Next Article in Journal
Silver Tip (Camellia sinensis) Extract Promotes Supersulfide Biosynthesis in Keratinocytes
Previous Article in Journal
Immunogenicity and Protection of mRNA Vaccine Encoding Spike Protein of SARS-CoV-2 Omicron-XEC Subvariant
Previous Article in Special Issue
Vitamin D and Metabolic Dysfunction-Associated Steatotic Liver Disease: Molecular Mechanisms and Clinical Implications—A Narrative Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 10
10.3390/ijms27104217
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association of Vitamin D Receptor Gene Polymorphisms with Serum 25-Hydroxyvitamin D Levels in Lithuanian Adults with Atopic Dermatitis: A Case—Control Study

by
Kamilija Briedė
1,*,
Daina Pavalkienė
2,3,
Brigita Gradauskienė
2,
Agnė Bartnykaitė
4,
Julius Leonavičius
1,
Rasa Ugenskienė
4,5,
Dalia Lukšienė
6,
Vacis Tatarūnas
7 and
Skaidra Valiukevičienė
1
1
Department of Skin and Venereal Diseases, Medical Academy, Lithuanian University of Health Sciences, LT-44307 Kaunas, Lithuania
2
Department of Immunology and Allergology, Medical Academy, Lithuanian University of Health Sciences, LT-44307 Kaunas, Lithuania
3
Lab of Immunology, Department of Immunology and Allergology, Lithuanian University of Health Sciences, LT-50161 Kaunas, Lithuania
4
Oncology Research Laboratory, Oncology Institute, Lithuanian University of Health Sciences, LT-44307 Kaunas, Lithuania
5
Department of Genetics and Molecular Medicine, Lithuanian University of Health Sciences, LT-44307 Kaunas, Lithuania
6
Laboratory of Population Studies, Institute of Cardiology, Lithuanian University of Health Sciences, LT-50103 Kaunas, Lithuania
7
Laboratory of Molecular Cardiology, Institute of Cardiology, Lithuanian University of Health Sciences, LT-50103 Kaunas, Lithuania
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(10), 4217; https://doi.org/10.3390/ijms27104217
Submission received: 20 March 2026 / Revised: 3 May 2026 / Accepted: 5 May 2026 / Published: 9 May 2026
(This article belongs to the Special Issue Vitamin D Signaling in Human Health and Diseases)
Versions Notes

Abstract

Atopic dermatitis (AD) is a chronic inflammatory skin disease increasingly prevalent in adults. Vitamin D plays an important role in regulating immune responses, cellular differentiation, and inflammation. Several single-nucleotide polymorphisms (SNPs) in the vitamin D receptor (VDR) gene have been suggested as biomarkers of AD susceptibility and severity. The aim of this study was to investigate six SNPs in the VDR gene (rs3847987, rs731236, rs7975232, rs1544410, rs2228570, and rs11168293) and their association with AD and blood biomarkers. Genotyping was performed in 91 adult patients with AD and 102 controls using real-time polymerase chain reaction. The genotype and allele distributions did not differ significantly between AD patients and controls. However, the G and T alleles of VDR rs731236 and rs1544410 were more frequently detected in individuals with serum 25-hydroxyvitamin D (25(OH)D) levels above 30 ng/mL. In contrast, the VDR rs7975232 C allele appears to be associated with lower odds of having a serum 25(OH)D level above 30 ng/mL. In genotype-stratified analysis, the T allele of VDR rs11168293 was more prevalent among individuals with eosinophil counts of 300 cells/μL. These findings suggest that VDR polymorphisms may contribute to variability in vitamin D status and inflammatory responses in adults with AD.

1. Introduction

Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by intense pruritus, eczematous lesions, and type 2 helper T lymphocyte (Th2)-dominant inflammation. Worldwide, up to 10% of adults are affected by AD [1]. In adults, AD is characterized by a more chronic disease course and is associated with a significant psychological burden [2,3].
Growing evidence suggests that serum 25-hydroxyvitamin D (25(OH)D) plays an important role in the pathophysiology of AD. A recent systematic review and meta-analysis showed that lower serum 25(OH)D levels are associated with greater AD severity, while vitamin D supplementation may improve clinical symptoms [4]. Suboptimal 25(OH)D3 levels are recognized as a modifiable risk factor for AD, with vitamin D3 supplementation demonstrating therapeutic potential in improving clinical outcomes [5]. In addition, several studies found that individuals with serum 25(OH)D insufficiency tend to have higher serum immunoglobulin E (IgE) levels and increased eosinophil count in blood compared to individuals with normal vitamin D levels [6,7].
The biological effects of serum 25(OH)D are primarily mediated through the vitamin D receptor (VDR), an intracellular nuclear receptor expressed in keratinocytes, immune cells, and various other tissues. After binding the active vitamin D metabolite 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), VDR regulates multiple biological processes, including keratinocyte proliferation, epidermal differentiation, immune responses, and maintenance of skin barrier integrity [8,9,10]. These pleiotropic mechanisms are particularly relevant to the pathogenesis of chronic inflammatory skin diseases, including AD.
Genetic variation within the VDR gene may modulate vitamin D’s biological activity by influencing receptor function and activation. Given the important role of vitamin D in immune regulation and epidermal barrier homeostasis, VDR polymorphisms have attracted considerable attention as potential genetic factors contributing to inflammatory and atopy-associated disorders, including AD, asthma, and allergic rhinitis [11]. Multiple studies have demonstrated associations between VDR polymorphisms and the risk of atopic diseases, including AD, across populations from diverse geographic regions. Although several studies have investigated the association between VDR polymorphisms and AD, much of the available evidence derives from pediatric or mixed-age populations [11,12]. In contrast, studies conducted specifically in adult cohorts remain limited and have yielded inconsistent findings [13,14,15,16,17].
Several studies have demonstrated significant associations between VDR gene polymorphisms and atopic diseases, particularly involving variants such as rs2228570 and rs731236 [13,15]. Despite this, research focusing on these polymorphisms in adults remains scarce, and the findings on their association with atopic diseases are notably inconsistent. These discrepancies likely reflect substantial heterogeneity among study populations, including differences in age, sex, ethnic background, sample size, and clinical phenotype [18,19]. In addition to demographic and genetic factors, environmental and lifestyle influences also contribute to differences between study populations. Lithuania, as a high-latitude country in Northern Europe, receives limited ultraviolet B (UVB) radiation for much of the year, especially in autumn and winter, which reduces vitamin D synthesis in the skin [20,21]. The Baltic region experiences significant seasonal variation in sunlight, causing fluctuations in serum 25(OH)D levels throughout the year [16]. Additionally, dietary intake of vitamin D-rich foods, such as fatty fish and fortified products, is relatively low in Northern and Eastern Europe compared to Southern Europe [17]. These factors may lead to a higher prevalence of vitamin D insufficiency and help explain population-specific differences in vitamin D status and its interaction with VDR genetic variability, especially when compared to countries like Italy or Turkey, where sun exposure and dietary habits differ. Associations between VDR polymorphisms and AD may partly reflect gene–environment interactions rather than direct genetic effects alone [16,17].
Thus far, only a limited number of studies have examined associations between VDR polymorphisms and AD in adults, including investigations conducted in Italy, Turkey, Germany, and Lithuania [13,14,15,16,17]. Expanding research in this field may improve our understanding of the genetic factors underlying AD and may contribute to the development of more personalized prevention and treatment in adults with AD. Genetic variation in the VDR gene may influence vitamin D signaling by altering receptor expression, messenger RNA (mRNA) stability, or transcriptional activity. Several VDR polymorphisms have therefore been investigated in immune-mediated and allergic diseases, including AD [9,11,19]. In the present study, six VDR variants were selected based on previous evidence, biological plausibility, and relevance to European populations. Four canonical variants—rs731236, rs7975232, rs1544410, and rs2228570—have been studied in relation to AD susceptibility, disease severity, and vitamin D metabolism [12,13,15]. Among these, rs2228570 is a functional polymorphism located at the translation initiation site and may alter VDR protein structure and downstream receptor activity [19], whereas rs731236, rs7975232, and rs1544410, located in the 3′ region of the gene, may influence mRNA stability, gene expression, or linkage with other regulatory variants [11,12]. In addition, rs3847987 and rs11168293 were included because of reported associations with vitamin D status and inflammatory biomarkers in atopy-related phenotypes [14,16]. Thus, the selected SNP panel enabled comparison with previous studies and exploration of additional VDR genetic variability in an adult Baltic population.
Therefore, the present study was designed to assess associations of six VDR gene polymorphisms (rs3847987, rs731236, rs7975232, rs1544410, rs2228570, and rs11168293) with AD and AD-linked peripheral blood markers in a homogeneous adult population. We hypothesized that selected VDR polymorphisms may be associated with variability in serum 25(OH)D levels and AD-related peripheral blood biomarkers in Lithuanian adults.

2. Results

2.1. Clinical Characterization of Participants

The demographic data of the participants are summarized in Table 1. Cases and controls did not vary substantially by gender (p = 0.498) and age (p = 0.068) (Table 1). The main baseline clinical characteristics of the AD subjects are presented in Table 2.
Among the 91 patients with AD, 51 (56.0%) had serum 25(OH)D levels less than 30 ng/mL, 45 (49.5%) had elevated total IgE levels (>100 kU/L), and 36 (39.6%) had eosinophil counts above 300 cells/μL. The median values of serum 25(OH)D level, total IgE level, and eosinophil count in men and women are presented in Table 3. Men tended to have higher values of all analytes than women; however, the differences were not significant (p > 0.05) (Table 3).
In the analyzed cohort, 26 patients (28.6%) had the highest SCORAD index (>50). This group demonstrated statistically significantly higher total IgE levels and eosinophil counts compared with the other two groups (p < 0.001) (Table 3). Although eosinophil counts differed according to disease severity, genotype-based analysis additionally revealed an association between VDR rs11168293 and eosinophilia.

2.2. VDR Polymorphisms and AD

Six VDR gene polymorphisms (rs3847987, rs731236, rs7975232, rs1544410, rs2228570, and rs11168293) were investigated in both AD patients and control subjects. The distribution of all analyzed SNPs was consistent with the Hardy–Weinberg equilibrium (HWE) (p > 0.05) and is shown in Table 4.
The allele frequencies in the AD and control groups were comparable to those reported for European populations in the 1000 Genomes project. No significant differences in genotype or allele frequencies were observed between AD patients and controls (p > 0.05), indicating no association between the analyzed VDR polymorphisms and AD (Table 4).

2.3. VDR Polymorphisms and Serum 25(OH)D Levels

In the AD group, the serum 25(OH)D levels ranged from 3.87 to 107.46 ng/mL, with a median value of 27.42 ng/mL. Both quantitative and qualitative statistical analyses were conducted to compare the serum 25(OH)D levels across the VDR genotype and allele groups. The quantitative analysis showed no statistically significant differences for any of the analyzed SNPs (p > 0.05).
A serum 25(OH)D level of 30 ng/mL is typically regarded as the threshold for sufficiency [22,23,24,25,26,27], with lower levels associated with increased severity and a higher risk of AD. Consequently, for the qualitative analysis, AD patients were classified into two groups according to serum 25(OH)D-level differences: ≤30 and >30 ng/mL. This analysis demonstrated that certain VDR gene polymorphisms (rs731236, rs7975232, and rs1544410) were significantly associated with variations in serum 25(OH)D level (Table 5). AD patients carrying the rs731236 G allele had 1.867-fold higher odds of having a serum 25(OH)D level higher than 30 ng/mL (OR = 1.867, 95% CI: 1.011–3.448, p = 0.046). Similarly, univariate logistic regression analysis revealed that increased odds of serum 25(OH)D level > 30 ng/mL were significantly associated with the rs1544410 T allele (OR = 1.964, 95% CI: 1.064–3.624, p = 0.031). In contrast, in the analyzed AD patient group, the rs7975232 C allele was associated with decreased odds for vitamin D level > 30 ng/mL (OR = 0.523, 95% CI: 0.289–0.946, p = 0.032).

2.4. VDR Polymorphisms, Blood Eosinophils and Total IgE

Since the study showed significant differences in eosinophil count and total IgE levels among patients with different AD severities, further analyses were performed to investigate the association of VDR polymorphisms on both analytes. Total eosinophil counts and IgE levels were compared using quantitative and qualitative statistical analyses across different VDR genotype and allele groups.
As blood eosinophil counts greater than 300 cells/μL [28,29,30] and total IgE levels above 100 kU/L [31,32] are commonly considered elevated in clinical practice, these values were used as threshold levels for group stratification in the qualitative analysis. The results showed a significant association between the rs11168293 T allele and increased eosinophil count (p = 0.039, Table 6). In the qualitative analysis, it was confirmed that the rs11168293 T allele is associated with approximately 2-fold increased odds for eosinophil counts > 300 cells/μL (OR = 1.867, 95% CI: 1.006–3.464, p = 0.048) (Table 7). Analysis of the relationship between VDR gene SNPs and IgE levels showed that the heterozygous rs1544410 genotype was associated with lower odds of elevated IgE levels (>100 kU/L) (OR = 0.391, 95% CI: 0.157–0.975, p = 0.044) (Table 8).

3. Discussion

In recent years, increasing attention has been directed toward the role of serum 25(OH)D levels and vitamin D receptor (VDR) signaling in the pathophysiology of AD [5,9]. However, the associations between VDR gene polymorphisms and AD, as well as its clinical manifestations, remain unclear. Thus, in the present study, we investigated the association between six selected VDR gene polymorphisms (rs3847987, rs731236, rs7975232, rs1544410, rs2228570, rs11168293) and AD in a cohort of Lithuanian adults, as well as their relationship with serum 25(OH)D levels and markers of allergic inflammation. Although the analyzed polymorphisms were not associated with AD, several associations with blood biomarkers were observed. The threshold for vitamin D sufficiency is still debated in international guidelines. While some organizations, including the Institute of Medicine, recommend lower cut-offs, a serum 25(OH)D concentration of 30 ng/mL is widely used in clinical research and is commonly adopted in Endocrine Society guidance [24,25,26,27]. We selected this threshold to align with previous studies and because it may be clinically relevant for northern European populations, such as those in Lithuania, where seasonal ultraviolet exposure is limited. Specifically, our study showed that the VDR alternative alleles at rs731236 and rs1544410 were more frequently observed among patients with sufficient serum 25(OH)D levels (greater than 30 ng/mL). In contrast, there seems to be lower odds of having a serum 25(OH)D level more than 30 ng/mL when the VDR rs7975232 alternative allele is present. These results indicate that VDR genetic variation may contribute to differences in circulating 25(OH)D levels among patients with AD.
The observed association between certain alleles and higher serum 25(OH)D concentrations should not be viewed as direct protection against AD. Rather, AD is a multifactorial disorder influenced by epidermal barrier dysfunction, immune dysregulation, and environmental factors [1,8,9]. These variants may affect vitamin D metabolism or signaling pathways but are unlikely to be primary determinants of disease risk [11,19]. Such associations may also reflect compensatory biological mechanisms that modulate chronic Th2-skewed inflammation [9,19].
Furthermore, we observed a higher prevalence of the alternative allele of VDR rs11168293 among patients with an eosinophil count greater than 300 cells/μL, suggesting a potential link between this SNP and systemic allergic inflammation. Higher eosinophil counts and total IgE levels are well-established biomarkers of AD severity and reflect systemic immune activation [1,3,29]. This may indicate that VDR rs11168293 is involved in the modulation of type 2 immune responses. However, several studies have been contradictory and did not show a clear relationship between serum 25(OH)D levels and disease severity [6,7,14]. This discrepancy may be attributable to the relatively small sample size of the investigated subjects, limited statistical power, population-specific genetic and environmental factors, or differences in study design and methodologies of AD severity assessment.
To date, the selected VDR polymorphisms have been investigated in relatively few studies of atopic diseases, and the evidence remains inconsistent. For VDR rs3847987, a previous study similarly found no association with AD or allergic asthma, although genotype-specific differences in vitamin D status were reported [17]. Additionally, no significant relationship between VDR rs3847987 and several key inflammatory cytokines (IL-5, IL-17A, TGF-β1, IL-10, IFN-γ, IL-35, and IL-33) has been demonstrated [16]. These findings suggest that VDR rs3847987 may have a limited role in disease susceptibility but could still be involved in modulating pathways related to vitamin D.
Regarding VDR rs731236, our results align with those of other authors who observed a significant association between VDR rs731236 and serum 25(OH)D levels [14,15]. However, the immunological and clinical significance of VDR rs731236 remains uncertain. The associations between VDR rs731236 and levels of Th2 and Th17 cells, the Th1/Th2 ratio, serum IL-10 and TGF-β1 levels have been reported [16], while other studies found no relationship with AD or its clinical characteristics (disease onset, sex, IgE levels, generalized AD localization, etc.) [33,34]. This inconsistency may indicate that VDR rs731236 primarily influences regulation rather than clinical phenotype expression.
For VDR rs7975232, most previous studies have not determined an association with AD or its clinical features [14,34,35], although one study [33] reported a higher frequency of the VDR rs7975232 AA genotype in patients with earlier disease onset. Our findings extend these observations by suggesting a potential relationship with vitamin D insufficiency. This may indicate that VDR rs7975232 influences vitamin D metabolism or signaling rather than directly contributing to disease occurrence.
The evidence regarding VDR rs1544410 is also inconsistent. While studies in Chinese and Spanish populations did not demonstrate an association with AD susceptibility [34,35], a study in a Turkish population [15] showed a markedly increased risk in carriers of the VDR rs1544410 alternative genotype. In contrast, other studies found no association with clinical characteristics of AD [14,33]. Our results suggest that this SNP may have a role in serum 25(OH)D levels rather than disease susceptibility. VDR rs2228570 is a functional polymorphism located at the translation initiation site, resulting in an alternative VDR protein isoform that may modify receptor activity and downstream immune signaling [19]. Some studies have reported associations with AD susceptibility and IgE levels [34], but others did not observe significant relationships with disease occurrence or clinical features [15,33]. These discrepancies may reflect population-specific genetic backgrounds, environmental effects, and differences in study design. In our study, no significant association was identified, suggesting that rs2228570 may have a modest or situation-dependent role in AD rather than a direct effect on disease susceptibility or clinical manifestation.
Lastly, VDR rs11168293 has been linked to immune regulation in previous studies, where this SNP was associated with higher levels of IL-10 [16], eosinophil counts, and total IgE level [14]. Our findings of an association with eosinophilia are consistent with these observations and further support the role of the VDR rs11168293 polymorphism in modulating allergic inflammation. This may be explained by the role of VDR signaling in type 2 immune responses, where genetic variation could influence cytokine expression and eosinophil activation.
Among the studied variants, rs2228570 is a functional polymorphism. In contrast, rs1544410, rs7975232, and rs731236 are in the 3′ region of the VDR gene, suggesting that their effects may be mediated through regulatory mechanisms influencing mRNA stability or VDR expression levels. Similarly, rs3847987 and rs11168293 are intronic variants that are unlikely to directly affect protein structure but may act as regulatory polymorphisms or proxy markers for functional elements involved in transcriptional regulation, chromatin accessibility, or enhancer activity [36,37,38,39]. Through these mechanisms, genetic variation in VDR may modulate receptor expression, availability, and transcriptional efficiency, thereby influencing downstream target gene expression, including CYP24A1, a key enzyme involved in vitamin D catabolism, thereby contributing to interindividual differences in vitamin D metabolism and homeostasis [40,41].
A principal strength of this study is the comprehensive evaluation of multiple VDR polymorphisms in relation to both vitamin D status and clinically relevant inflammatory biomarkers within a well-defined adult AD population. In contrast to previous studies conducted in broader atopic cohorts [16,18], this investigation specifically addresses AD as a distinct clinical entity, thereby providing more targeted insight into disease-related mechanisms. Furthermore, our findings extend previous research by demonstrating that VDR polymorphisms may influence biological pathways relevant to AD, even in the absence of a direct association with disease occurrence. Several limitations should be acknowledged. First, the relatively small sample size may have limited the statistical power to detect associations between the investigated VDR polymorphisms and AD. Given the available sample size, the study had sufficient power to detect moderate-to-large effect sizes, but smaller genetic effects may have gone undetected. As a result, the lack of significant associations with AD susceptibility should be interpreted cautiously, especially for complex polygenic traits like AD. Achieving adequate statistical power (>80%) would likely require larger effect sizes (OR ≥ 1.7–2.0), which are uncommon in complex diseases. Second, only six polymorphisms within the VDR gene were analyzed, while other variants involved in vitamin D metabolism, including those related to synthesis, transport, and degradation, were not assessed and may also influence serum 25(OH)D levels and immune responses. We performed several statistical comparisons, which could have raised the chance of type I error. To address this, we used the Benjamini–Hochberg method for false-discovery rate (FDR) correction as a sensitivity analysis. Since this was an exploratory study focused on identifying possible genetic associations rather than providing final proof, we examined both nominal and FDR-adjusted p-values. After FDR correction, none of the associations stayed statistically significant. Because our sample size was small and the genetic models were related, the FDR method might have been overly strict, increasing the risk of type II error. For these reasons, our findings should be seen as exploratory, and we report FDR-adjusted results to be transparent and thorough. Third, environmental factors that may influence serum 25(OH)D concentrations, including dietary intake and sunlight exposure, were not controlled in the present study. Seasonal variation in sunlight exposure during the blood collection period was not accounted for, which may have contributed to variability in vitamin D levels independently of VDR genetic variation. This is particularly relevant in high-latitude regions such as Lithuania, where sunlight exposure changes markedly across seasonal fluctuations in UV radiation which may substantially limit cutaneous vitamin D synthesis during much of the year. Furthermore, local dietary patterns and variability in the consumption of vitamin D-rich or fortified foods may also affect serum 25(OH)D concentrations [21,22]. These regional factors may modify the association between VDR polymorphisms and vitamin D status in this cohort. Additionally, key Th2 cytokines, including IL-4, IL-5, and IL-13, were not evaluated in this study. Future investigations incorporating cytokine profiling may provide a more comprehensive understanding of the relationship between VDR polymorphisms and immune dysregulation in AD. Despite these limitations, this study provides new insights into the relationship between VDR polymorphisms, serum 25(OH)D status, and biomarkers in adults with AD from the Baltic region, where genetic studies on this topic remain limited.
This study did not identify a significant association between the investigated VDR polymorphisms and AD susceptibility in Lithuanian adults. However, several variants showed significant relationships with biological markers relevant to disease activity: rs731236 and rs1544410 were associated with higher odds of sufficient serum 25(OH)D levels, rs7975232 with lower odds of vitamin D sufficiency, and rs11168293 with eosinophilia. These results suggest that VDR genetic variation may act more as a modifier of disease-related biomarkers and phenotype expression than as a primary driver of AD susceptibility. Clinically, these variants may account for interindividual differences in vitamin D status and immune responses among adults with AD. Further multicenter studies with adequate statistical power are required to confirm these data.

4. Materials and Methods

4.1. Study Population

A total of 193 participants (91 patients with AD and 102 controls) were enrolled in this case–control study. Patients were recruited at the Department of Skin and Venereal Diseases, Hospital of the Lithuanian University of Health Sciences Kauno Klinikos, from 2022 to 2024. Diagnosis of AD was confirmed according to the Hanifin and Rajka criteria by one dermatovenereologist (K.B.). The study was approved by the Kaunas Regional Biomedical Research Ethics Committee (No. BE-2-74). A blank informed consent form is provided in the Supplementary Materials. The inclusion criteria for the case group were a confirmed diagnosis of AD, age 18–60 years, no use of systemic immunosuppressive medications for at least 1 month prior to study enrolment, no use of vitamin D supplements for at least three months prior to enrolment, and absence of malignant disease, autoimmune disorders, chronic or acute infections. Exclusion criteria were age <18 years or >60 years, use of systemic immunosuppressive medications within 1 month prior to examination, presence of malignancy, autoimmune disease, chronic or acute infections, participation in other clinical trials and refusal or inability to provide informed consent due to psychological or other reasons. The control group included individuals without a history of AD. In addition, participants completed a structured questionnaire on chronic diseases, including questions about physician-diagnosed allergic conditions such as asthma, allergic rhinitis, and other atopy-related disorders. They were selected from respondents (N = 3426) who participated in the epidemiological health survey entitled “Chronic Diseases and Their Risk Factors in the Adult Population,” conducted in Kaunas, Lithuania. Eligibility criteria included age of 25 years or older, willingness to participate in the biomedical study, and absence of AD as confirmed by dermatological examination. Exclusion criteria applied to both case and control groups. These included severe systemic diseases, mental disorders that impaired understanding or participation, pregnancy, or lactation. Individuals who declined participation or withdrew consent during the study were also excluded.

4.2. Clinical Examination

All participants underwent an objective examination, including anthropometric measurements [42] and skin examination using both qualitative criteria of AD according to Hanifin and Rajka [43]. For subjects in the case group, the Scoring Atopic Dermatitis (SCORAD) index was used to assess AD severity and severity categories (mild, moderate, severe) were defined according to established interpretation guidelines, with cut-offs of <25, 25–50, and >50, respectively [44]. All SCORAD assessments were performed by the same dermatovenereolologist (the co-author K.B.) throughout the study to ensure consistency.

4.3. Blood Sampling and Sample Processing

Peripheral venous blood samples were obtained from all participants under standard conditions. Blood samples intended for genetic analysis and eosinophil count determination were collected in tubes containing the anticoagulant ethylenediaminetetraacetic acid (K3-EDTA). Samples for biochemical analyses, including serum 25-hydroxyvitamin D and total IgE concentrations, were collected in serum separation tubes (SSTs). Each specimen was assigned a unique identification code to ensure anonymization and accurate linkage between biological samples and clinical data. Serum tubes were centrifuged at 3500 rpm for 10 min, after which the serum fraction was separated and stored at −80 °C until further laboratory analysis.

4.4. Laboratory Measurements

Serum concentrations of vitamin D (25-hydroxyvitamin D, 25(OH)D) were determined using a commercially available enzyme-linked immunosorbent assay (ELISA) kit with a commercially available kit (BioVendor, Brno, Czech Republic). The inter-assay coefficient of variation (CV) for the assay was approximately 20%, and the analytical detection limit was 2.81 ng/mL. Vitamin D status was categorized as deficiency (<20 ng/mL), insufficiency (20–30 ng/mL), sufficient levels (30–50 ng/mL), and high levels (>50 ng/mL), according to commonly used clinical thresholds.
Peripheral blood eosinophil counts were measured using an automated hematology analyzer (Sysmex, Kobe, Japan). Serum total IgE concentrations were quantified using a commercially available ELISA kit (IBL International, Hamburg, Germany). The inter-assay coefficient of variation was 4.1%, and the assay detection limit was 0.8 IU/mL. Based on the manufacturer’s recommendations, total IgE levels below 100 IU/mL were considered within the normal range for adults.

4.5. DNA Extraction and SNP Genotyping

Genomic DNA extraction was performed using a QIAamp DNA blood mini kit (Qiagen, Hilden, Germany; Cat#51104). DNA concentration and purity were analyzed by Multiskan SkyHigh Microplate Spectrophotometer (Thermo Scientific, Waltham, MA, USA; Cat#A51119600DPC) and stored at −20 °C. Six SNPs (rs3847987, rs731236, rs7975232, rs1544410, rs2228570, and rs11168293) in the VDR gene were genotyped by using the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA; Cat#A28137). Table 9 lists the TaqMan SNP genotyping assay IDs used for the analysis. The provided genotyping assays were combined with TaqMan® Universal Master Mix II with UNG (Applied Biosystems, Foster City, CA, USA), nuclease-free water, and genomic DNA. The reaction mixtures were incubated with a pre-read step at 60 °C for 30 s, followed by an initial denaturation at 95 °C for 10 min. This was followed by 40 amplification cycles consisting of 95 °C for 15 s and 60 °C for 1 min, with a post-read step at 60 °C for 30 s.

4.6. Statistical Analysis

Statistical Package for Social Sciences (IBM SPSS Statistics 30.0.0.0) software was used for statistical data analysis. Data normality was assessed using the Kolmogorov–Smirnov and Shapiro–Wilk tests depending on group size. Non-parametric data are presented as medians together with minimum–maximum values. The Mann–Whitney U and Kruskal–Wallis tests were used for comparing the data between groups. The assessment of Hardy–Weinberg equilibrium (HWE) was performed by a goodness-of-fit Chi-square test. Categorical variables were compared using the Chi-square test or Fisher’s exact test when expected cell counts were small. Logistic regression analyses were conducted to determine associations between analyzed polymorphisms in the VDR gene and AD. Moreover, association analyses were performed to assess the relationship between VDR gene polymorphisms and serum 25(OH)D-level groups, total IgE levels, and blood eosinophil counts. Correction for multiple testing was performed separately for each analyzed outcome (AD susceptibility, serum 25(OH)D level, IgE level, and eosinophil count) to control for the number of tests performed within each set of related hypotheses. For each outcome, p-values obtained from logistic regression analyses across all tested SNPs and genetic models were adjusted using the Benjamini–Hochberg false-discovery rate (FDR) method. The p-values, odds ratios (ORs), and 95% confidence intervals (CIs) were reported to quantify the strength of the associations.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27104217/s1.

Author Contributions

Conceptualization, K.B., B.G. and S.V.; methodology, K.B. and S.V.; software, A.B.; validation, K.B., D.P., A.B. and J.L.; formal analysis, K.B. and A.B.; investigation, K.B. and D.P.; resources, K.B. and S.V.; data curation, K.B., A.B. and J.L.; writing—original draft preparation, K.B.; writing—review and editing, K.B., B.G., R.U., D.L., V.T. and S.V.; visualization, K.B. and A.B.; supervision, B.G. and S.V.; project administration, B.G. and S.V.; funding acquisition, K.B., D.P., B.G. and S.V. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported in part by the Research Council of Lithuania (project reg. no. S-LLT-20-1, P-LLT-20-4), the Research Foundation of the Lithuanian University of Health Sciences, and the Kaunas Regional Association of Dermatovenereologists. The publication fee was funded by the Lithuanian University of Health Sciences, Kaunas, Lithuania.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Kaunas Regional Biomedical Research Ethics Committee, Lithuanian University of Health Sciences (protocol code BE-2-74; approved on 8 July 2020).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We thank Lukas Šemeklis, Augustė Dubinskaitė, Justė Katkauskaitė, and Ona Rūta Šereivienė for their contributions to this study.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Langan, S.M.; Irvine, A.D.; Weidinger, S. Atopic Dermatitis. Lancet 2020, 396, 345–360. [Google Scholar] [CrossRef] [PubMed]
  2. Eisen, M.; Gradauskiene, B.; Grigaitiene, J.; Hartmane, I.; Kingo, K.; Mikazans, I.; Raam, L.; Toomela, K. Burden of Disease and Treatment Patterns in Adults with Atopic Dermatitis from the Baltic Region: Real-World Data from the ESSENTIAL AD Cross-Sectional Study. Medicina 2025, 62, 84. [Google Scholar] [CrossRef] [PubMed]
  3. Ramírez-marín, H.A.; Silverberg, J.I. Differences Between Pediatric and Adult Atopic Dermatitis. Pediatr. Dermatol. 2022, 39, 345–353. [Google Scholar] [CrossRef]
  4. Ng, J.C.; Yew, Y.W. Effect of Vitamin D Serum Levels and Supplementation on Atopic Dermatitis: A Systematic Review and Meta-analysis. Am. J. Clin. Dermatol. 2022, 23, 267–275. [Google Scholar] [CrossRef]
  5. Li, Q.; Chan, H. Vitamin D and Skin Disorders: Bridging Molecular Insights to Clinical Innovations. Mol. Med. 2025, 31, 259. [Google Scholar] [CrossRef]
  6. El Abd, A.; Dasari, H.; Dodin, P.; Trottier, H.; Ducharme, F.M. Associations Between Vitamin D Status and Biomarkers Linked with Inflammation in Patients with Asthma: A Systematic Review and Meta-Analysis of Interventional and Observational Studies. Respir. Res. 2024, 25, 344. [Google Scholar] [CrossRef] [PubMed]
  7. Hernández-Colín, D.D.; Bedolla-Barajas, M.; Morales-Romero, J.; Robles-Figueroa, M.; Bedolla-Pulido, A.; Arroyo-Sánchez, N.D.R. Serum Vitamin D Is Inversely Associated with Blood Eosinophil Count Among Adults with Allergic Asthma. Thorac. Res. Pract. 2023, 24, 208. [Google Scholar] [CrossRef]
  8. Przechowski, K.; Krawczyk, M.N.; Krasowski, R.; Pawliczak, R.; Kleniewska, P. Vitamin D and Atopic Dermatitis—A Mere Correlation or a Real Supportive Treatment Option? Nutrients 2025, 17, 2582. [Google Scholar] [CrossRef]
  9. Zeng, Y.; Yang, S.; Liu, Y.; Tang, Z.; Zong, X.; Li, X.; Wang, D. The Role of VD/VDR Signaling Pathway in Autoimmune Skin Diseases. Mini Rev. Med. Chem. 2023, 23, 652–661. [Google Scholar] [CrossRef]
  10. Blady, K.; Pomianowski, B.; Strugała, M.; Smółka, L.; Kursa, K.; Stanek, A. Vitamin D in Atopic Dermatitis: Role in Disease and Skin Microbiome. Nutrients 2025, 17, 3584. [Google Scholar] [CrossRef]
  11. Zhang, L.; Zhang, S.; He, C.; Wang, X. VDR Gene Polymorphisms and Allergic Diseases: Evidence from a Meta-analysis. Immunol. Investig. 2020, 49, 166–177. [Google Scholar] [CrossRef] [PubMed]
  12. Usategui-Martín, R.; De Luis-Román, D.; Fernández-Gómez, J.M.; Ruiz-Mambrilla, M.; Pérez-Castrillón, J. Vitamin D Receptor (VDR) Gene Polymorphisms Modify the Response to Vitamin D Supplementation: A Systematic Review and Meta-Analysis. Nutrients 2022, 14, 360. [Google Scholar] [CrossRef]
  13. Heine, G.; Hoefer, N.; Franke, A.; Nöthling, U.; Schumann, R.R.; Hamann, L.; Worm, M. Association of Vitamin D Receptor Gene Polymorphisms with Severe Atopic Dermatitis in Adults. Br. J. Dermatol. 2013, 168, 855–858. [Google Scholar] [CrossRef] [PubMed]
  14. Bastyte, D.; Tamasauskiene, L.; Stakaitiene, I.; Ugenskiene, R.; Gradauskiene, B. The Association of Vitamin D Receptor Gene Polymorphisms with Vitamin D, Total IgE, and Blood Eosinophils in Patients with Atopy. Biomolecules 2024, 14, 212. [Google Scholar] [CrossRef]
  15. Kılıç, S.; Sılan, F.; Hız, M.; Işık, S.; Ögretmen, Z.; Özdemir, Ö. Vitamin D Receptor Gene BSMI, FOKI, APAI, and TAQI Polymorphisms and the Risk of Atopic Dermatitis. J. Investig. Allergol. Clin. Immunol. 2016, 26, 106–110. [Google Scholar] [CrossRef]
  16. Bastyte, D.; Tamasauskiene, L.; Stakaitiene, I.; Briede, K.; Ugenskiene, R.; Valiukeviciene, S.; Gradauskiene, B. Relation of T Cell Profile with Vitamin D Receptor and Vitamin D-Binding Protein Gene Polymorphisms in Atopy. Int. J. Mol. Sci. 2024, 25, 9021. [Google Scholar] [CrossRef] [PubMed]
  17. Bastyte, D.; Tamasauskiene, L.; Golubickaite, I.; Ugenskiene, R.; Sitkauskiene, B. Vitamin D Receptor and Vitamin D Binding Protein Gene Polymorphisms in Patients with Asthma: A Pilot Study. BMC Pulm. Med. 2023, 23, 288, Erratum for BMC Pulm. Med. 2023, 23, 245. [Google Scholar] [CrossRef]
  18. Rojo-Tolosa, S.; Márquez-Pete, N.; Gálvez-Navas, J.M.; Pineda-Lancheros, L.E.; Fernández-Alonso, A.; Membrive-Jiménez, C.; Ramírez-Tortosa, M.C.; Pérez-Ramírez, C.; Jiménez-Morales, A. Single Nucleotide Polymorphisms in the Vitamin D Metabolic Pathway and Their Relationship with High Blood Pressure Risk. Int. J. Mol. Sci. 2023, 24, 5974. [Google Scholar] [CrossRef]
  19. Valdivielso, J.M.; Fernandez, E. Vitamin D Receptor Polymorphisms and Diseases. Clin. Chim. Acta 2006, 371, 1–12. [Google Scholar] [CrossRef]
  20. O’Neill, C.M.; Kazantzidis, A.; Ryan, M.J.; Barber, N.; Sempos, C.T.; Durazo-Arvizu, R.A.; Jorde, R.; Grimnes, G.; Eiriksdottir, G.; Gudnason, V.; et al. Seasonal Changes in Vitamin D-Effective UVB Availability in Europe and Associations with Population Serum 25-Hydroxyvitamin D. Nutrients 2016, 8, 533. [Google Scholar] [CrossRef]
  21. Amrein, K.; Scherkl, M.; Hoffmann, M.; Neuwersch-Sommeregger, S.; Köstenberger, M.; Tmava Berisha, A.; Martucci, G.; Pilz, S.; Malle, O. Vitamin D Deficiency 2.0: An Update on the Current Status Worldwide. Eur. J. Clin. Nutr. 2020, 74, 1498–1513. [Google Scholar] [CrossRef]
  22. Chauhan, K.; Shahrokhi, M.; Huecker, M.R. Vitamin D. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
  23. Kaur, J.; Khare, S.; Givler, A. Vitamin D Deficiency. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2026. [Google Scholar]
  24. Holick, M.F.; Binkley, N.C.; Bischoff-Ferrari, H.A.; Gordon, C.M.; Hanley, D.A.; Heaney, R.P.; Murad, M.H.; Weaver, C.M. Guidelines for Preventing and Treating Vitamin D Deficiency and Insufficiency Revisited. J. Clin. Endocrinol. Metab. 2012, 97, 1153–1158. [Google Scholar] [CrossRef]
  25. Płudowski, P.; Karczmarewicz, E.; Bayer, M.; Carter, G.; Chlebna-Sokół, D.; Czech-Kowalska, J.; Dębski, R.; Decsi, T.; Dobrzańska, A.; Franek, E.; et al. Practical Guidelines for the Supplementation of Vitamin D and the Treatment of Deficits in Central Europe—Recommended Vitamin D Intakes in the General Population and Groups at Risk of Vitamin D Deficiency. Endokrynol. Pol. 2013, 64, 319–327. [Google Scholar] [CrossRef]
  26. Bauer, P.; Henni, S.; Dörr, O.; Bauer, T.; Hamm, C.W.; Most, A. High Prevalence of Vitamin D Insufficiency in Professional Handball Athletes. Physician Sportsmed. 2019, 47, 71–77. [Google Scholar] [CrossRef] [PubMed]
  27. Kardelen, A.D.; Yildiz, I.; Omer, B.; Oguz, F. Serum 25(OH) Vitamin D Levels of Adolescent and Young Medical Students. Int. J. Pediatr. Res. 2018, 4, 032. [Google Scholar] [CrossRef]
  28. Kanuru, S.; Sapra, A. Eosinophilia. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2026. [Google Scholar]
  29. Benson, V.S.; Hartl, S.; Barnes, N.; Galwey, N.; Van Dyke, M.K.; Kwon, N. Blood eosinophil counts in the general population and airways disease: A comprehensive review and meta-analysis. Eur. Respir. J. 2022, 59, 2004590. [Google Scholar] [CrossRef]
  30. Tang, M.; Charbit, A.R.; Johansson, M.W.; Jarjour, N.N.; Denlinger, L.C.; Raymond, W.W.; Peters, M.C.; Dunican, E.M.; Castro, M.; Sumino, K.; et al. Utility of eosinophil peroxidase as a biomarker of eosinophilic inflammation in asthma. J. Allergy Clin. Immunol. 2024, 154, 580–591.e6. [Google Scholar] [CrossRef] [PubMed]
  31. Nemet, S.; Elbirt, D.; Cohen, R.; Mahlab-Guri, K.; Bezalel-Rosenberg, S.; Asher, I.; Talmon, A.; Rubin, L.; Ribak, Y.; Sergienko, R.; et al. Clinical Significance of Very High IgE Levels (≥1000 IU/mL): Population-Based Study of 118,211 Adults. J. Allergy Clin. Immunol. Glob. 2025, 4, 100403. [Google Scholar] [CrossRef]
  32. Wittig, H.J.; Belloit, J.; De Fillippi, I.; Royal, G. Age-related Serum Immunoglobulin E Levels in Healthy Subjects and in Patients with Allergic Disease. J. Allergy Clin. Immunol. 1980, 66, 305–313. [Google Scholar] [CrossRef]
  33. Grieco, T.; Moliterni, E.; Paolino, G.; Chello, C.; Sernicola, A.; Egan, C.G.; Nannipieri, F.; Battaglia, S.; Accoto, M.; Tirotta, E.; et al. Association between Vitamin D Receptor Polymorphisms, Tight Junction Proteins and Clinical Features of Adult Patients with Atopic Dermatitis. Dermatol. Pract. Concept. 2024, 14, e2024214. [Google Scholar] [CrossRef] [PubMed]
  34. Ou, Y.; Jiang, X.; Guan, H. Vitamin D Receptor Gene Polymorphisms and Risk of Atopic Dermatitis in Chinese Han Population. Int. J. Gen. Med. 2021, 14, 5301. [Google Scholar] [CrossRef] [PubMed]
  35. González-Tarancón, R.; Goñi-Ros, N.; Salvador-Rupérez, E.; Hernández-Martín, Á.; Izquierdo-Álvarez, S.; Puzo-Foncillas, J.; Gilaberte-Calzada, Y. Association Between VDR and CYP24A1 Polymorphisms, Atopic Dermatitis, and Biochemical Lipid and Vitamin D Profiles in Spanish Population: Case-Control Study. JMIR Dermatol. 2023, 6, e39567. [Google Scholar] [CrossRef]
  36. Kerr Whitfield, G.; Remus, L.S.; Jurutka, P.W.; Zitzer, H.; Oza, A.K.; Dang, H.T.L.; Haussler, C.A.; Galligan, M.A.; Thatcher, M.L.; Dominguez, C.E.; et al. Functionally Relevant Polymorphisms in the Human Nuclear Vitamin D Receptor Gene. Mol. Cell. Endocrinol. 2001, 177, 145–159. [Google Scholar] [CrossRef] [PubMed]
  37. Uitterlinden, A.G.; Fang, Y.; Van Meurs, J.B.J.; Pols, H.A.P.; Van Leeuwen, J.P.T.M. Genetics and Biology of Vitamin D Receptor Polymorphisms. Gene 2004, 338, 143–156. [Google Scholar] [CrossRef]
  38. Arai, H.; Miyamoto, K.; Taketani, Y.; Yamamoto, H.; Iemori, Y.; Morita, K.; Tonai, T.; Nishisho, T.; Mori, S.; Takeda, E. A Vitamin D Receptor Gene Polymorphism in the Translation Initiation Codon: Effect on Protein Activity and Relation to Bone Mineral Density in Japanese Women. J. Bone Miner. Res. 1997, 12, 915–921. [Google Scholar] [CrossRef] [PubMed]
  39. Zmuda, J.M.; Cauley, J.A.; Ferrell, R.E. Molecular Epidemiology of Vitamin D Receptor Gene Variants. Epidemiol. Rev. 2000, 22, 203–217. [Google Scholar] [CrossRef]
  40. Karrow, N.A.; Leuschner, S.E.; Shandilya, U.K.; Mallard, B.A.; Wagter-Lesperance, L.; Bridle, B.W. Genetic Variants Influencing Individual Vitamin D Status. Nutrients 2025, 17, 2673. [Google Scholar] [CrossRef]
  41. Barry, E.L.; Rees, J.R.; Peacock, J.L.; Mott, L.A.; Amos, C.I.; Bostick, R.M.; Figueiredo, J.C.; Ahnen, D.J.; Bresalier, R.S.; Burke, C.A.; et al. Genetic Variants in CYP2R1, CYP24A1, and VDR Modify the Efficacy of Vitamin D3 Supplementation for Increasing Serum 25-hydroxyvitamin D Levels in a Randomized Controlled Trial. J. Clin. Endocrinol. Metab. 2014, 99, 2133. [Google Scholar] [CrossRef]
  42. World Health Organization. WHO STEPS Surveillance Manual: The WHO STEPwise Approach to Noncommunicable Disease Risk Factor Surveillance. Last updated 26 January 2017. Available online: https://www.who.int/docs/default-source/ncds/ncd-surveillance/steps/steps-manual.pdf (accessed on 4 May 2026).
  43. Hanifin, J.M.; Rajka, G. Diagnostic Features of Atopic Dermatitis. Acta Derm.-Venereol. 1980, 60, 44–47. [Google Scholar] [CrossRef]
  44. Kunz, B.; Oranje, A.P.; Labrèze, L.; Stalder, J.F.; Ring, J.; Taïeb, A. Clinical Validation and Guidelines for the SCORAD Index: Consensus Report of the European Task Force on Atopic Dermatitis. Dermatology 1997, 195, 10–19. [Google Scholar] [CrossRef]
Table 1. General demographic characteristics of study participants with atopic dermatitis (n = 91) and control (n = 102) groups.
Table 1. General demographic characteristics of study participants with atopic dermatitis (n = 91) and control (n = 102) groups.
CharacteristicsNumber, n (%)GenderAge
Male, n (%)Female, n (%)p-ValueYears, Median (Min–Max)p-Value
Controls 102 (100.0)36 (35.3)66 (64.7)0.49828 (23–45)0.068
AD patients91 (100.0)27 (29.7)64 (70.3)27 (18–59)
AD—atopic dermatitis.
Table 2. Clinical profile of the atopic dermatitis (AD) group (n = 91).
Table 2. Clinical profile of the atopic dermatitis (AD) group (n = 91).
VariablesDistribution, n (%)
AD symptom onset, n (%)
Early onset (0 to <5 years old) 48 (52.7)
Childhood (5 to <18 years old) 21 (23.1)
Adult (18 years old) 22 (24.2)
Asthma, n (%)
Present 20 (22.0)
Absent 71 (78.0)
Rhinitis, n (%)
Present 22 (24.2)
Absent 69 (75.8)
Conjunctivitis, n (%)
Present 19 (20.9)
Absent 72 (79.1)
Severity of AD by SCORAD index, n (%)
Mild (<25) 32 (35.2)
Moderate (25–50) 33 (36.3)
Severe (>50) 26 (28.6)
Dermatology life quality index (DLQI), median (min–max)8 (0–28)
Body mass index (BMI) (kg/m2), n (%)
Underweight (≤18.5)5 (5.5)
Normal weight (18.5–24.9)58 (63.7)
Overweight (25–29.9)18 (19.8)
Obesity (≥30)10 (11.0)
Total IgE (kU/L), median (min–max)90.17 (3.00–13,739.50)
Blood eosinophils count (% of leukocytes), median (min–max)3.80 (0.00–37.90)
Blood eosinophils count (x109/L), median (min–max)0.20 (0.00–3.00)
Serum 25(OH)D level (ng/mL), median (min–max)27.42 (3.87–107.46)
Deficiency (<20 ng/mL) 21 (23.1)
Insufficiency (20–30 ng/mL) 30 (33.0)
Normal (30–50 ng/mL) 29 (31.9)
High (>50 ng/mL) 11 (12.1)
AD—atopic dermatitis; SCORAD—Scoring Atopic Dermatitis; IgE—immunoglobulin E; 25(OH)D—25-hydroxyvitamin D.
Table 3. Serum 25(OH)D levels, total IgE levels, and blood eosinophils in patients with different courses of AD.
Table 3. Serum 25(OH)D levels, total IgE levels, and blood eosinophils in patients with different courses of AD.
CharacteristicsSerum 25(OH)D Level (ng/mL)p-ValueTotal IgE Level (kU/L)p-ValueEosinophils Count (Cells/μL)p-Value
Male (n = 27)25.10 (3.87–107.46)0.126127.48 (3.50–13,739.50)0.089300 (100–3000)0.763
Female (n = 64)29.18 (6.01–81.33)73.58 (3.00–9763.30)200 (0–1400)
SCORAD—Mild (<25) (n = 32)27.95 (6.01–81.33)0.97838.90 (3.00–819.00)<0.001150 (100–1000)<0.001
SCORAD—Moderate (25–50) (n = 33)28.63 (11.75–64.20)60.10 (3.00–6766.50)200 (0–800)
SCORAD—Severe (>50) (n = 26)27.32 (3.87–107.46)1064.80 (18.79–13,739.50)600 (100–3000)
25(OH)D—25-hydroxyvitamin D; IgE—immunoglobulin E; SCORAD—Scoring Atopic Dermatitis. Results are presented as median (minimum–maximum) values. Bold represents statistically significant values.
Table 4. Genotype analysis of VDR gene polymorphisms in AD patients (n = 91) and controls (n = 102).
Table 4. Genotype analysis of VDR gene polymorphisms in AD patients (n = 91) and controls (n = 102).
SNPGenotype/AlleleAD Patients, n (%)Controls, n (%)p-ValueOR (95% CI)p-ValueAdjusted p-Value
rs3847987CC72 (79.1)83 (81.4)0.7811.000
CA19 (20.9)18 (17.6)1.217 (0.594–2.494)0.592 0.874
AA0 (0.0)1 (1.0)N/A
CA + AA19 (20.9)19 (18.6)0.8331.153 (0.567–2.345)0.695 0.874
C163 (89.6)184 (90.2)0.8901.000
A19 (10.4)20 (9.8)1.072 (0.553–2.080)0.836
rs731236AA38 (41.8)40 (39.2)0.7891.000
AG41 (45.1)45 (44.1)0.959 (0.519–1.771)0.894 0.894
GG12 (13.2)17 (16.7)0.743 (0.314–1.760)0.500 0.874
AG + GG53 (58.2)62 (60.8)0.8320.900 (0.506–1.600)0.719 0.874
A117 (64.3)125 (61.3)0.9061.000
G65 (35.7)79 (38.7)0.879 (0.581–1.330)0.542 0.874
rs7975232AA20 (22.0)26 (25.5)0.8421.000
AC46 (50.5)50 (49.0)1.196 (0.590–2.426)0.620 0.874
CC25 (27.5)26 (25.5)1.250 (0.561–2.784)0.585 0.874
AC + CC71 (78.0)76 (74.5)0.6871.214 (0.624–2.366)0.568 0.874
A86 (47.3)102 (50.0)0.9031.000
C96 (52.7)102 (50.0)1.116 (0.748–1.665)0.590 0.874
rs1544410CC38 (41.8)39 (38.2)0.7831.000
CT40 (44.0)45 (44.1)0.912 (0.492–1.691)0.771 0.874
TT13 (14.3)18 (17.6)0.741 (0.319–1.720)0.486 0.874
CT + TT53 (58.2)63 (61.8)0.7250.863 (0.485–1.538)0.618 0.874
C116 (63.7)123 (60.3)0.8271.000
T66 (36.3)81 (39.7)0.864 (0.572–1.305)0.487 0.874
rs2228570GG27 (29.7)34 (33.3)0.8191.000
GA44 (48.4)45 (44.1)1.231 (0.640–2.368)0.533 0.874
AA20 (22.0)23 (22.5)1.095 (0.500–2.398)0.820 0.874
GA + AA64 (70.3)68 (66.7)0.6961.185 (0.644–2.181)0.585 0.874
G98 (53.8)113 (55.4)0.8651.000
A84 (46.2)91 (44.6)1.064 (0.712–1.590)0.761 0.874
rs11168293GG39 (42.9)32 (31.4)0.2551.000
GT39 (42.9)52 (51.0)0.615 (0.329–1.150)0.128 0.874
TT13 (14.3)18 (17.6)0.593 (0.253–1.390)0.229 0.874
GT + TT52 (57.1)70 (68.6)0.1330.610 (0.338–1.099)0.100 0.874
G117 (64.3)116 (56.9)0.2081.000
T65 (35.7)88 (43.1)0.732 (0.486–1.104)0.137 0.874
SNP—single-nucleotide polymorphism; AD—atopic dermatitis; OR—odds ratio; CI—confidence interval; N/A—not available; adjusted p-value refers to p-values corrected for multiple comparisons using the Benjamini–Hochberg false-discovery rate (FDR) approach.
Table 5. Association between serum 25(OH)D-level groups (≤30 and >30 ng/mL) and VDR gene polymorphisms.
Table 5. Association between serum 25(OH)D-level groups (≤30 and >30 ng/mL) and VDR gene polymorphisms.
SNPGenotype/Allele≤30 ng/mL, n (%)>30 ng/mL, n (%)p-ValueOR (95% CI)p-ValueAdjusted p-Value
rs3847987CC41 (80.4)31 (77.5)0.7361.000
CA10 (19.6)9 (22.5)1.190 (0.432–3.282)0.736 0.824
AA0 (0.0)0 (0.0)N/A
CA + AA10 (19.6)9 (22.5)0.9391.190 (0.432–3.282)0.736 0.824
C92 (90.2)71 (88.8)0.9421.000
A10 (9.8)9 (11.3)1.166 (0.450–3.022)0.752 0.824
rs731236AA25 (49.0)13 (32.5)0.1311.000
AG22 (43.1)19 (47.5)1.661 (0.669–4.121)0.274 0.473
GG4 (7.8)8 (20.0)3.846 (0.973–15.207)0.055 0.181
AG + GG26 (51.0)27 (67.5)0.1701.997 (0.845–4.718)0.115 0.240
A72 (70.6)45 (56.3)0.0651.000
G30 (29.4)35 (43.8)1.867 (1.011–3.448)0.046 0.176
rs7975232AA7 (13.7)13 (32.5)0.0751.000
AC27 (52.9)19 (47.5)0.379 (0.127–1.127)0.081 0.233
CC17 (33.3)8 (20.0)0.253 (0.073–0.880)0.031 0.166
AC + CC44 (86.3)27 (67.5)0.0590.330 (0.117–0.931)0.036 0.166
A41 (40.2)45 (56.3)0.0451.000
C61 (59.8)35 (43.8)0.523 (0.289–0.946)0.032 0.166
rs1544410CC25 (49.0)13 (32.5)0.0881.000
CT22 (43.1)18 (45.0)1.573 (0.630–3.928)0.332 0.509
TT4 (7.8)9 (22.5)4.327 (1.116–16.776)0.034 0.166
CT + TT26 (51.0)27 (67.5)0.1701.997 (0.845–4.718)0.115 0.240
C72 (70.6)44 (55.0)0.0441.000
T30 (29.4)36 (45.0)1.964 (1.064–3.624)0.031 0.166
rs2228570GG17 (33.3)10 (25.0)0.5211.000
GA22 (43.1)22 (55.0)1.700 (0.638–4.527)0.288 0.473
AA12 (23.5)8 (20.0)1.133 (0.346–3.716)0.836 0.873
GA + AA34 (66.7)30 (75.0)0.5271.500 (0.596–3.774)0.389 0.559
G56 (54.9)42 (52.5)0.8631.000
A46 (45.1)38 (47.5)1.101 (0.612–1.981)0.747 0.824
rs11168293GG19 (37.3)20 (50.0)0.2071.000
GT25 (51.0)14 (32.5)0.475 (0.190–1.186)0.111 0.240
TT6 (11.8)7 (17.5)1.108 (0.315–3.901)0.873 0.873
GT + TT32 (62.7)20 (50.0)0.3140.594 (0.256–1.376)0.224 0.429
G64 (62.7)53 (66.3)0.7381.000
T38 (37.3)27 (33.8)0.858 (0.465–1.584)0.624 0.824
SNP—single-nucleotide polymorphism; N/A—not available; OR—odds ratio; CI—confidence interval; bold represents statistically significant values; adjusted p-value refers to p-values corrected for multiple comparisons using the Benjamini–Hochberg false-discovery rate (FDR) approach.
Table 6. The distribution of eosinophil count (cells/μL) according to VDR gene polymorphism genotypes and alleles.
Table 6. The distribution of eosinophil count (cells/μL) according to VDR gene polymorphism genotypes and alleles.
SNPHomozygous (Ref.), Cells/μLHeterozygous, Cells/μLHomozygous (Alt.), Cells/μLp-ValueAllele (Ref.), Cells/μLAllele (Alt.), Cells/μLp-Value
rs3847987CCCAAA0.335CA0.390
200 (0–1400)200 (100–3000)N/A200 (0–3000)200 (100–3000)
rs731236AAAGGG0.931AG0.644
200 (0–1000)300 (100–300)200 (100–1400)200 (0–3000)200 (100–3000)
rs7975232AAACCC0.772AC0.162
200 (100–3000)250 (100–1100)200 (0–1000)200 (100–3000)200 (0–1100)
rs1544410CCCTTT0.953CT0.554
200 (0–1000)250 (100–3000)200 (100–1400)200 (0–3000)200 (100–3000)
rs2228570GGGAAA0.712GA0.603
300 (0–1100)200 (100–3000)200 (100–900)200 (0–3000)200 (100–3000)
rs11168293GGGTTT0.105GT0.039
200 (100–1400)200 (0–1000)500 (100–3000)200 (0–1400)300 (0–3000)
SNP—single-nucleotide polymorphism; ref.—reference; alt.—alternative. Results are presented as median (minimum–maximum) values. Bold represents statistically significant values.
Table 7. Association between eosinophil count groups (≤300 and >300 cells/μL) and VDR gene polymorphisms.
Table 7. Association between eosinophil count groups (≤300 and >300 cells/μL) and VDR gene polymorphisms.
SNPGenotype/Allele≤300 Cells/μL>300 Cells/μLp-ValueOR (95% CI)p-ValueAdjusted p-Value
rs3847987CC45 (81.8)27 (75.0)0.4341.000
CA10 (18.2)9 (25.0)1.500 (0.541–4.156)0.436 0.995
AA0 (0.0)0 (0.0)N/A
CA + AA10 (18.2)9 (25.0)0.6041.500 (0.541–4.156)0.436 0.995
C100 (90.9)63 (87.5)0.6261.000
A10 (9.1)9 (12.5)1.429 (0.550–3.709)0.464 0.995
rs731236AA23 (41.8)15 (41.7)0.5001.000
AG23 (41.8)18 (50.0)1.200 (0.490–2.941)0.690 0.995
GG9 (16.4)3 (8.3)0.511 (0.119–2.200)0.367 0.995
AG + GG32 (58.2)21 (58.3)1.0001.006 (0.429–2.359)0.989 0.995
A69 (62.7)48 (66.7)0.7011.000
G41 (37.3)24 (33.3)0.841 (0.451–1.571)0.588 0.995
rs7975232AA13 (23.6)7 (19.4)0.7401.000
AC26 (47.3)20 (55.6)1.429 (0.481–4.241)0.521 0.995
CC16 (29.1)9 (25.0)1.045 (0.306–3.571)0.944 0.995
AC + CC42 (76.4)29 (80.6)0.8311.282 (0.456–3.605)0.637 0.995
A52 (47.3)34 (47.2)1.0001.000
C58 (52.7)38 (52.8)1.002 (0.553–1.817)0.995 0.995
rs1544410CC23 (41.8)15 (41.7)0.7541.000
CT23 (41.8)17 (47.2)1.133 (0.459–2.797)0.786 0.995
TT9 (16.4)4 (11.1)0.681 (0.177–2.617)0.576 0.995
CT + TT32 (58.2)21 (58.3)1.0001.006 (0.429–2.359)0.989 0.995
C69 (62.7)47 (65.3)0.8481.000
T41 (37.3)25 (34.7)0.895 (0.481–1.665)0.726 0.995
rs2228570GG16 (29.1)11 (30.6)0.6001.000
GA25 (45.5)19 (52.8)1.105 (0.418–2.923)0.840 0.995
AA14 (25.5)6 (16.7)0.623 (0.183–2.125)0.450 0.995
GA + AA39 (70.9)25 (69.4)1.0000.932 (0.373–2.333)0.881 0.995
G57 (51.8)41 (56.9)0.5991.000
A53 (48.2)31 (43.1)0.813 (0.447–1.479)0.498 0.995
rs11168293GG27 (49.1)12 (33.3)0.1411.000
GT23 (41.8)16 (44.4)1.565 (0.616–3.977)0.346 0.995
TT5 (9.1)8 (22.2)3.600 (0.973–13.316)0.055 0.633
GT + TT28 (50.9)24 (66.7)0.2051.929 (0.807–4.611)0.140 0.995
G77 (70.0)40 (55.6)0.0671.000
T33 (30.0)32 (44.4)1.867 (1.006–3.464)0.048 0.633
SNP—single-nucleotide polymorphism; OR—odds ratio; CI—confidence interval; N/A—not available. Bold represents statistically significant values; adjusted p-value refers to p-values corrected for multiple comparisons using the Benjamini–Hochberg false-discovery rate (FDR) approach.
Table 8. Association between IgE level groups (≤100 and >100 kU/L) and VDR gene polymorphisms.
Table 8. Association between IgE level groups (≤100 and >100 kU/L) and VDR gene polymorphisms.
SNPGenotype/Allele≤100 kU/L>100 kU/Lp-ValueOR (95% CI)p-ValueAdjusted p-Value
rs3847987CC36 (78.3)36 (80.0)1.0001.000
CA10 (21.7)9 (20.0)0.900 (0.327–2.476)0.838 0.848
AA0 (0.0)0 (0.0)N/A
CA + AA10 (21.7)9 (20.0)1.0000.900 (0.327–2.476)0.838 0.848
C82 (89.1)81 (90.0)1.0001.000
A10 (10.9)9 (10.0)0.911 (0.352–2.359)0.848 0.848
rs731236AA15 (32.6)23 (51.1)0.1611.000
AG25 (54.3)16 (35.6)0.417 (0.169–1.031)0.058 0.288
GG6 (13.0)6 (13.3)0.652 (0.177–2.406)0.521 0.725
AG + GG31 (67.4)22 (48.9)0.1150.463 (0.198–1.082)0.075 0.288
A55 (59.8)62 (68.9)0.2601.000
G37 (40.2)28 (31.1)0.671 (0.365–1.236)0.201 0.514
rs7975232AA14 (30.4)6 (13.3)0.1351.000
AC20 (43.5)26 (57.8)3.033 (0.990–9.297)0.052 0.288
CC12 (26.1)13 (28.9)2.528 (0.734–8.709)0.142 0.467
AC + CC32 (69.6)39 (86.7)0.0862.844 (0.981–8.245)0.054 0.288
A48 (52.2)38 (42.2)0.2321.000
C44 (47.8)52 (57.8)1.493 (0.832–2.680)0.180 0.514
rs1544410CC15 (32.6)23 (51.1)0.1191.000
CT25 (54.3)15 (33.3)0.391 (0.157–0.975)0.044 0.288
TT6 (13.0)7 (15.6)0.761 (0.214–2.709)0.673 0.815
CT + TT31 (67.4)22 (48.9)0.1150.463 (0.198–1.082)0.075 0.288
C55 (59.8)61 (67.8)0.3331.000
T37 (40.2)29 (32.2)0.707 (0.385–1.297)0.263 0.583
rs2228570GG15 (32.6)12 (26.7)0.5451.000
GA23 (50.0)21 (46.7)1.141 (0.436–2.988)0.788 0.848
AA8 (17.4)12 (26.7)1.875 (0.580–6.061)0.294 0.583
GA + AA31 (67.4)33 (73.3)0.6961.331 (0.539–3.285)0.536 0.725
G53 (57.6)45 (50.0)0.3781.000
A39 (42.4)45 (50.0)1.359 (0.757–2.438)0.304 0.583
rs11168293GG18 (39.1)21 (46.7)0.7681.000
GT21 (45.7)18 (40.0)0.735 (0.302–1.790)0.497 0.725
TT7 (15.2)6 (13.3)0.735 (0.209–2.588)0.631 0.806
GT + TT28 (60.9)24 (53.3)0.6070.735 (0.319–1.690)0.468 0.725
G57 (62.0)60 (66.7)0.6111.000
T35 (38.0)30 (33.3)0.814 (0.443–1.495)0.508 0.725
SNP—single-nucleotide polymorphism; OR—odds ratio; CI—confidence interval; N/A—not available. Bold represents statistically significant values; adjusted p-value refers to p-values corrected for multiple comparisons using the Benjamini–Hochberg false-discovery rate (FDR) approach.
Table 9. The list and main information of the analyzed SNPs.
Table 9. The list and main information of the analyzed SNPs.
SNP IDSNP PositionFrequency (1000 Genome Project, European)Assay IDContext Sequence [VIC/FAM]
rs3847987chr12:47844285C = 0.8539 A = 0.1461C___2404006_20AAGGGGGTGGGGTGGGAGCTGTGGG[C/A]CGATTATTTATCGTGAGTAGGCAGG
rs731236chr12:47844974A = 0.6004 G = 0.3996C___2404008_10TGGACAGGCGGTCCTGGATGGCCTC[A/G]ATCAGCGCGGCGTCCTGCACCCCAG
rs7975232chr12:47845054C = 0.4453 A = 0.5547C__28977635_10AAGGCACAGGAGCTCTCAGCTGGGC[A/C]CCTCACTGCTCAATCCCACCACCCC
rs1544410chr12:47846052C = 0.5964 T = 0.4036C___8716062_20GAGCAGAGCCTGAGTATTGGGAATG[T/C]GCAGGCCTGTCTGTGGCCCCAGGAA
rs2228570chr12:47879112A = 0.3777 G = 0.6223C__12060045_20GGAAGTGCTGGCCGCCATTGCCTCC[A/G]TCCCTGTAAGAACAGCAAGCAGGCC
rs11168293chr12:47899933G = 0.6789 T = 0.3211C__44841112_10AGAGGAGGCTAGAGTCCATTTCTCC[G/T]TCCAGCTGGGCTAGGTTCAGGAGCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Briedė, K.; Pavalkienė, D.; Gradauskienė, B.; Bartnykaitė, A.; Leonavičius, J.; Ugenskienė, R.; Lukšienė, D.; Tatarūnas, V.; Valiukevičienė, S. Association of Vitamin D Receptor Gene Polymorphisms with Serum 25-Hydroxyvitamin D Levels in Lithuanian Adults with Atopic Dermatitis: A Case—Control Study. Int. J. Mol. Sci. 2026, 27, 4217. https://doi.org/10.3390/ijms27104217

AMA Style

Briedė K, Pavalkienė D, Gradauskienė B, Bartnykaitė A, Leonavičius J, Ugenskienė R, Lukšienė D, Tatarūnas V, Valiukevičienė S. Association of Vitamin D Receptor Gene Polymorphisms with Serum 25-Hydroxyvitamin D Levels in Lithuanian Adults with Atopic Dermatitis: A Case—Control Study. International Journal of Molecular Sciences. 2026; 27(10):4217. https://doi.org/10.3390/ijms27104217

Chicago/Turabian Style

Briedė, Kamilija, Daina Pavalkienė, Brigita Gradauskienė, Agnė Bartnykaitė, Julius Leonavičius, Rasa Ugenskienė, Dalia Lukšienė, Vacis Tatarūnas, and Skaidra Valiukevičienė. 2026. "Association of Vitamin D Receptor Gene Polymorphisms with Serum 25-Hydroxyvitamin D Levels in Lithuanian Adults with Atopic Dermatitis: A Case—Control Study" International Journal of Molecular Sciences 27, no. 10: 4217. https://doi.org/10.3390/ijms27104217

APA Style

Briedė, K., Pavalkienė, D., Gradauskienė, B., Bartnykaitė, A., Leonavičius, J., Ugenskienė, R., Lukšienė, D., Tatarūnas, V., & Valiukevičienė, S. (2026). Association of Vitamin D Receptor Gene Polymorphisms with Serum 25-Hydroxyvitamin D Levels in Lithuanian Adults with Atopic Dermatitis: A Case—Control Study. International Journal of Molecular Sciences, 27(10), 4217. https://doi.org/10.3390/ijms27104217

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop