Animal Model Screening for Hyperlipidemic ICR Mice
Abstract
1. Introduction
2. Results
2.1. General Morphologic Changes in Mice
2.2. Comparison of Changes in Body Weight and Food Intake in Mice
2.3. Comparison of Organ Indices in Mice
2.4. Comparison of Serum Biochemical Indices in Mice
2.5. Comparison of Total Cholesterol (T-CHO), Triglyceride (TG), and Total Bile Acid (TBA) in the Livers of Mice in Each Group
2.6. HE Staining of Mouse Liver Tissue and Epididymal Adipose Tissue and Oil Red O Staining of Liver
2.7. Mouse Liver HMGCR(3-Hydroxy-3-Methylglutaryl-CoA Reductase) Content Assay
2.8. Immunofluorescence of Liver Tissue LXRα (Liver X Receptor Alpha), CYP7A1 (Cytochrome P450 Family 7 Subfamily A Member 1)
2.9. Insig-1 (Insulin-Induced Gene 1), SREBP-2 (Sterol Regulatory Element Binding Protein 2), HMGCR, LXRα, ABCA1 (ATP-Binding Cassette Transporter A1), CYP7A1 mRNA Expression in Mouse Livers
2.10. Insig1, SREBP-2, HMGCR, LXR, ABCA1, CYP7A1 Protein Expression in Mouse Livers
3. Discussion
3.1. Changes in Serum Biochemical Indices in Hyperlipidemic Mice
3.2. Changes in Organ Index, T-CHO, TG, TBA Content, and Pathologic Indices and HMGCR Content in Livers of Hyperlipidemic Mice
3.3. Changes of Insig-1, SREBP-2, HMGCR, LXRα, ABCA1, and CYP7A1 Gene and Protein Expression in the Livers of Hyperlipidemic Mice
4. Materials and Methods
4.1. Reagents
4.2. Experimental Animals
4.3. Feed Preparation
4.4. Hyperlipidemia ICR Mouse Model Establishment
4.5. Observations on the General State of Mice
4.6. Body Weight and Food Intake of Mice
4.7. Serum Biochemical Index Tests
4.8. Calculation of Organ Index
4.9. Determination of Total Cholesterol (T-CHO) and Triglyceride (TG) and Total Bile Acids (TBAs) in the Liver
4.10. Detection of HMGCR (3-Hydroxy-3-Methylglutaryl-CoA Reductase) Content in Liver
4.11. Liver and Adipose Tissue Pathology Testing
4.12. Immunofluorescence of Liver LXRα, CYP7A1
4.13. RT-qPCR of Liver Tissue
4.14. Immunoblotting of Liver Tissue Proteins
4.15. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, Y.; Chen, J.; Zhang, Y.; Li, S.; Wang, Y.; Zhang, Y.; Shi, C. Mechanism of Total Saponin of Astragali Radix and Total Alkaloids of Nelumbinis Folium Against Hyperlipidemia Based on PPARγ/LXRα/ABCG1 Signaling Pathway. Chin. J. Exp. Tradit. Med. Formulae 2024, 30, 37–44. [Google Scholar] [CrossRef]
- Manolis, T.A.; Vouliotis, A.; Manolis, A.S. Metabolic Dysfunction-Associated Steatotic Liver Disease and the Cardiovascular System. Trends Cardiovasc. Med. 2025. [Google Scholar] [CrossRef]
- Mansouri, M.; Imenshahidi, M.; Rameshrad, M.; Hosseinzadeh, H. Effects of Tinospora cordifolia (giloy) on metabolic syndrome components: A mechanistic review. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2024, 1–31. [Google Scholar] [CrossRef]
- Tyagi, S.C. A High-Fat Diet Induces Epigenetic 1-Carbon Metabolism, Homocystinuria, and Renal-Dependent HFpEF. Nutrients 2025, 17, 216. [Google Scholar] [CrossRef] [PubMed]
- Damodharan, K.; Palaniyandi, S.A.; Yang, S.H.; Balaji, S. Cholesterol-Lowering Activity of Lactiplantibacillus pentosus KS6I1 in High-Cholesterol Diet-Induced Hypercholesterolemic Mice. J. Microbiol. Biotechnol. 2024, 35, e2404029. [Google Scholar] [CrossRef]
- Khalaf, K.; Chamieh, M.; Welc, N.; Singh, C.; Kaouk, J.L.; Kaouk, A.; Mackiewicz, A.; Kaczmarek, M.; Perek, B. Cellular aspects of immunity involved in the development of atherosclerosis. Front. Immunol. 2025, 16, 1461535. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Hu, B.; Zhang, L.; Hu, Y.; Zhang, Y.; Zhang, R.; Yu, H.; Liu, D.; Wang, X.; Lin, O.; et al. Role of gut microbiota and metabolomics in the lipid-lowering efficacy of statins among Chinese patients with coronary heart disease and hypercholesterolemia. Front. Cell. Infect. Microbiol. 2024, 14, 1408581. [Google Scholar] [CrossRef] [PubMed]
- Xu, A.; Zhou, Y.; Zhao, M.; Chen, H. Comparison of Two Kinds of Animal Models of Hyperlipidemia. Lishizhen Med. Mater. Med. Res. 2014, 25, 138–139. [Google Scholar]
- Lian, J.; Reyimai, M.; Zhu, H.; Zhou, B.; Zhao, X. A comparative study of different methods for establising hyperlipidemia models. J. Med. Pest Control. 2023, 39, 872–876+880. [Google Scholar]
- Wang, Y.; Peng, D.; Liu, X.; Xie, R.; LI, X. Validation Research and Regulation Exploration of High Fat-introduced Hyperlipidemia Model in Rat. Chin. J. Compa Rative Med. 2017, 27, 5–10. [Google Scholar]
- Wang, P.; Yang, D.; Sun, J.; Zhao, Y. Effects of so.dium tungstate on poloxamer 407-induced hyperlipidemic Kunming mouse model. J. Logist. Univ. PAP (Med. Sci.) 2013, 22, 249–251. [Google Scholar]
- Qi, M.; Xu, C.; Lyu, L.; Yang, Z.; Yang, R. Comparative study on the establishment of hyperlipidemia models in rats induced by different high-fat diets. Lab. Anim. Sci. 2023, 40, 39–43. [Google Scholar]
- Lu, X.; Yang, Y.; Ma, N.; Liu, X.; Li, J. Optimal regulation period of flower bud differentiation of Tussilago farfara L. J. Tradit. Chin. Vet. Med. 2020, 39, 8–12. [Google Scholar] [CrossRef]
- Bao, H.; Zhang, C.; Su, Y.; Gao, Y.; Zhang, H. The establishment of huperlipidemic models induced by high fat diets in mice. Northwest Pharm. J. 2019, 34, 47–51. [Google Scholar]
- Hou, H.; Zhang, G.; Peng, B.; Wei, X.; Wang, L.; Song, L.; Gao, Y.; Chen, T.; Ning, L. Analysis on Changes of Related Indexes in Different Periods of Hyperlipidemia of Rat Model. Lab. Anim. Sci. 2023, 40, 67–72. [Google Scholar]
- Qin, H.; Wang, S.; Wen, P.; Zhao, P.; Li, B.; Zhang, J. A Comparison on Hyperlipidemia Rat Models Induced by High-fat Diet with Different Proportions of Sugar and Oil. Lab. Anim. Comp. Med. 2017, 37, 209–213. [Google Scholar]
- Zheng, L.; Dong, P.; Wu, Y.; Cai, X.; Meng, Q.; Tian, S. Experimental Study on the Model Construction of Hyperlipidemia Complicated with Fatty Liver by 2 Kinds of Different Feed Formulations. J. Guangzhou Univ. Tradit. Chin. Med. 2022, 39, 657–663. [Google Scholar] [CrossRef]
- Morselli, E.; Frank, A.P.; Santos, R.S.; Fátima, L.A.; Palmer, B.F.; Clegg, D.J. Sex and Gender: Critical Variables in Pre-Clinical and Clinical Medical Research. Cell Metab. 2016, 24, 203–209. [Google Scholar] [CrossRef] [PubMed]
- Tian, S.; Zuo, Z.; Li, Y.; Tian, Y.; Pei, H.; Yu, S.; Zhao, X.; Liu, C.; Wang, Z. Characteristics and sex differences of two kinds of hyperlipidemia models in rats. Chin. J. Comp. Med. 2023, 33, 37–44. [Google Scholar]
- Mei, H.; Hu, H.; Lv, Y.; Ma, G.; Tang, F.; Hong, Z.; Shao, F. The Hypolipidemic Effect of Dalbergia odorifera T. C. Chen Leaf Extract on Hyperlipidemic Rats and Its Mechanism Investigation Based on Network Pharmacology. Evid.-Based Complement. Altern. Med. 2021, 2021, 3155266. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Sun, H.; Liang, G.; Lin, Y.; Huang, Y. Screening and Optimization of Hyperlipidemia Rat Model of Several Kinds of Modeling Methods. Prog. Vet. Med. 2014, 35, 89–93. [Google Scholar] [CrossRef]
- Wu, X.; Wei, W.; Liu, S. Screening and Optimization of Hyperlipidemia Rat Model of Four Kinds of Modeling Methods. Prog. Vet. Med. 2013, 34, 75–78. [Google Scholar] [CrossRef]
- Cacabelos, R.; Carril, J.C.; Corzo, L.; Pego, R.; Cacabelos, N.; Alcaraz, M.; Muñiz, A.; Martínez-Iglesias, O.; Naidoo, V. Pharmacogenetics of anxiety and depression in Alzheimer’s disease. Pharmacogenomics 2023, 24, 27–57. [Google Scholar] [CrossRef] [PubMed]
- Aldworth, H.; Hooper, N.M. Post-translational regulation of the low-density lipoprotein receptor provides new targets for cholesterol regulation. Biochem. Soc. Trans. 2024, 52, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Reamy, B.V.; Ford, B.; Goodman, C. Novel Pharmacotherapies for Hyperlipidemia. Prim. Care Clin. Off. Pract. 2023, 51, 27–40. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, T.; Ding, L.; Li, Z.; Zhang, Y.; Dai, M.; Wu, H. Extract of Gualou-Xiebai Herb Pair Improves Lipid Metabolism Disorders by Enhancing the Reverse Cholesterol Transport in Atherosclerosis Mice. Curr. Neurovasc. Res. 2024, 21, 214–227. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Yan, L.-T.; Yao, Z.; Xiong, G.-Y. Biochanin A Regulates Cholesterol Metabolism Further Delays the Progression of Nonalcoholic Fatty Liver Disease. Diabetes Metab. Syndr. Obes. Targets Ther. 2021, 14, 3161–3172. [Google Scholar] [CrossRef]
- Du, L.; Wang, Q.; Ji, S.; Sun, Y.; Huang, W.; Zhang, Y.; Li, S.; Yan, S.; Jin, H. Metabolomic and Microbial Remodeling by Shanmei Capsule Improves Hyperlipidemia in High Fat Food-Induced Mice. Front. Cell. Infect. Microbiol. 2022, 12, 729940. [Google Scholar] [CrossRef]
- Yu, C.; Huang, J.; Xi, Y.; Lai, E.Y.; Chen, S.; Xu, N. Construction of a mouse model of type 2 diabetes induced by high fat diet alone and evaluation of pathological changes. Acta Physiol. Sin. 2024, 76, 385–393. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhong, L.; He, K.; Qiu, C.; Li, Z.; Zhao, L.; Gong, J. Cholesterol attenuated the progression of DEN-induced hepatocellular carcinoma via inhibiting SCAP mediated fatty acid de novo synthesis. Biochem. Biophys. Res. Commun. 2019, 509, 855–861. [Google Scholar] [CrossRef] [PubMed]
- Hang, W.; Shu, H.; Wen, Z.; Liu, J.; Jin, Z.; Shi, Z.; Chen, C.; Wang, D.W. N-Acetyl Cysteine Ameliorates High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Intracellular Triglyceride Accumulation by Preserving Mitochondrial Function. Front. Pharmacol. 2021, 12, 636204. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Lv, Y.; Zheng, M.; Yin, L.; Wang, X.; Fu, Y.; Yu, B.; Li, J. Polyphenols from blue honeysuckle (Lonicera caerulea var. edulis) berry inhibit lipid accumulation in adipocytes by suppressing lipogenesis. J. Ethnopharmacol. 2021, 279, 114403. [Google Scholar] [CrossRef]
- Zhang, Y.; Long, M. Research progress of novel adipokines in obesity and type 2 diabetes mellitus. Chin. J. Clin. Res. 2023, 36, 1769–1775. [Google Scholar] [CrossRef]
- Wang, W. The Mechanism of Cells Involved in Adipose Tissue Fibrosis. Chin. J. Biochem. Mol. Biol. 2023, 39, 1735–1742. [Google Scholar] [CrossRef]
- Ree, J.; Kim, J.I.; Lee, C.W.; Lee, J.; Kim, H.J.; Kim, S.C.; Sohng, J.K.; Park, Y.I. Quinizarin suppresses the differentiation of adipocytes and lipogenesis in vitro and in vivo via downregulation of C/EBP-beta/SREBP pathway. Life Sci. 2021, 287, 120131. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.-T.; Huang, Y.-W.; Hou, C.-Y.; Wang, J.-J.; Wu, C.-C.; Hsieh, S.-L. D-Limonene Promotes Anti-Obesity in 3T3-L1 Adipocytes and High-Calorie Diet-Induced Obese Rats by Activating the AMPK Signaling Pathway. Nutrients 2023, 15, 267. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.; Wen, Q.; Liu, R.; He, M.; Jiang, Z.; Qian, K.; Zhou, C.; Li, J.; Du, H.; Ouyang, H.; et al. PL-S2, a homogeneous polysaccharide from Radix Puerariae lobatae, attenuates hyperlipidemia via farnesoid X receptor (FXR) pathway-modulated bile acid metabolism. Int. J. Biol. Macromol. 2020, 165, 1694–1705. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Sun, W.; Gao, L.; Liu, S. Therapeutic targets of hypercholesterolemia: HMGCR and LDLR. Diabetes Metab. Syndr. Obes. Targets Ther. 2019, 12, 1543–1553. [Google Scholar] [CrossRef]
- Zhang, S.; Wang, H.; Zhang, T.; Jia, S.; Dan, J. Research Progress on Expression and Activity Regulation of HMGCR. Chin. J. Cell Biol. 2023, 45, 990–996. [Google Scholar]
- Van den Boomen, D.J.; Volkmar, N.; Lehner, P.J. Ubiquitin-mediated regulation of sterol homeostasis. Curr. Opin. Cell Biol. 2020, 65, 103–111. [Google Scholar] [CrossRef]
- Wang, L.; Zhang, S.; Ma, P.; Dan, J. Research Progress on Expression and Activity Regulation of SREBP2. Chin. J. Cell Biol. 2021, 43, 2441–2448. [Google Scholar]
- Shi, X.; Song, B. Diets and cholesterol metabolism. Sci. Sin. (Vitae) 2022, 52, 1391–1398. [Google Scholar] [CrossRef]
- Yan, R.; Cao, P.; Song, W.; Li, Y.; Wang, T.; Qian, H.; Yan, C.; Yan, N. Structural basis for sterol sensing by Scap and Insig. Cell Rep. 2021, 35, 109299. [Google Scholar] [CrossRef]
- Ouyang, S.; Mo, Z.; Sun, S.; Yin, K.; Lv, Y. Emerging role of Insig-1 in lipid metabolism and lipid disorders. Clin. Chim. Acta 2020, 508, 206–212. [Google Scholar] [CrossRef]
- Jiang, L.-Y.; Jiang, W.; Tian, N.; Xiong, Y.-N.; Liu, J.; Wei, J.; Wu, K.-Y.; Luo, J.; Shi, X.-J.; Song, B.-L. Ring finger protein 145 (RNF145) is a ubiquitin ligase for sterol-induced degradation of HMG-CoA reductase. J. Biol. Chem. 2018, 293, 4047–4055. [Google Scholar] [CrossRef] [PubMed]
- Schumacher, M.M.; Jun, D.J.; Jo, Y.; Seemann, J.; DeBose-Boyd, R.A. Geranylgeranyl-regulated transport of the prenyltransferase UBIAD1 between membranes of the ER and Golgi. J. Lipid. Res. 2016, 57, 1286–1299. [Google Scholar] [CrossRef]
- Faulkner, R.; Jo, Y. Synthesis, function, and regulation of sterol and nonsterol isoprenoids. Front. Mol. Biosci. 2022, 9, 100682. [Google Scholar] [CrossRef] [PubMed]
- Hasson, T.S.; Said, E.; Helal, M.G. Nifuroxazide modulates hepatic expression of LXRs/SR-BI/CES1/CYP7A1 and LDL-R and attenuates experimentally-induced hypercholesterolemia and the associated cardiovascular complications. Life Sci. 2022, 306, 120790. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.H.; Tang, C.K. ABCA1, ABCG1, and Cholesterol Homeostasis. Adv. Exp. Med. Biol. 2022, 1377, 95–107. [Google Scholar] [CrossRef]
- Du, Y.; Su, J.; Yan, M.; Wang, Q.; Wang, T.; Gao, S.; Tian, Y.; Wang, Y.; Chen, S.; Lv, G.; et al. Polymethoxyflavones in citrus extract has a beneficial effect on hypercholesterolemia rats by promoting liver cholesterol metabolism. J. Ethnopharmacol. 2023, 322, 117644. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.; He, F.; Yan, X.; Xing, Y.; Lei, Y.; Gao, J.; He, M.; Li, D.; Bai, L.; Yuan, Z.; et al. Hepatic Reduction in Cholesterol 25-Hydroxylase Aggravates Diet-induced Steatosis. Cell. Mol. Gastroenterol. Hepatol. 2022, 13, 1161–1179. [Google Scholar] [CrossRef]
- Tsai, M.-C.; Cho, R.-L.; Lin, C.-S.; Jheng, Y.-S.; Lien, C.-F.; Chen, C.-C.; Tzeng, B.-H. Cav3.1 T-type calcium channel blocker NNC 55-0396 reduces atherosclerosis by increasing cholesterol efflux. Biochem. Pharmacol. 2024, 222, 116096. [Google Scholar] [CrossRef]
- Peng, Y.; Xu, J.; Zeng, Y.; Chen, L.; Le Xu, X. Polydatin attenuates atherosclerosis in apolipoprotein E-deficient mice: Role of reverse cholesterol transport. Phytomedicine 2019, 62, 152935. [Google Scholar] [CrossRef]
- Iborra, R.T.; Machado-Lima, A.; Okuda, L.S.; Pinto, P.R.; Nakandakare, E.R.; Machado, U.F.; Correa-Giannella, M.L.; Pickford, R.; Woods, T.; Brimble, M.A.; et al. AGE-albumin enhances ABCA1 degradation by ubiquitin-proteasome and lysosomal pathways in macrophages. J. Diabetes Complicat. 2018, 32, 1–10. [Google Scholar] [CrossRef]
- Wang, W.; Zhang, Y.; Wang, Z.; Zhang, J.; Jia, L. Ganoderma lucidum polysaccharides improve lipid metabolism against high-fat diet-induced dyslipidemia. J. Ethnopharmacol. 2023, 309, 116321. [Google Scholar] [CrossRef]















| Basic Feeds | Wild Boar Oil | Triglyceride | Fructose | Sodium Cholate | Other | Date |
|---|---|---|---|---|---|---|
| 52.2% | 15% | 1.2% | 20% | 0.2% | 10% casein, 0. 6% calcium phosphate, 0. 4% premix | 2017 |
| 63.7% | 10% | 1% | 20% | 0.3% | 5% casein | 2023 |
| 68.7% | 10% | 1% | 20% | 0.3% | — | 2023 |
| 77.8% | 10% | 2% | — | 0.2% | 10% egg yolk powder | 2020 |
| 72.8% | 15% | 2% | 10% | 0.2% | — | 2019 |
| 63.6% | 15% | 1.2% | 20% | 0.2% | — | 2023 |
| 72.8% | 15% | 1.2% | 5% | 0.2% | 5.8% casein | 2017 |
| 72.2% | 10% | 1.2% | 5% | 0.2% | 5% egg yolk powder, 5% casein, 1.1% calcium phosphate, 0.3% rock flour | 2022 |
| 49% | 15% | 1.2% | 20% | 0.2% | 12% casein, 1.8% calcium phosphate, 0.6% rock flour, 0.2% salt | 2022 |
| Gene Accession Numbers | Gene Name | Primer Sequences (5′–3′) |
|---|---|---|
| NM_033218.1 | M-SREBP2(2)-S | GATGGATGAGAGCAGCGAGC |
| M-SREBP2(2)-A | CTCTCCCACTTGATTGCTGACA | |
| NM_153526.5 | M-Insig1-S | GATAGCCACCATCTTCTCCTCC |
| M-Insig1-A | TGTCCACCACAAACCCAAAGA | |
| NM_001360165.1 | M-Hmgcr(4)-S | CAAGTACATTCTGGGTATTGCTGG |
| M-Hmgcr(4)-A | TAAGCCTGTCAGTTCTTTGTCG | |
| NM_013454.3 | M-ABCA1-S | AGTCCATCGTGTCTCGCCTGT |
| M-ABCA1-A | GGGATGCTTGATCTGCCGTA | |
| NM_007824.3 | M-Cyp7a1(2)-S | GCTAAGGAGGACTTCACTCTACACC |
| M-Cyp7a1(2)-A | TGGTCTTTGCTTTCCCACTTTC | |
| NM_001177730.1 | M-LXRA-S | TCATCAAGGGAGCACGCTATGT |
| M-LXRA-A | CTTGAGCCTGTTCCTCTTCTTGC | |
| NM_008084.2 | M-GAPDH-S | CCTCGTCCCGTAGACAAAATG |
| M-GAPDH-A | TGAGGTCAATGAAGGGGTCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Zhou, Y.; Yang, J.; Yang, R.; Xue, S.; Wang, Q.; Niu, W. Animal Model Screening for Hyperlipidemic ICR Mice. Int. J. Mol. Sci. 2025, 26, 2142. https://doi.org/10.3390/ijms26052142
Chen X, Zhou Y, Yang J, Yang R, Xue S, Wang Q, Niu W. Animal Model Screening for Hyperlipidemic ICR Mice. International Journal of Molecular Sciences. 2025; 26(5):2142. https://doi.org/10.3390/ijms26052142
Chicago/Turabian StyleChen, Xingtong, Yunyue Zhou, Jinbiao Yang, Ruihong Yang, Shuang Xue, Qiao Wang, and Wenying Niu. 2025. "Animal Model Screening for Hyperlipidemic ICR Mice" International Journal of Molecular Sciences 26, no. 5: 2142. https://doi.org/10.3390/ijms26052142
APA StyleChen, X., Zhou, Y., Yang, J., Yang, R., Xue, S., Wang, Q., & Niu, W. (2025). Animal Model Screening for Hyperlipidemic ICR Mice. International Journal of Molecular Sciences, 26(5), 2142. https://doi.org/10.3390/ijms26052142
