Antithrombotic Effect of Chenopodium album L. Extract and Its Fractions via Regulating TLRs and the Downstream MAPKs and PI3K/AKT Signaling Pathways in Zebrafish
Abstract
1. Introduction
2. Results
2.1. Antithrombotic Effect of CA on Zebrafish
2.2. Antithrombotic Effect of Fractions from CA on Zebrafish
2.3. UPLC-Q-TOF-MS Analysis of Fractions from CA
2.4. Antithrombotic Activity of CA-C
2.5. Results of Network Pharmacology Analysis
2.6. Transcriptomics Analysis
2.7. RT-qPCR Analysis
3. Discussion
4. Materials and Methods
4.1. Chemicals and Regents
4.2. Plant Material
4.3. Extraction and Separation
4.4. UPLC-Q-TOF-MS Analysis
4.5. Zebrafish Maintenance
4.6. Drug Safety Testing
4.7. Antithrombotic Effect Assays
4.7.1. Cardiac Erythrocyte Assay
4.7.2. Caudal Thrombus Assay
4.7.3. Assay for Blood Flow Dynamics of the Caudal Vein
4.8. Network Pharmacology Analysis
4.9. mRNA-Sequencing and Bioinformatics Analysis
4.10. RNA-Isolation and RT-qPCR
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
UPLC-Q-TOF-MS | ultra-high performance liquid chromatography-quadrupole time-of-flight tandem mass spectrometry |
TLRs | toll-like receptors |
MAPK | mitogen-activated protein kinase |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
PPI | protein–protein interaction |
LC1 | 1% lethal concentration |
AA | arachidonic acid |
GO | Gene Ontology |
TCM | traditional Chinese medicine |
DEGs | differentially expressed genes |
PI3K | phosphoinositide-3-kinase |
RT-qPCR | real-time quantitative PCR |
PKC | protein kinase C |
TXB2 | thromboxane B2 |
vWF | von Willebrand factor |
NF-κb | nuclear factor-κB |
ERK | extracellular regulated protein kinases |
PLA2 | phospholipase A2 |
JNK | c-Jun N-terminal kinase |
TIR | toll/interleukin-1 receptor |
AP-1 | activator protein-1 |
MyD88 | myeloid differentiation primary response protein 88 |
References
- Zitomersky, N.L.; Verhave, M.; Trenor, C.C. Thrombosis and inflammatory bowel disease: A call for improved awareness and prevention. Inflamm. Bowel Dis. 2011, 17, 458–470. [Google Scholar] [CrossRef] [PubMed]
- Aksu, K.; Donmez, A.; Keser, G. Inflammation-induced thrombosis: Mechanisms, disease associations and management. Curr. Pharm. Design. 2012, 18, 1478–1493. [Google Scholar]
- Cheng, Y.; Wang, M.; Yu, Y.; Lawson, J.; Funk, C.D.; FitzGerald, G.A. Cyclooxygenases, microsomal prostaglandin E synthase-1, and cardiovascular function. J. Clin. Investig. 2006, 116, 1391–1399. [Google Scholar] [CrossRef] [PubMed]
- Offermanns, S. Activation of platelet function through G protein-coupled receptors. Circ. Res. 2006, 99, 1293–1304. [Google Scholar] [CrossRef]
- Middleton, E.A.; Weyrich, A.S.; Zimmerman, G.A. Platelets in pulmonary immune responses and inflammatory lung diseases. Physiol. Rev. 2016, 96, 1211–1259. [Google Scholar] [CrossRef]
- Beaulieu, L.M.; Freedman, J.E. The role of inflammation in regulating platelet production and function: Toll-like receptors in platelets and megakaryocytes. Thromb. Res. 2010, 125, 205–209. [Google Scholar] [CrossRef]
- Vallance, T.M.; Zeuner, M.T.; Williams, H.F.; Widera, D.; Vaiyapuri, S. Toll-like receptor 4 signalling and its impact on platelet function, thrombosis, and haemostasis. Mediat. Inflamm. 2017, 2017, 9605894. [Google Scholar] [CrossRef]
- Manne, B.K.; Münzer, P.; Badolia, R.; Walker-Allgaier, B.; Campbell, R.A.; Middleton, E.; Weyrich, A.S.; Kunapuli, S.P.; Borst, O.; Rondina, M.T. PDK1 governs thromboxane generation and thrombosis in platelets by regulating activation of Raf1 in the MAPK pathway. J. Thromb. Haemost. 2018, 16, 1211–1225. [Google Scholar] [CrossRef]
- Zhou, Y.F.; Zhang, D.K.; Tan, P.; Xian, B.; Jiang, H.J.; Wu, Q.H.; Huang, X.L.; Zhang, P.; Xiao, X.H.; Pei, J. Mechanism of platelet activation and potential therapeutic effects of natural drugs. Phytomedicine 2023, 108, 154463. [Google Scholar] [CrossRef]
- Ziyi, W.; Shao, L. Network pharmacology in quality control of traditional Chinese medicines. Chin. Herb. Med. 2022, 14, 477–478. [Google Scholar]
- Cheng, M.H.; Li, T.; Hu, E.; Yan, Q.J.; Li, H.G.; Wang, Y.; Luo, J.K.; Tang, T. A novel strategy of integrating network pharmacology and transcriptome reveals antiapoptotic mechanisms of Buyang Huanwu Decoction in treating intracerebral hemorrhage. J. Ethnopharmacol. 2024, 319, 14. [Google Scholar] [CrossRef] [PubMed]
- Song, J.F.; Jiang, Z.H.; Wei, X.L.; Zhang, Y.; Bian, B.L.; Wang, H.J.; Gao, W.Y.; Si, N.; Liu, H.Y.; Cheng, M.; et al. Integrated transcriptomics and lipidomics investigation of the mechanism underlying the gastrointestinal mucosa damage of Loropetalum chinense (R. Br.) and its representative component. Phytomedicine 2023, 114, 14. [Google Scholar] [CrossRef] [PubMed]
- Saini, R.; Kumar, D.; Mittal, A. Antimicrobial and phytochemical potential of Chenopodium album Linn. International. J. Sci. Technol. Res. 2019, 8, 877–880. [Google Scholar]
- Poonia, A.; Upadhayay, A. Chenopodium album Linn: Review of nutritive value and biological properties. J. Food Sci Technol. 2015, 52, 3977–3985. [Google Scholar] [CrossRef]
- Arsene, M.M.J.; Viktorovna, P.I.; Mikhailovitch, M.K.; Davares, A.K.L.; Parfait, K.; Rehailia, M.; Nikolayevich, S.A.; Stefanovna, G.V.; Sarra, S.; Sulikoevich, K.Z.; et al. In vitro antimicrobial activity, antibioresistance reversal properties, and toxicity screen of ethanolic extracts of Heracleum mantegazzianum Sommier and Levier (giant hogweed), Centaurea jacea L. (brown knapweed), and Chenopodium album L. (Pigweed): Three invasive plants. Open Vet. J. 2022, 12, 584–594. [Google Scholar]
- Kabir, M.; Al-Noman, A.; Dash, B.K.; Hasan, M.; Akhter, S.; Rahman, M. Trema orientalis (Linn.) leaves promotes anticancer activity in Ehrlich ascites carcinoma (EAC) in Swiss albino mice. J. Basic Clin. Physiol. Pharmacol. 2019, 31, 2019012. [Google Scholar] [CrossRef]
- Kim, P.; Jeong, C.S. Effects of Chenopodium album Linne on gastritis and gastric cancer cell growth. Biomol. Ther. 2011, 19, 487–492. [Google Scholar] [CrossRef]
- Suleman, M.; Faiz, A.; Fakhr, I.A. Antibacterial, antiparasitic and phytochemical activities of Chenopodium album (bathua) plant extract. Bangladesh J. Bot. 2021, 50, 417–421. [Google Scholar] [CrossRef]
- Hussain, S.; Asrar, M.; Rasul, A.; Sultana, S.; Saleem, U. Chenopodium album extract ameliorates carbon tetrachloride induced hepatotoxicity in rat model. Saudi J. Biol. Sci. 2022, 29, 3408–3413. [Google Scholar] [CrossRef]
- Choudhary, N.; Khatik, G.L.; Choudhary, S.; Singh, G.; Suttee, A. In vitro anthelmintic activity of Chenopodium album and in-silico prediction of mechanistic role on Eisenia foetida. Heliyon 2021, 7, 8. [Google Scholar] [CrossRef]
- Lapchak, P.A.; Zivin, J.A. The lipophilic multifunctional antioxidant edaravone (radicut) improves behavior following embolic strokes in rabbits: A combination therapy study with tissue plasminogen activator. Exp. Neurol. 2009, 215, 95–100. [Google Scholar] [CrossRef] [PubMed]
- Chico, T.J.A.; Ingham, P.W.; Crossman, D.C. Modeling cardiovascular disease in the zebrafish. Trends Cardiovasc. Med. 2008, 18, 150–155. [Google Scholar] [CrossRef] [PubMed]
- Jagadeeswaran, P.; Cooley, B.C.; Gross, P.L.; Mackman, N. Animal models of thrombosis from zebrafish to nonhuman primates use in the elucidation of new pathologic pathways and the development of antithrombotic drugs. Circ. Res. 2016, 118, 1363–1379. [Google Scholar] [CrossRef]
- Xin, S.S.; Zhang, M.Q.; Li, P.H.; Wang, L.Z.; Zhang, X.M.; Zhang, S.S.; Mu, Z.Q.; Lin, H.W.; Li, X.B.; Liu, K.C. Marine-Fungus-Derived Natural Compound 4-Hydroxyphenylacetic Acid Induces Autophagy to Exert Antithrombotic Effects in Zebrafish. Mar. Drugs 2024, 22, 148. [Google Scholar] [CrossRef]
- Wang, C.; Cheng, Y.Y.; Zhang, Y.H.; Jin, H.T.; Zuo, Z.Y.; Wang, A.P.; Huang, J.M.; Jiang, J.D.; Kong, W.J. Berberine and its main metabolite berberrubine inhibit platelet activation through suppressing the class I PI3Kβ/Rasa3/Rap1 pathway. Front. Pharmacol. 2021, 12, 734603. [Google Scholar] [CrossRef]
- Ling, S.S.; Jin, L.J.; Li, S.Z.; Zhang, F.C.; Xu, Q.; Liu, M.K.; Chen, X.K.; Liu, X.L.; Gu, J.L.; Liu, S.M.; et al. Allium macrostemon saponin inhibits activation of platelet via the CD40 signaling pathway. Front. Pharmacol. 2021, 11, 570603. [Google Scholar] [CrossRef]
- Yamamoto, M.; Jokura, H.; Suzuki, A.; Hase, T.; Shimotoyodome, A. Effects of continuous ingestion of hesperidin and glucosyl hesperidin on vascular gene expression in spontaneously hypertensive rats. J. Nutr. Sci. Vitaminol. 2013, 59, 470–473. [Google Scholar] [CrossRef]
- Zhang, M.Q.; Li, P.H.; Zhang, S.S.; Zhang, X.M.; Wang, L.Z.; Zhang, Y.; Li, X.B.; Liu, K.C. Study on the Mechanism of the Danggui-Chuanxiong Herb Pair on Treating Thrombus through Network Pharmacology and Zebrafish Models. Acs Omega 2021, 6, 14677–14691. [Google Scholar] [CrossRef]
- Zhou, Y.; Little, P.J.; Downey, L.; Afroz, R.; Wu, Y.; Ta, H.T.; Xu, S.; Kamato, D. The role of toll-like receptors in atherothrombotic cardiovascular disease. ACS Pharmacol. Transl. Sci. 2020, 3, 457–471. [Google Scholar] [CrossRef]
- D’Atri, L.P.; Schattner, M. Platelet toll-like receptors in thromboinflammation. Front. Biosci. 2017, 22, 1867–1883. [Google Scholar]
- Vogel, S.; Murthy, P.; Cui, X. TLR4-dependent upregulation of the platelet NLRP3 inflammasome promotes platelet aggregation in a murine model of hindlimb ischemia. Biochem. Biophys. Res. Commun. 2019, 508, 614–619. [Google Scholar] [CrossRef] [PubMed]
- Prakash, P.; Kulkarni, P.P.; Lentz, S.R. Cellular fibronectin containing extra domain A promotes arterial thrombosis in mice through platelet toll-like receptor 4. Blood 2015, 125, 3164–3172. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Liang, Y.Q.; Feng, J.K.; Xie, Z.L.; Li, Q.S.; Chen, Y.L.; Duan, Y.J.; Liu, H.; Zhang, B.C.; Liao, C.Z.; et al. Lycopene inhibits carrageenan-induced thrombi by regulating AKT/FoxO3a and TLR4/NF-κB pathways. J. Funct. Food. 2024, 113, 106021. [Google Scholar] [CrossRef]
- Yang, X.Y.; Li, L.; Liu, J.; Lv, B.; Chen, F.P. Extracellular histones induce tissue factor expression in vascular endothelial cells via TLR and activation of NF-κB and AP-1. Thromb. Res. 2016, 137, 211–218. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Yoo, J.Y.; Suh, J.M.; Park, S.; Kang, D.; Jo, H.; Bae, Y.S. The flagellin-TLR5-Nox4 axis promotes the migration of smooth muscle cells in atherosclerosis. Exp. Mol. Med. 2019, 51, 1–13. [Google Scholar] [CrossRef]
- Zhang, G.Y.; Han, J.Y.; Welch, E.J.; Ye, R.D.; Voyno-Yasenetskaya, T.A.; Malik, A.B.; Du, X.P.; Li, Z.Y. Lipopolysaccharide Stimulates Platelet Secretion and Potentiates Platelet Aggregation via TLR4/MyD88 and the cGMP-Dependent Protein Kinase Pathway. J. Immunol. 2009, 182, 7997–8004. [Google Scholar] [CrossRef]
- Pires, M.E.L.; Clarke, S.R.; Marcondes, S.; Gibbins, J.M. Lipopolysaccharide potentiates platelet responses via toll-like receptor 4-stimulated Akt-Erk-PLA signalling. PLoS ONE 2017, 12, e0186981. [Google Scholar]
- Blair, P.; Rex, S.; Vitseva, O.; Beaulieu, L.; Tanriverdi, K.; Chakrabarti, S.; Hayashi, C.; Genco, C.A.; Iafrati, M.; Freedman, J.E. Stimulation of Toll-Like Receptor 2 in Human Platelets Induces a Thromboinflammatory Response Through Activation of Phosphoinositide 3-Kinase. Circ. Res. 2009, 104, 346–354. [Google Scholar] [CrossRef]
- Seliga, A.K.; Zablocki, K.; Bandorowicz-Pikula, J. Palmitate stimulates expression of the von willebrand factor and modulates Toll-like receptors level and activity in human umbilical vein endothelial cells (HUVECs). Int. J. Mol. Sci. 2024, 25, 254. [Google Scholar] [CrossRef]
- Hers, I.; Vincent, E.E.; Tavar’e, J.M. Akt signallling in health and disease. Cell. Signal. 2011, 23, 1515–1527. [Google Scholar] [CrossRef]
NO. | RT (min) | Compound | Areas of Peak | Percentage of Peak Area | Error (ppm) | Molecular Formula | Molecular Weight | Classification |
---|---|---|---|---|---|---|---|---|
1 | 7.33 | Unidentified | 418,613 | 0.18% | −1.2 | C24H14N2O4 | 394.1 | Alkaloid |
2 | 9.68 | Unidentified | 5,075,087 | 2.14% | 4 | C20H28N2O4 | 360.2 | Alkaloid |
3 | 10.23 | N-Acetyl-DL-tryptophan | 12,821 | 0.01% | −0.2 | C13H14N2O3 | 246.1 | Amino acid derivatives |
4 | 11.56 | Unidentified | 575,710 | 0.24% | 7.5 | C17H16N4O2 | 308.13 | Alkaloid |
5 | 11.84 | Ochangoside analogues | 22,853 | 0.01% | 5 | C20H14N4O6 | 406.09 | Alkaloid |
6 | 12.52 | Sasanquin or isomer | 2,293,896 | 0.97% | 0 | C21H30O11 | 458.18 | Sugar derivatives |
7 | 13.01 | Unidentified | 1,382,987 | 0.58% | −0.5 | C15H20O5 | 280.13 | / |
8 | 13.59 | Camellianoside or isomer | 411,681 | 0.17% | 2.1 | C32H38O20 | 742.2 | Flavonoid |
9 | 14.36 | Turkesterone | 3,016,210 | 1.27% | 2.3 | C27H44O8 | 496.3 | Steroid |
10 | 14.78 | β-Ecdysone | 22,736,901 | 9.55% | 3 | C27H44O7 | 480.31 | Steroid |
11 | 14.97 | Manghaslin or isomer | 3,858,890 | 1.62% | 1.7 | C33H40O20 | 756.21 | Flavonoid |
12 | 15.6 | Rutin | 11,197,633 | 4.70% | 0.4 | C27H30O16 | 610.15 | Flavonoid |
13 | 16.24 | Unidentified | 4,202,950 | 1.77% | 0.4 | C19H32O7 | 372.21 | / |
14 | 16.8 | Ochangoside analogues | 3,428,915 | 1.44% | 4.4 | C22H16N4O7 | 448.1 | Alkaloid |
15 | 17.06 | β-Ecdysone isomer | 2,751,005 | 1.16% | −1.1 | C27H44O7 | 480.31 | Steroid |
16 | 17.87 | Unidentified | 2,539,013 | 1.07% | −0.3 | C33H54O11 | 626.37 | Saponin |
17 | 18.99 | Quercetin 3-xylosyl-(1->2)-alpha-L-arabinofuranoside | 8,081,510 | 3.39% | 2 | C25H26O15 | 566.13 | Flavonoid |
18 | 20.17 | (2S,3R,10R,13R,14S)-2,3,14-Trihydroxy-10,13-dimethyl-17-[(2R,3R,5R)-2,3,5-trihydroxy-5,6-dimethylheptan-2-yl]-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one or isomer | 7,280,938 | 3.06% | 1.6 | C28H46O7 | 494.32 | Steroid |
19 | 20.44 | (2S,3R,10R,13R,14S)-2,3,14-Trihydroxy-10,13-dimethyl-17-[(2R,3R,5R)-2,3,5-trihydroxy-5,6-dimethylheptan-2-yl]-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one or isomer | 7,143,672 | 3.00% | 1.4 | C28H46O7 | 494.32 | Steroid |
20 | 20.46 | Kaempferol-3-O-rutinoside or isomer | 2,585,993 | 1.09% | −0.8 | C27H30O15 | 594.16 | Flavonoid |
21 | 21.21 | Xanthorhamnin or isomer | 548,948 | 0.23% | −1.5 | C34H42O20 | 770.23 | Flavonoid |
22 | 21.73 | Ochangoside analogues | 616,553 | 0.26% | 3.8 | C23H26N4O6 | 454.19 | Alkaloid |
23 | 22.02 | Unidentified | 1,164,620 | 0.49% | −0.3 | C18H34O9 | 394.22 | / |
24 | 22.32 | Ochangoside analogues | 77,581 | 0.03% | 3.2 | C23H24N4O6 | 452.17 | Alkaloid |
25 | 23.21 | Ajugasalicioside F or isomer | 1,794,673 | 0.75% | 0.9 | C35H58O12 | 670.39 | Saponin |
26 | 23.34 | Unidentified | 3,569,670 | 1.50% | 3.6 | C34H44O15 | 692.27 | Steroid |
27 | 23.63 | Unidentified | 3,252,710 | 1.37% | 1.8 | C24H42O14 | 554.26 | / |
28 | 24.03 | Unidentified | 1,485,841 | 0.62% | 0.1 | C26H52O10 | 524.36 | / |
29 | 24.49 | Unidentified | 2,092,369 | 0.88% | 0.7 | C33H54O10 | 610.37 | / |
30 | 24.86 | Unidentified | 1,877,497 | 0.79% | 1.3 | C41H70O17 | 834.46 | Saponin |
31 | 25.15 | Unidentified | 1,662,002 | 0.70% | 1.6 | C41H68O17 | 832.45 | Saponin |
32 | 25.3 | Unidentified | 2,308,288 | 0.97% | 1.3 | C24H41NO9 | 487.28 | Alkaloid |
33 | 25.52 | Azukisaponin III or isomer | 281,837 | 0.12% | −0.4 | C42H66O15 | 810.44 | Saponin |
34 | 25.65 | Ochangoside analogues | 8,168,834 | 3.43% | 6.5 | C22H26N4O7 | 458.18 | Alkaloid |
35 | 25.93 | Unidentified | 16,793,342 | 7.05% | 6.6 | C22H26N4O7 | 458.18 | Alkaloid |
36 | 26.29 | Unidentified | 6,432,661 | 2.70% | 2.8 | C19H21NO5 | 343.14 | Alkaloid |
37 | 26.62 | Ochangoside analogues | 7,985,342 | 3.35% | 6.7 | C22H26N4O7 | 458.18 | Alkaloid |
38 | 27.09 | Ochangoside analogues | 11,309,288 | 4.75% | 7.4 | C22H26N4O7 | 458.18 | Alkaloid |
39 | 27.32 | 9,12,13-Trihydroxy-10,15-octadecadienoic acid or isomer | 2,227,110 | 0.94% | 1.9 | C18H32O5 | 328.22 | Fatty acid |
40 | 27.49 | 9,12,13-Trihydroxy-10,15-octadecadienoic acid or isomer | 2,072,285 | 0.87% | 2 | C18H32O5 | 328.22 | Fatty acid |
41 | 27.89 | 9,12,13-Trihydroxy-10,15-octadecadienoic acid or isomer | 3,938,724 | 1.65% | 2.5 | C18H32O5 | 328.22 | Fatty acid |
42 | 28.03 | 9,12,13-Trihydroxy-10-octadecenoic acid or isomer | 12,151,177 | 5.10% | 2.8 | C18H34O5 | 330.24 | Fatty acid |
43 | 28.35 | 9,12,13-Trihydroxy-10,15-octadecadienoic acid or isomer | 2,951,132 | 1.24% | 2.2 | C18H32O5 | 328.22 | Fatty acid |
44 | 28.6 | 9,12,13-Trihydroxy-10,15-octadecadienoic acid or isomer | 1,480,947 | 0.62% | 0.8 | C18H32O5 | 328.22 | Fatty acid |
45 | 28.83 | Unidentified | 2,243,838 | 0.94% | 1.3 | C34H44O11 | 628.29 | / |
46 | 29.16 | Spinasaponin A or isomer | 347,8076 | 1.46% | 1.2 | C42H66O14 | 794.45 | Saponin |
47 | 29.41 | Unidentified | 955,201 | 0.40% | 4.6 | C30H42O12 | 594.27 | / |
48 | 29.53 | Unidentified | 710,610 | 0.30% | 5.2 | C30H42O12 | 594.27 | / |
49 | 29.82 | (3β,12α)-12-Hydroxy-28-oxo-13,28-epoxyoleanan-3-yl α-D-mannopyranosiduronic acid or isomer | 878,366 | 0.37% | −0.6 | C36H56O10 | 648.39 | Saponin |
50 | 30.32 | Unidentified | 772,582 | 0.32% | −2.7 | C23H44O19 | 624.25 | Saponin |
51 | 30.9 | Unidentified | 437,050 | 0.18% | −2.3 | C17H28O5 | 312.19 | / |
52 | 31.53 | Trp-lys-asp-phe or isomer | 1,046,036 | 0.44% | −1.3 | C30H38N6O7 | 594.28 | Peptide |
53 | 31.86 | Asp-trp-phe-lys or isomer | 1,424,328 | 0.60% | −1.5 | C30H38N6O7 | 594.28 | Peptide |
54 | 32.53 | Unidentified | 13,602,821 | 5.71% | 6.4 | C30H42O11 | 578.27 | / |
55 | 33.67 | Unidentified | 2,948,779 | 1.24% | 5.2 | C30H44O11 | 580.29 | Sugar derivatives |
56 | 34.19 | Forskoditerpenoside C or isomer | 20,829,413 | 8.75% | 6.5 | C28H44O11 | 556.29 | Diterpenoid |
57 | 35.45 | Unidentified | 1,711,740 | 0.72% | 8.1 | C20H24O3 | 312.17 | Cyclopentanoperhydro-phenanthrene |
58 | 37.54 | Unidentified | 1,404,050 | 0.59% | 6.2 | C21H26O3 | 326.19 | Cyclopentanoperhydro-phenanthrene |
Primer Name | Forward Primer (5′→3′) | Reverse Primer (3′→5′) |
---|---|---|
Rpl13a | AGAGCTATGAGCTGCCTGACG | CCGCAAGATTCCATACCCA |
tlr2 | TGCTGTCGGTCGATTACCTG | ACACAGGGAAAACGAAGGCT |
tlr5 | GCAACAAACACCAGGACTCG | CGCGCCCGTCTCTAATTGTA |
tlr4ba | TGCTGCGAGAGATCGGAAGAAA | ACAAAAGCAGATCGAATATCCAGC |
map2k7 | CATCGTGATCCAGCTCAGTCC | TGAGGGGAGCTTTCTGACGA |
ap-1 | CCACCGCTCTCTCCTATC | ATCCTCTCCAGTTTCCTCTT |
mapk10 | CATTCTGGGCATGGGCTACA | CCTGCCGGGGAATAGGATTTT |
vwf | GTTCCTGCTGAGAGCGTCTT | ACGACCGATGTTTGTGCTCT |
myd88 | ACGGCTAATCCCTGTCGTCT | CAGATGGTCAGAAAGCGCAG |
mapk1 | TACGTCTGGTGCTCAAACGG | AATGCGTCCCGACAGAGACA |
mapk14 | AACGTGACGGTGGACATTTG | AGCTGATGTAAGTACGAGCCT |
pik3cb | GGAGGCGCAGACATATCCTC | AGAACAGGCAGGAATGGTCG |
akt2 | TAAGCAGACGTGAGCAGGTG | AAGCTCGTTCCACCCTTCAA C |
map2k2b | CTCTAAAAGGCCAAACGCCC | AGTTGTGTGTGGTGGTCTCC |
nf-κb | ATAGATGAGAACGGAGACACG | CGCTACTAACTTGGGTTGCTT |
IL-1β | GTGGACTTCGCAGCACAAAA | AAGACGGCACTGAATCCACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Wang, M.; Dong, Y.; Yu, S.; Zhang, S.; Sun, P.; Wang, L.; Liu, J.; Lin, H.; Pan, X.; et al. Antithrombotic Effect of Chenopodium album L. Extract and Its Fractions via Regulating TLRs and the Downstream MAPKs and PI3K/AKT Signaling Pathways in Zebrafish. Int. J. Mol. Sci. 2025, 26, 2118. https://doi.org/10.3390/ijms26052118
Wang X, Wang M, Dong Y, Yu S, Zhang S, Sun P, Wang L, Liu J, Lin H, Pan X, et al. Antithrombotic Effect of Chenopodium album L. Extract and Its Fractions via Regulating TLRs and the Downstream MAPKs and PI3K/AKT Signaling Pathways in Zebrafish. International Journal of Molecular Sciences. 2025; 26(5):2118. https://doi.org/10.3390/ijms26052118
Chicago/Turabian StyleWang, Xiyue, Miaoyunhuan Wang, Yuqing Dong, Shuqing Yu, Shanshan Zhang, Pinghua Sun, Lu Wang, Jibin Liu, Houwen Lin, Xinhui Pan, and et al. 2025. "Antithrombotic Effect of Chenopodium album L. Extract and Its Fractions via Regulating TLRs and the Downstream MAPKs and PI3K/AKT Signaling Pathways in Zebrafish" International Journal of Molecular Sciences 26, no. 5: 2118. https://doi.org/10.3390/ijms26052118
APA StyleWang, X., Wang, M., Dong, Y., Yu, S., Zhang, S., Sun, P., Wang, L., Liu, J., Lin, H., Pan, X., & Li, X. (2025). Antithrombotic Effect of Chenopodium album L. Extract and Its Fractions via Regulating TLRs and the Downstream MAPKs and PI3K/AKT Signaling Pathways in Zebrafish. International Journal of Molecular Sciences, 26(5), 2118. https://doi.org/10.3390/ijms26052118