBank.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

da Cruz Lopes da Rosa, J.; Dias, C.d.O.; Suárez-Morales, E.; Weber, L.I.; Fischer, L.G. Record of Caromiobenella (Copepoda, Monstrilloida) in Brazil and Discovery of the Male of C. brasiliensis: Morphological and Molecular Evidence. Diversity 2021, 13, 241. https://doi.org/10.3390/d13060241

AMA Style

da Cruz Lopes da Rosa J, Dias CdO, Suárez-Morales E, Weber LI, Fischer LG. Record of Caromiobenella (Copepoda, Monstrilloida) in Brazil and Discovery of the Male of C. brasiliensis: Morphological and Molecular Evidence. Diversity. 2021; 13(6):241. https://doi.org/10.3390/d13060241

Chicago/Turabian Style

da Cruz Lopes da Rosa, Judson, Cristina de Oliveira Dias, Eduardo Suárez-Morales, Laura Isabel Weber, and Luciano Gomes Fischer. 2021. "Record of Caromiobenella (Copepoda, Monstrilloida) in Brazil and Discovery of the Male of C. brasiliensis: Morphological and Molecular Evidence" Diversity 13, no. 6: 241. https://doi.org/10.3390/d13060241

APA Style

da Cruz Lopes da Rosa, J., Dias, C. d. O., Suárez-Morales, E., Weber, L. I., & Fischer, L. G. (2021). Record of Caromiobenella (Copepoda, Monstrilloida) in Brazil and Discovery of the Male of C. brasiliensis: Morphological and Molecular Evidence. Diversity, 13(6), 241. https://doi.org/10.3390/d13060241

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop