Experimental System Design and Modelling of EGFR Extracellular Domain and Its Mutant Binding to Antibody Interacting Partner
Abstract
1. Introduction
2. Results
2.1. Molecular Dynamics Simulation Results
2.2. Molecular Docking Results
2.3. Synthesis and PCR Amplification of EGFR and MEGFR
2.4. Real-Time PCR Results
3. Materials and Methods
3.1. Molecular Modeling
3.1.1. Molecular Dynamics Simulation
3.1.2. Molecular Docking
3.2. Data Collection and Preparation
3.2.1. Polymerase Chain Reaction for EGFR and MEGFR
3.2.2. Cloning and Bacterial Transformation
3.2.3. Sequence Analysis
3.2.4. Cell Culture and Generation of Transfected Cell Lines
3.2.5. RNA Isolation and cDNA Synthesis
3.2.6. Quantitative Real-Time PCR (qRT-PCR)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ferlay, J.; Ervik, M.; Lam, F.; Laversanne, M.; Colombet, M.; Mery, L.; Piñeros, M.; Znaor, A.; Soerjomataram, I.; Bray, F. Global Cancer Observatory: Cancer Today. Lyon, France: International Agency for Research on Cancer. Available online: https://gco.iarc.who.int/media/globocan/factsheets/populations/900-world-fact-sheet.pdf (accessed on 12 February 2021).
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit]
- Flynn, J.F.; Wong, C.; Wu, J.M. Anti-EGFR Therapy: Mechanism and Advances in Clinical Efficacy in Breast Cancer. J. Oncol. 2009, 2009, 526963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, L.B.; Zhou, B.; Zhang, L.; Wei, Y.-S.; Wang, Y.-Y.; Liang, W.-B.; Lv, M.-L.; Pan, X.-M.; Chen, Y.; Rao, C.L. R497K polymorphism in epidermal growth factor receptor gene is associated with the risk of acute coronary syndrome. BMC Med. Genet. 2008, 9, 74. [Google Scholar]
- You, B.; Chen, E.X. Anti-EGFR monoclonal antibodies for treatment of colorectal cancers: Development of cetuximab and panitumumab. J. Clin. Pharmacol. 2012, 52, 128–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brewer, M.R.; Yun, C.-H.; Lai, D.; Lemmon, M.A.; Eck, M.J.; Pao, W. Mechanism for activation of mutated epidermal growth factor receptors in lung cancer. Proc. Natl. Acad. Sci. USA 2013, 110, E3595–E3604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moroni, M.; Veronese, S.; Benvenuti, S.; Marrapese, G.; Sartore-Bianchi, A.; Di Nicolantonio, F.; Gambacorta, M.; Siena, S.; Bardelli, A. Gene copy number for epidermal growth factor receptor (EGFR) and clinical response to antiEGFR treatment in colorectal cancer: A cohort study. Lancet Oncol. 2005, 6, 279–286. [Google Scholar] [CrossRef] [Scilit]
- Sforza, V.; Martinelli, E.; Ciardiello, F.; Gambardella, V.; Napolitano, S.; Martini, G.; della Corte, C.; Cardone, C.; Ferrara, M.L.; Reginelli, A.; et al. Mechanisms of resistance to anti-epidermal growth factor receptor inhibitors in metastatic colorectal cancer. World J. Gastroenterol. 2016, 22, 6345–6361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linardou, H.; Briasoulis, E.; Dahabreh, I.J.; Mountzios, G.; Papadimitriou, C.; Papadopoulos, S.; Bafaloukos, D.; Kosmidis, P.; Murray, S. All about KRAS for clinical oncology practice: Gene profile, clinical implications and laboratory recommendations for somatic mutational testing in colorectal cancer. Cancer Treat. Rev. 2011, 37, 221–233. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zha, L.; Liao, D.; Li, X. A Meta-Analysis on the Relations between EGFR R521K Polymorphism and Risk of Cancer. Int. J. Genom. 2014, 2014, 312102. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, H.; Okuda, K.; Shimizu, S.; Takada, M.; Kawahara, M.; Kitahara, N.; Okumura, M.; Matsumura, A.; Iuchi, K.; Kawaguchi, T.; et al. EGFR R497K polymorphism is a favorable prognostic factor for advanced lung cancer. J. Cancer Res. Clin. Oncol. 2009, 135, 313–318. [Google Scholar] [CrossRef] [Scilit]
- Prabha, M.L.; Pradeepa, N. Role of Molecular Modelling in Drug Design. Int. J. Innov. Res. Med. Sci. 2016, 1, 2. [Google Scholar] [CrossRef] [Scilit]
- González, M. Force fields and molecular dynamics simulations. École Thématique de La Société Française de La Neutronique. EDP Sci. 2011, 12, 169–200. [Google Scholar] [CrossRef] [Scilit]
- Adcock, S.A.; McCammon, J.A. Molecular dynamics: Survey of methods for simulating the activity of proteins. Chem. Rev. 2006, 106, 1589–1615. [Google Scholar] [CrossRef] [Scilit]
- Toffolon-Masclet, C.; Perron, A.; Mazères, B.; Dépinoy, S.; Desgranges, C.; Martinelli, L.; Monceau, D.; Boulnat, X.; Mathevon, A.; Perez, M. 1.27 Computational Kinetics: Application to Nuclear Materials. Compr. Nucl. Mater. 2020, 1, 850–880. [Google Scholar]
- Salmaso, V.; Moro, S. Bridging Molecular Docking to Molecular Dynamics in Exploring Ligand-Protein Recognition Process: An Overview. Front. Pharmacol. 2018, 9, 923. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.-Y.; Zhang, H.-X.; Mezei, M.; Cui, M. Molecular docking: A powerful approach for structure-based drug discovery. Curr. Comput. Aided-Drug Des. 2011, 7, 146–157. [Google Scholar] [CrossRef] [Scilit]
- Liebman, J.F.; Gregurick, S.K.A. Review of: Molecular Modelling for Beginners. Mol. Cryst. Liq. Cryst. 2005, 442, 203–205. [Google Scholar] [CrossRef] [Scilit]
- Humphrey, W.; Dalke, A.; Schulten, K. VMD: Visual molecular dynamics. J. Mol. Graph. 1996, 14, 33–38. [Google Scholar] [CrossRef] [Scilit]
- Pierce, B.G.; Hourai, Y.; Weng, Z. Accelerating protein docking in ZDOCK using an advanced 3D convolution library. PLoS ONE 2011, 6, e24657. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.; Li, L.; Weng, Z. ZDOCK: An initial-stage protein-docking algorithm. Proteins Struct Funct. Genet. 2003, 52, 80–87. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Schmitz, K.R.; Jeffrey, P.D.; Wiltzius, J.J.W.; Kussie, P.; Ferguson, K.M. Structural basis for inhibition of the epidermal growth factor receptor by cetuximab. Cancer Cell 2005, 7, 301–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braig, F.; Kriegs, M.; Voigtlaender, M.; Habel, B.; Grob, T.; Biskup, K.; Blanchard, V.; Sack, M.; Thalhammer, A.; Ben Batalla, I.; et al. Cetuximab Resistance in Head and Neck Cancer Is Mediated by EGFR-K521 Polymorphism. Cancer Res. 2017, 77, 1188–1199. [Google Scholar] [CrossRef] [Scilit]
- Rudd, P.M.; Elliott, T.; Cresswell, P.; Wilson, I.A.; Dwek, R.A. Glycosylation and the immune system. Science 2001, 291, 2370–2376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, Q.; Pao, W.; Ladanyi, M. Rapid polymerase chain reaction-based detection of epidermal growth factor receptor gene mutations in lung adenocarcinomas. J. Mol. Diagn. 2005, 7, 396–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Zhao, Y.; Wang, M.; Yap, W.S.; Chang, A.Y.-C. Detection and comparison of epidermal growth factor receptor mutations in cells and fluid of malignant pleural effusion in non-small cell lung cancer. Lung Cancer 2008, 60, 175–182. [Google Scholar] [CrossRef] [Scilit]
- Chiu, C.-H.; Ho, H.-L.; Chiang, C.-L.; Lin, S.-F.; Ma, H.-H.; Chuang, Y.-T.; Lin, K.-Y.; Tsai, C.-M.; Chou, T.-Y. Clinical characteristics and treatment outcomes of lung adenocarcinomas with discrepant EGFR mutation testing results derived from PCR-direct sequencing and real-time PCR-based assays. J. Thorac. Oncol. 2014, 9, 91–96. [Google Scholar] [CrossRef] [Scilit]
- Angulo, B.; Conde, E.; Suárez-Gauthier, A.; Plaza, C.; Martínez, R.; Redondo, P.; Izquierdo, E.; Rubio-Viqueira, B.; Paz-Ares, L.; Hidalgo, M.; et al. A comparison of EGFR mutation testing methods in lung carcinoma: Direct sequencing, real-TIME PCR and immunohistochemistry. PLoS ONE 2012, 7, e43842. [Google Scholar] [CrossRef] [Scilit]
- Shin, S.; Kim, J.; Kim, Y.; Cho, S.-M.; Lee, K.-A. Assessment of real-time PCR method for detection of EGFR mutation using both supernatant and cell pellet of malignant pleural effusion samples from non-small-cell lung cancer patients. Clin. Chem. Lab. Med. 2017, 55, 1962–1969. [Google Scholar] [CrossRef] [Scilit]
- Heid, C.A.; Southwick, K.; Luetke, K.H.; Livak, K.J.; Williams, P.M. Real-time quantitative PCR. Genome Res. 1996, 6, 986–994. [Google Scholar] [CrossRef] [Scilit]
- Van Krieken, J.H.; Jung, A.; Kirchner, T.; Carneiro, F.; Seruca, R.; Bosman, F.T.; Quirke, P.; Fléjou, J.F.; Hansen, T.P.; de Hertogh, G. KRAS mutation testing for predicting response to anti-EGFR therapy for colo-rectal carcinoma: Proposal for a European quality assurance program. Virchows Arch. 2008, 453, 417–431. [Google Scholar]
- Tsiatis, A.C.; Norris-Kirby, A.; Rich, R.G.; Hafez, M.J.; Gocke, C.D.; Eshleman, J.R.; Murphy, K.M. Comparison of sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations. J. Mol. Diagn. 2010, 12, 425–432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mok, T.S.; Wu, Y.-L.; Thongprasert, S.; Yang, C.-H.; Chu, D.-T.; Saijo, N.; Sunpaweravong, P.; Han, B.; Margono, B.; Ichinose, Y.; et al. Gefitinib or carboplatin–paclitaxel in pulmonary adenocarcinoma. N. Engl. J. Med. 2009, 361, 947–957. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Receptor | Time (ns) | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EGFR | 0.5 | Score | 1694 | 1573 | 1525 | 1509 | 1386 | 1374 | 1327 | 1318 | 1282 | 1236 |
| Binding Site | d3 | d3 | d3 | d3 | d3 | d3 | d3 | d3 | d3 | d3 | ||
| MEGFR | 0.5 | Score | 1623 | 1542 | 1499 | 1367 | 1321 | 1221 | ||||
| Binding Site | d3 | d3 | d3 | d3 | d3 | d3 | ||||||
| MEGFR | 90 | Score | 1303 | 1246 | 1214 | 1152 | ||||||
| Binding Site | d3–d4 | d3 | d3 | d3 |
| Receptor | Time (ns) | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EGFR | 0.5 | Score | 1809 | 1795 | 1777 | 1725 | 1706 | 1694 | 1685 | 1681 | 1672 | 1662 |
| Binding Site | d4 | d1–d2 | d1–d2 | d3 | d1–d2 | d3 | d3 | d4 | d2–d4 | d1–d4 | ||
| MEGFR | 0.5 | Score | 1966 | 1917 | 1879 | 1862 | 1843 | 1824 | 1786 | 1778 | 1772 | 1764 |
| Binding Site | d3 | d1–d2 | d1–d2 | d1–d2 | d1 | d1–d2 | d1 | d1 | d3 | d4 | ||
| MEGFR | 90 | Score | 1879 | 1821 | 1779 | 1716 | 1684 | 1664 | 1651 | 1641 | 1637 | 1635 |
| Binding Site | d1–d2 | d1–d2 | d1–d2 | d1–d2 | d4 | d3 | d1 | d4 | d4 | d4 |
| (A) | ||||||
| Identifier | Av. Ct | Identifier | Av. Ct | ΔCt | 2−ΔCt | |
| CHO cell | GAPDH | 24.9 | P1 | 31.5 | 6.6 | 0 |
| CHO cell transfected with pcDNA 3.1 vector | GAPDH | 25.8 | P1 | 28.5 | 2.7 | 0.2 |
| CHO cell transfected with EGFR/pcDNA 3.1 vector | GAPDH | 23.5 | P1 | 16.5 | −7 | 130.8 |
| CHO cell | GAPDH | 24.9 | P2 | 32.5 | 7.6 | 0 |
| CHO cell transfected with pcDNA 3.1 vector | GAPDH | 25.8 | P2 | 31.1 | 5.3 | 0 |
| CHO cell transfected with EGFR/pcDNA 3.1 vector | GAPDH | 23.5 | P2 | 21.6 | −1.9 | 3.8 |
| (B) | ||||||
| Identifier | Av. Ct | Identifier | Av. Ct | ΔCt | 2−ΔCt | |
| CHO cell | GAPDH | 24.9 | P1 | 31.5 | 6.6 | 0 |
| CHO cell transfected with pcDNA 3.1 vector | GAPDH | 25.8 | P1 | 28.5 | 2.7 | 0.2 |
| CHO cell transfected with MEGFR/pcDNA 3.1 vector | GAPDH | 22.6 | P1 | 19.1 | −3.5 | 11.3 |
| CHO cell | GAPDH | 24.9 | P2 | 32.5 | 7.6 | 0 |
| CHO cell transfected with pcDNA 3.1 vector | GAPDH | 25.8 | P2 | 31.1 | 5.3 | 0 |
| CHO cell transfected with MEGFR/pcDNA 3.1 vector | GAPDH | 22.6 | P2 | 16.4 | −6.2 | 74.6 |
| Primer Name | Sequence (5 > 3) | Base Pair (bp) | Temperature (°C) |
|---|---|---|---|
| EGFR Forward primer (F) | TTATGCTAGCGCCGCCACCATGCACCATCATCATCACCATCACCACCTGGAAAAGAAAGTTTGCC | 68 | 76 |
| EGFR Reverse primer (R) | ATGGGCCTAAGATCCCGTCCTGACTAGCTCGAGTCAA | 37 | 73.9 |
| R497K EGFR Forward primer (MF) | CCAAAATTATAAGCAACAAGGGTGAAAACAGC | 32 | 59 |
| R497K EGFR Reverse primer (MR) | GCTGTTTTCACCCTTGTTGCTTATAATTTTGG | 32 | 59 |
| qPCR-Forward primer | CAGCCTGAACATAACATCCTTGG | 23 | 60.6 |
| qPCR-Reverse primer without mutation for P1 | CTTGCAGCTGTTTTCACCTCTG | 22 | 60.3 |
| qPCR-Reverse primer with mutation for P2 | CTTGCAGCTGTTTTCACCCTTG | 22 | 60.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Erdemir, F.; Balcioglu, B.K.; Ozal Ildeniz, T.A.; Can, O. Experimental System Design and Modelling of EGFR Extracellular Domain and Its Mutant Binding to Antibody Interacting Partner. Int. J. Mol. Sci. 2025, 26, 3594. https://doi.org/10.3390/ijms26083594
Erdemir F, Balcioglu BK, Ozal Ildeniz TA, Can O. Experimental System Design and Modelling of EGFR Extracellular Domain and Its Mutant Binding to Antibody Interacting Partner. International Journal of Molecular Sciences. 2025; 26(8):3594. https://doi.org/10.3390/ijms26083594
Chicago/Turabian StyleErdemir, Feyzanur, Bertan Koray Balcioglu, Tugba Arzu Ozal Ildeniz, and Ozge Can. 2025. "Experimental System Design and Modelling of EGFR Extracellular Domain and Its Mutant Binding to Antibody Interacting Partner" International Journal of Molecular Sciences 26, no. 8: 3594. https://doi.org/10.3390/ijms26083594
APA StyleErdemir, F., Balcioglu, B. K., Ozal Ildeniz, T. A., & Can, O. (2025). Experimental System Design and Modelling of EGFR Extracellular Domain and Its Mutant Binding to Antibody Interacting Partner. International Journal of Molecular Sciences, 26(8), 3594. https://doi.org/10.3390/ijms26083594

